TRIM39-RPP21 Variants (∆19InsCCC) Are Not Associated with Juvenile Idiopathic Epilepsy in Egyptian Arabian Horses.
Abstract: Juvenile idiopathic epilepsy (JIE) is an inherited disease characterized by recurrent seizures during the first year of life in Egyptian Arabian horses. Definitive diagnosis requires an electroencephalogram (EEG) performed by a veterinary specialist. A recent study has suggested that a 19 base-pair deletion, along with a triple-C insertion, in intron five of twelve (∆19InsCCC; chr20:29542397-29542425: GTTCAGGGGACCACATGGCTCTCTATAGA>TATCTTAAGACCC) of the () gene is associated with JIE. To confirm this association, a new sample set consisting of nine EEG-phenotyped affected and nine unaffected Egyptian Arabian horses were genotyped using Sanger sequencing. There was no significant genotypic ( = 1.00) or allelic ( = 0.31) association with the ∆19InsCCC variant and JIE status. The previously reported markers in are therefore not associated with JIE in well-phenotyped samples. The ∆19InsCCC variant is a common variant that happens to be positioned in a highly polymorphic region in the Arabian breed.
Publication Date: 2019-10-16 PubMed ID: 31623255PubMed Central: PMC6826448DOI: 10.3390/genes10100816Google Scholar: Lookup
The Equine Research Bank provides access to a large database of publicly available scientific literature. Inclusion in the Research Bank does not imply endorsement of study methods or findings by Mad Barn.
- Journal Article
- Research Support
- N.I.H.
- Extramural
- Research Support
- Non-U.S. Gov't
Summary
This research summary has been generated with artificial intelligence and may contain errors and omissions. Refer to the original study to confirm details provided. Submit correction.
The research investigates the association between a variant in the TRIM39-RPP21 gene and juvenile idiopathic epilepsy (JIE) in Egyptian Arabian horses, but found no significant link between them.
Introduction to the Disorder
- Juvenile idiopathic epilepsy (JIE) is a genetic condition that manifests in the form of repetitive seizures within the first year of life in Egyptian Arabian horses.
- This illness is definitively diagnosed through the use of an electroencephalogram (EEG) conducted by a veterinary specialist.
Earlier Assumptions About the Disorder
- A previous study postulated that a 19 base-pair deletion with a triple-C insertion (referred to as ∆19InsCCC) in intron five of twelve in the TRIM39-RPP21 gene was linked with this disorder.
Current Study’s Objective
- The main purpose of the present research was to validate the previously suggested association between the ∆19InsCCC variant and JIE.
- For this, the researchers conducted genotyping on a new sample that consisted of nine EEG-tested affected and nine unaffected Egyptian Arabian horses, using a method known as Sanger sequencing.
Findings of the Study
- The findings of the research indicated no significant genotypic or allelic association between the ∆19InsCCC variant and the JIE status, which contradicts the earlier assumptions about the links between these genetic markers and JIE.
- The study therefore concludes that the ∆19InsCCC variant in the TRIM39-RPP21 gene, which is common and situated in a highly polymorphic region in the Arabian breed, is not associated with JIE.
Cite This Article
APA
Rivas VN, Aleman M, Peterson JA, Dahlgren AR, Hales EN, Finno CJ.
(2019).
TRIM39-RPP21 Variants (∆19InsCCC) Are Not Associated with Juvenile Idiopathic Epilepsy in Egyptian Arabian Horses.
Genes (Basel), 10(10), 816.
https://doi.org/10.3390/genes10100816 Publication
Researcher Affiliations
- Department of Population, Health and Reproduction, University of California, Davis, CA 95616, USA. vnrivasgutierrez@ucdavis.edu.
- Department of Veterinary Medicine and Epidemiology, University of California, Davis, CA 95616, USA. mraleman@ucdavis.edu.
- Department of Population, Health and Reproduction, University of California, Davis, CA 95616, USA. janel.peterson@bcm.edu.
- Department of Population, Health and Reproduction, University of California, Davis, CA 95616, USA. adahlgren@ucdavis.edu.
- Department of Population, Health and Reproduction, University of California, Davis, CA 95616, USA.
- Department of Population, Health and Reproduction, University of California, Davis, CA 95616, USA. cjfinno@ucdavis.edu.
MeSH Terms
- Animals
- Egypt
- Electroencephalography
- Epilepsy / diagnosis
- Epilepsy / genetics
- Epilepsy / veterinary
- Genotype
- Horse Diseases / genetics
- Horses / genetics
- Ribonuclease P / genetics
- Seizures / genetics
- Seizures / veterinary
- Sequence Deletion
- Ubiquitin-Protein Ligases / genetics
Grant Funding
- L40 TR001136 / NCATS NIH HHS
- R25 GM056765 / NIGMS NIH HHS
- L40 TR001136 / NIH HHS
Conflict of Interest Statement
The authors declare no conflict of interest.
References
This article includes 12 references
- Aleman M, Gray LC, Williams DC, Holliday TA, Madigan JE, LeCouteur RA, Magdesian KG. Juvenile idiopathic epilepsy in Egyptian Arabian foals: 22 cases (1985-2005).. J Vet Intern Med 2006 Nov-Dec;20(6):1443-9.
- Sengoku A. The contribution of J. H. Jackson to present-day epileptology.. Epilepsia 2002;43 Suppl 9:6-8.
- Berg AT, Berkovic SF, Brodie MJ, Buchhalter J, Cross JH, van Emde Boas W, Engel J, French J, Glauser TA, Mathern GW, Moshé SL, Nordli D, Plouin P, Scheffer IE. Revised terminology and concepts for organization of seizures and epilepsies: report of the ILAE Commission on Classification and Terminology, 2005-2009.. Epilepsia 2010 Apr;51(4):676-85.
- Shorvon SD. The etiologic classification of epilepsy.. Epilepsia 2011 Jun;52(6):1052-7.
- Trinka E, Cock H, Hesdorffer D, Rossetti AO, Scheffer IE, Shinnar S, Shorvon S, Lowenstein DH. A definition and classification of status epilepticus--Report of the ILAE Task Force on Classification of Status Epilepticus.. Epilepsia 2015 Oct;56(10):1515-23.
- Hirose S, Mitsudome A, Okada M, Kaneko S. Genetics of idiopathic epilepsies.. Epilepsia 2005;46 Suppl 1:38-43.
- Lacombe VA. Seizures in horses: diagnosis and classification.. Vet Med (Auckl) 2015;6:301-308.
- Gardiner M. Genetics of idiopathic generalized epilepsies.. Epilepsia 2005;46 Suppl 9:15-20.
- Polani S, Dean M, Lichter-Peled A, Hendrickson S, Tsang S. Sequence Variant in the TRIM39-RPP21 Gene Readthrough is Shared across a Cohort of Arabian Foals Diagnosed with Juvenile Idiopathic Epilepsy. J. Gene Mutat. 2018;1:103.
- Untergasser A, Cutcutache I, Koressaar T, Ye J, Faircloth BC, Remm M, Rozen SG. Primer3--new capabilities and interfaces.. Nucleic Acids Res 2012 Aug;40(15):e115.
- Kent WJ, Sugnet CW, Furey TS, Roskin KM, Pringle TH, Zahler AM, Haussler D. The human genome browser at UCSC.. Genome Res 2002 Jun;12(6):996-1006.
- Robinson JT, Thorvaldsdóttir H, Winckler W, Guttman M, Lander ES, Getz G, Mesirov JP. Integrative genomics viewer.. Nat Biotechnol 2011 Jan;29(1):24-6.
Citations
This article has been cited 2 times.- Durward-Akhurst SA, Marlowe JL, Schaefer RJ, Springer K, Grantham B, Carey WK, Bellone RR, Mickelson JR, McCue ME. Predicted genetic burden and frequency of phenotype-associated variants in the horse. Sci Rep 2024 Apr 10;14(1):8396.
- Aleman M, Benini R, Elestwani S, Vinardell T. Juvenile idiopathic epilepsy in Egyptian Arabian foals, a potential animal model of self-limited epilepsy in children. J Vet Intern Med 2024 Jan-Feb;38(1):449-459.
Use Nutrition Calculator
Check if your horse's diet meets their nutrition requirements with our easy-to-use tool Check your horse's diet with our easy-to-use tool
Talk to a Nutritionist
Discuss your horse's feeding plan with our experts over a free phone consultation Discuss your horse's diet over a phone consultation
Submit Diet Evaluation
Get a customized feeding plan for your horse formulated by our equine nutritionists Get a custom feeding plan formulated by our nutritionists
