DNA in horses refers to the genetic material that carries the hereditary information necessary for the growth, development, functioning, and reproduction of equine species. It consists of sequences of nucleotides that encode the genetic instructions used in the development and functioning of horses. DNA analysis in horses can provide insights into genetic diversity, lineage, and breed characteristics. It is also utilized in identifying genetic disorders, understanding hereditary traits, and assisting in selective breeding programs. This page compiles peer-reviewed research studies and scholarly articles that explore the structure, function, and applications of DNA analysis in equine genetics and breeding.
Harrison SP, Turrion-Gomez JL.The mitochondrial DNA (mtDNA) molecule, carrying genes encoding for respiratory chain enzymes, is a primary candidate for demonstrating associations between genotype and athletic performance in mammalian species. In humans, variation at seven protein encoding mitochondrial loci has been implicated in influencing fitness and performance characteristics. Although thoroughbred horses are selected for racing ability, there have not been any previous reported associations between genotypes and racecourse performance. The multi-factorial nature of the inheritance of racing ability is an obvious comp...
Wagner ML, Raudsepp T, Goh G, Agarwala R, Schaffer AA, Dranchak PK, Brinkmeyer-Langford C, Skow LC, Chowdhary BP, Mickelson JR.A comparative approach that utilizes information from more densely mapped or sequenced genomes is a proven and efficient means to increase our knowledge of the structure of the horse genome. Human chromosome 2 (HSA2), the second largest human chromosome, comprising 243 Mb, and containing 1246 known genes, corresponds to all or parts of three equine chromosomes. This report describes the assignment of 140 new markers (78 genes and 62 microsatellites) to the equine radiation hybrid (RH) map, and the anchoring of 24 of these markers to horse chromosomes by FISH. The updated equine RH maps for ECA...
Park MK, Kim EH, Cho MR, Yi YH, Lee MJ, Shah DH, Park JH, Park BK, Eo SK, Lee JH, Chae JS.Neorickettsia (Ehrlichia) risticii is a causative agent of acute diarrheal syndrome in horses, commonly known as Potomac horse fever. Korean isolate of N. risticii NR-JA1 was cultivated in mouse macrophage cell line P388D1. A complete ORF of p51 antigenic protein gene was amplified and cloned into pQE32 and pcDNA3.1 vectors and the resultant clones were named as pQE32/Nr-51 and pcDNA3.1/Nr-51, respectively. Recombinant p51 (rp51) protein antigen was expressed in E. coli (pQE32/Nr-51) and cos-7 cell line (pcDNA3.1/Nr-51). The rp51 protein showed immunoreactivity with anti- mouse p51 antibodies....
The Journal of heredityFebruary 17, 2006
Volume 97, Issue 2 107-113 doi: 10.1093/jhered/esj020
Luís C, Bastos-Silveira C, Cothran EG, Oom Mdo M.Fossil records, archaeological proofs, and historical documents report that horses persisted continuously in the Iberian Peninsula since the Pleistocene and were taken to the American continent (New World) in the 15th century. To investigate the variation within the mitochondrial DNA (mtDNA) control region of Iberian and New World horse breeds, to analyze their relationships, and to test the historical origin of New World horses, a total of 153 samples, representing 30 Iberian and New World breeds, were analyzed by sequencing mtDNA control region fragments. Fifty-four haplotypes were found and...
Pusterla N, Leutenegger CM, Wilson WD, Watson JL, Ferraro GL, Madigan JE.Based on the hypothesis that the viral load of cells infected with EHV-4 will likely change during the course of disease, TaqMan PCR was used to investigate and characterize the kinetics of EHV-4 viral DNA load (glycoprotein B gene) and transcriptional activity (glycoprotein B and latency-associated transcripts) in peripheral blood leukocytes (PBLs) and nasopharyngeal secretions (NSs) collected from 11 foals during a field outbreak of respiratory disease. The EHV-4 DNA load in PBLs was low and of short duration after onset of clinical signs. In contrast, the EHV-4 load in NSs remained high for...
Werners AH, Bull S, Vendrig JC, Smyth T, Bosch RR, Fink-Gremmels J, Bryant CE.The inter- and intra-species differences in the response to lipopolysaccharides (LPS) are well recognised in mammalian species. It has been hypothesized that these differences can be attributed to genetic polymorphisms in the components involved in LPS signal transduction. These components include the cluster of differentiation factor 14 (CD-14), a membrane bound protein on the surface of mononuclear cells that recognises LPS and a receptor complex consisting of Toll-like receptor-4 (TLR-4) and myeloid differentiation factor-2 (MD-2). Sequencing of these three proteins in humans and mice revea...
Scholz HC, Joseph M, Tomaso H, Al Dahouk S, Witte A, Kinne J, Hagen RM, Wernery R, Wernery U, Neubauer H.A polymerase chain reaction (PCR) assay targeting the flagellin P (fliP)-I S407A genomic region of Burkholderia mallei was developed for the specific detection of this organism in pure cultures and clinical samples from a recent outbreak of equine glanders. Primers deduced from the known fliP-IS407A sequence of B. mallei American Type Culture Collection (ATCC) 23344(T) allowed the specific amplification of a 989-bp fragment from each of the 20 B. mallei strains investigated, whereas other closely related organisms tested negative. The detection limit of the assay was 10 fg for purified DNA of ...
Lin YL, Moolenaar H, van Weeren PR, van de Lest CH.To determine effects of microcurrent electrical tissue stimulation (METS) on equine tenocytes cultured from the superficial digital flexor tendon (SDFT). Methods: SDFTs were collected from 20 horses at slaughter. Methods: Tenocytes were isolated following outgrowth from explants and grown in 48-well plates. Four methods of delivering current to the tenocytes with a METS device were tested. Once the optimal method was selected, current consisting of 0 (negative control), 0.05, 0.1, 0.5, 1.0, or 1.5 mA was applied to cells (8 wells/current intensity) once daily for 8 minutes. Cells were treated ...
Kelly C, Bugg M, Robinson C, Mitchell Z, Davis-Poynter N, Newton JR, Jolley KA, Maiden MC, Waller AS.Improved understanding of the epidemiology of Streptococcus equi transmission requires sensitive and portable subtyping methods that can rationally discriminate between strains. S. equi is highly homogeneous and cannot be distinguished by multilocus enzyme electrophoretic or multilocus sequence-typing methods that utilize housekeeping genes. However, on sequence analysis of the N-terminal region of the SeM genes of 60 S. equi isolates from 27 strangles outbreaks, we identified 21 DNA codon changes. These resulted in the nonsynonymous substitution of 18 amino acids and allowed the assignment of...
Hodgkinson JE.The future implementation of improved and sustainable control strategies for the major equine parasites will be dependent on a greater insight into their basic biology, pathogenicity and epidemiology together with an enhanced ability for accurate diagnosis. This paper will provide a review of the current molecular methods under development for the detection of equine parasites and their application to current scientific questions. In particular, the strongyles are recognised as important pathogens of horses and recent advances made in the study of this parasitic group at the single species lev...
Dias GM, Retamal CA, Tobella L, Arnholdt AC, López ML.'The highly packed chromatin of mature spermatozoa results from replacement of somatic-like histones by highly basic arginine- and cysteine-rich protamines during spermatogenesis, with additional conformational changes in chromatin structure during epididymal transit. The objective of the present study was to compare the nuclear characteristics of immature and mature epididymal stallion spermatozoa, using a variety of experimental approaches. Resistance to in vitro decondensation of chromatin, following exposure to SDS-DTT and alkaline thioglycolate, increased significantly in mature spermatoz...
von Samson-Himmelstjerna G.Conventional and real time polymerase chain reaction-based tests have been developed for the diagnosis of anthelmintic resistance (AR) in populations of several small and large ruminant as well as horse gastro-intestinal nematode species. To date, molecular markers that correlate well with AR are available only for the detection of benzimidazole resistance. Recently, however, a single nucleotide polymorphism was found in vitro to be of functional relevance for reduced drug efficacy to macrocylic lactones. The focus of the present review, therefore, is the molecular mechanism of action of these...
Grønbaek LM, Angen O, Vigre H, Olsen SN.Streptococcus equi is the cause of strangles in horses. To improve diagnostic sensitivity, development and evaluation of DNA-based methods are necessary. Objective: To evaluate diagnostic methods and observe the pattern of bacterial shedding during natural outbreaks. Methods: Two herds with natural outbreaks of strangles were visited over a period of 15 weeks and 323 samples originating from 35 horses investigated. The diagnostic use of a nested PCR test was evaluated using a collection of 165 isolates of Lancefield group C streptococci (species specificity) and swabs from nasal passages or fr...
Carbone L, Nergadze SG, Magnani E, Misceo D, Francesca Cardone M, Roberto R, Bertoni L, Attolini C, Francesca Piras M, de Jong P, Raudsepp T....Centromere repositioning (CR) is a recently discovered biological phenomenon consisting of the emergence of a new centromere along a chromosome and the inactivation of the old one. After a CR, the primary constriction and the centromeric function are localized in a new position while the order of physical markers on the chromosome remains unchanged. These events profoundly affect chromosomal architecture. Since horses, asses, and zebras, whose evolutionary divergence is relatively recent, show remarkable morphological similarity and capacity to interbreed despite their chromosomes differing co...
Christopherson PW, Insalaco TA, van Santen VL, Livesey L, Bourne C, Boudreaux MK.Glanzmann thrombasthenia (GT) is an inherited, intrinsic platelet defect characterized by a quantitative or qualitative change in the platelet glycoprotein complex IIb-IIIa (integrin alpha(IIb)beta3). The subunits are encoded by separate genes and both subunits must be expressed for a stable complex to form on the platelet surface; therefore, a defect in either gene can result in GT.
Gupta AK, Chauhan M, Tandon SN.Genetic diversity within the Marwari breed of horses was evaluated using 26 different microsatellite pairs with 48 DNA samples from unrelated horses. This molecular characterisation was undertaken to evaluate the problem of genetic bottlenecks also, if any, in this breed. The estimated mean (-/+ s.e.) allelic diversity was 5.9 (-/+ 2.24), with a total of 133 alleles. A high level of genetic variability within this breed was observed in terms of high values of mean (-/+ s.e.) effective number of alleles (3.3 -/+ 1.27), observed heterozygosity (0.5306 -/+ 0.22), expected Levene's heterozygosity ...
Gupta AK, Kaur D, Rattan B, Yadav MP.Three abortigenic Indian isolates of equine herpesvirus-1 (EHV-1) (Tohana, Hisar and Bikaner), along with two exotic abortigenic isolates (AB4 and V592) and another EHV-1 isolate (Jind) obtained from a case of perinatal foal mortality, were studied for variability. For this purpose, PCR and restriction endonuclease (RE) digestion techniques were used simultaneously as a DNA fingerprinting system. Nine different regions of EHV-1 virus were amplified by PCR using primer pairs specific for the regions and the products obtained from these regions were subsequently subjected to various restriction ...
Galosi CM, de la Paz VC, Fernández LC, Martinez JP, Craig MI, Barrandeguy M, Etcheverrrigaray ME.This study describes the isolation of equine herpesvirus-2 (EHV-2) from the lung of an aborted equine fetus in Argentina. The isolated virus was confirmed as EHV-2 by indirect immunofluorescence using a rabbit anti-EHV-2 polyclonal antiserum and by virus-neutralization test using an equine polyclonal antibody against EHV-2. Restriction endonuclease DNA fingerprinting with BamHI also confirmed the identity of the virus as EHV-2. Furthermore, viral nucleic acid was detected by polymerase chain reaction from the original lung sample and from the DNA obtained from cells infected with the virus iso...
Swinburne JE, Boursnell M, Hill G, Pettitt L, Allen T, Chowdhary B, Hasegawa T, Kurosawa M, Leeb T, Mashima S, Mickelson JR, Raudsepp T, Tozaki T....A genetic linkage map of the horse consisting of 742 markers, which comprises a single linkage group for each of the autosomes and the X chromosome, is presented. The map has been generated from two three-generation full-sibling reference families, sired by the same stallion, in which there are 61 individuals in the F2 generation. Each linkage group has been assigned to a chromosome and oriented with reference to markers mapped by fluorescence in situ hybridization. The average interval between markers is 3.7 cM and the linkage groups collectively span 2772 cM. The 742 markers comprise 734 mic...
Elia G, Decaro N, Martella V, Campolo M, Desario C, Lorusso E, Cirone F, Buonavoglia C.A real-time PCR assay was developed for detection and quantitation of equid herpesvirus type 1 (EHV-1). The sensitivity of the assay was compared with an established nested-PCR (n-PCR). The real-time PCR detected 1 copy of target DNA, with a sensitivity 1 log higher than gel-based n-PCR. The assay was able to detect specifically EHV-1 DNA in equine tissue samples and there was no cross-amplification of other horse herpesviruses. Real-time PCR was applied to determine EHV-1 load in tissue samples from equine aborted fetuses. The high sensitivity and reproducibility of the EHV-1-specific fluorog...
Milenkovic D, Mata X, Chadi S, Guérin G.Laminins are large heterotrimeric basement membrane glycoproteins composed of alpha, beta and gamma chains. The Laminin 5 isoform has an alpha3beta3gamma2 composition and is essential for the adhesion of basal keratinocytes to the underlying epithelial basement membrane where it is mainly located. Mutations in the genes coding for the 3 chains have been associated with a severe skin blistering disease, Herlitz's junctional epidermolysis bullosa (JEB), observed in different species as man, dog, cat and horse. In this study, we report the sequence of the 5.2 kb horse laminin alpha 3 cDNA (LAMA3)...
Brooks SA, Bailey E.Sabino (SB) is a white spotting pattern in the horse characterized by white patches on the face, lower legs, or belly, and interspersed white hairs on the midsection. Based on comparable phenotypes in humans and pigs, the KIT gene was investigated as the origin of the Sabino phenotype. In this article we report the genetic basis of one type of Sabino spotting pattern in horses that we call Sabino 1, with the alleles represented by the symbols SB1 and sb1. Transcripts of KIT were characterized by reverse transcriptase polymerase chain reaction (RT-PCR) and sequencing cDNA from horses with the g...
Tallmadge RL, Lear TL, Antczak DF.The availability of a contig of bacterial artificial chromosome (BAC) clones spanning the equine major histocompatibility complex (MHC) made possible a detailed analysis of horse MHC class I genes. Prior to this study, only a single horse MHC class I gene had been sequenced at the genomic level. Although many ( approximately 60) MHC class I cDNA sequences had been determined and published, from this information, it was not possible to determine how many class I loci are expressed in horses or to assign individual sequences to allelic series. In this study, 15 MHC class I genes were identified ...
Lin YL, Brama PA, Kiers GH, DeGroot J, van Weeren PR.To quantify and compare biochemical characteristics of the extracellular matrix (ECM) of specimens harvested from tensional and compressive regions of the superficial digital flexor tendon (SDFT) of horses in age classes that include neonates to mature horses. Methods: Tendon specimens were collected on postmortem examination from 40 juvenile horses (0, 5, 12, and 36 months old) without macroscopically visible signs of tendonitis. Methods: Central core specimens of the SDFT were obtained with a 4-mm-diameter biopsy punch from 2 loaded sites, the central part of the mid-metacarpal region and th...
The Journal of heredityOctober 26, 2005
Volume 96, Issue 6 663-669 doi: 10.1093/jhered/esi116
Royo LJ, Alvarez I, Beja-Pereira A, Molina A, Fernández I, Jordana J, Gómez E, Gutiérrez JP, Goyache F.Despite a number of recent studies that have focused on the origin of domestic horses, genetic relationships between major geographical clusters still remain poorly understood. In this study we analyzed a 296 bp mtDNA fragment from the HVI region of 171 horses representing 11 native Iberian, Barb, and Exmoor breeds to assess the maternal phylogeography of Iberian horses. The mtDNA haplogroup with a CCG motif (nucleotide position 15,494 to 15,496) was the most frequent in Iberian and Barb breeds (0.42 and 0.57, respectively), regardless of geographic location or group of breeds. This finding su...
Halbert ND, Reitzel RA, Martens RJ, Cohen ND.To evaluate sensitivity and specificity of a multiplex polymerase chain reaction (PCR) assay for simultaneous detection of Rhodococcus equi and differentiation of strains that contain the virulence-associated gene (vapA) from strains that do not. Methods: 187 isolates of R equi from equine and nonequine tissue and environmental specimens and 27 isolates of bacterial species genetically or morphologically similar to R equi. Methods: The multiplex PCR assay included 3 gene targets: a universal 311-bp bacterial 16S ribosomal RNA amplicon (positive internal control), a 959-bp R equi-specific targe...
Fitzgibbon JE, Sagripanti JL.The development of a method in macroarray format for the identification of alphaviruses and orthopoxviruses in samples of concern in biodefense is reported. Capture oligonucleotides designed to bind generic members of the orthopox- or alphavirus families and a collection of additional oligonucleotides to bind specifically nucleic acids from five individual alphaviruses, including Venezuelan equine encephalitis, or DNA from each of four orthopoxviruses, including variola virus (VAR) were deposited onto nylon membranes. Hybridization of digoxigenin labeled PCR products to the macroarray produced...
Pielberg G, Mikko S, Sandberg K, Andersson L.Grey horses are born coloured, turn progressively grey and often develop melanomas late in life. Grey shows an autosomal dominant inheritance and the locus has previously been mapped to horse chromosome 25 (ECA25), around the TXN gene. We have now developed eight new single nucleotide polymorphisms (SNPs) associated with genes on ECA25 using information on the linear order of genes on human chromosome 9q, as well as the human and mouse coding sequences. These SNPs were mapped in relation to the Grey locus using more than 300 progeny from matings between two Swedish Warmblood grey stallions and...
Vychodilova-Krenkova L, Matiasovic J, Horin P.The objective of this study was to identify single nucleotide polymorphisms (SNPs) within four functionally related immune response genes in the horse, and to develop genotyping techniques that could be useful for future genomic studies of horse infectious and allergic diseases. The genes analysed were: the lipopolysaccharide (LPS) receptor gene CD14, the toll-like receptor 4 gene TLR4, the gene Cepsilon encoding the IgE heavy chain molecule and the gene FcepsilonR1 alpha coding for the alpha subunit of the IgE receptor molecule. Horse-specific primers amplifying selected gene regions were des...
Vaughan L, Schofield W, Ennis S.A three year old pony with sexually ambiguous external genitalia was found to have a normal female karyotype (64, XX) and bilateral inguinal testes. The PCR analysis of blood samples revealed the absence of the Y chromosome sequences SRY, eTSPY and ZFY. No Y chromosome sequences were identified in DNA extracted from the gonads. The mechanism whereby XX sex reversal occurs in the absence of SRY is unknown.
De Oliveira RA, Budik S, Aurich C.Although glycerol is the cryoprotectant most commonly used in stallions, it has also a considerable toxicity for equine sperm. It was the aim of this study to analyse the quality of frozen-thawed stallion semen after complete or partial replacement of glycerol in the freezing extender by alternative cryoprotectants. We hypothesized that partial or total replacement of glycerol by cryoprotectants occurring in cold-resistant frog, insect or plant species results in similar or better semen quality after freezing-thawing. As basic medium, the commercial Ghent basic extender was used and either sup...
Sato T, Itou T, Sakai T.The complete coding region sequence of equine muscle-type phosphofructokinase (ePFKM) was obtained from skeletal muscle of a thoroughbred horse. The deduced amino acid sequence of ePFKM showed 97%, 96%, 96%, 96% and 95% identity to canine, human, mouse, rabbit and rat PFKM, respectively. The amino and carboxyl terminal halves of ePFKM presented a structure of tandem repeat, as other mammalian PFKMs. As the amino acid residues constituting various ligand-binding sites were also conserved, it is thought that ePFKM has enzymatic activity similar to PFKM in other mammals.
Vandergrifft EV, Swiderski CE, Horohov DW.We have cloned equine interleukin 4 (IL-4) cDNA using the polymerase chain reaction (PCR) and primers based on the human IL-4 sequence. The cDNA was amplified from mitogen-stimulated equine peripheral blood mononuclear cells (PBMC). The cloned PCR product shares extensive homology ith IL-4 sequences from other species.
Thoresen SI, Jenkins A, Ask E.Chromosomal DNA fingerprinting indicated that Norwegian Taylorella equigenitalis strains are genetically homogeneous and similar to some Swedish isolates but different from other European strains. As contagious equine metritis is rarely a serious disease in Norwegian horses, we conclude that the dominant T. equigenitalis strain in Norway is a genetically homogeneous clone of low virulence.
Rivas VN, Aleman M, Peterson JA, Dahlgren AR, Hales EN, Finno CJ.Juvenile idiopathic epilepsy (JIE) is an inherited disease characterized by recurrent seizures during the first year of life in Egyptian Arabian horses. Definitive diagnosis requires an electroencephalogram (EEG) performed by a veterinary specialist. A recent study has suggested that a 19 base-pair deletion, along with a triple-C insertion, in intron five of twelve (∆19InsCCC; chr20:29542397-29542425: GTTCAGGGGACCACATGGCTCTCTATAGA>TATCTTAAGACCC) of the () gene is associated with JIE. To confirm this association, a new sample set consisting of nine EEG-phenotyped affected and nine unaffec...
Abbas G, Ghafar A, Koehler AV, Bauquier J, Wilkes EJA, Jacobson C, Beasley A, Hurley J, Cudmore L, Carrigan P, Tennent-Brown B, El-Hage C, Nielsen MK....Strongyloides westeri is found in the small intestine of young horses, mainly in foals up to about 16 weeks of age. The main source of infection for foals is through transmammary transmission, and foals can develop acute diarrhoea, weakness, dermatitis and respiratory signs. The epidemiology of S. westeri in Australia is largely unknown. Further, molecular techniques have never been employed for detection of S. westeri in horses. This pilot study aimed to assess the utility of a molecular phylogenetic method for the detection of S. westeri in the faeces of foals. Methods: Faecal samples were ...
Ramsauer AS, Wachoski-Dark GL, Fraefel C, Ackermann M, Brandt S, Grest P, Knight CG, Favrot C, Tobler K.There is growing evidence that equine papillomavirus type 2 (EcPV2) infection is etiologically associated with the development of genital squamous cell carcinoma (SCC) and precursor lesions in equids. However, the precise mechanisms underlying neoplastic progression remain unknown. To allow the study of EcPV2-induced carcinogenesis, we aimed to establish a primary equine cell culture model of EcPV2 infection. Three-dimensional (3D) raft cultures were generated from equine penile perilesional skin, plaques and SCCs. Using histological, molecular biological and immunohistochemical methods, rafts...
Pailhoux E, Cribiu EP, Parma P, Cotinot C.In this study, cytogenetic analysis of an infertile mare revealed a 64, XY karyotype. The XY sex-reversed animal had a female phenotype with gonadal dysgenesis. Using Southern blot analysis, we tested for the presence of two Y-specific genes SRY and ZFY by using DNA isolated from peripheral blood leukocytes. The results showed that at least the DNA-binding domain of the SRY gene was deleted from the Y chromosome of the XY mare but that the ZFY gene was present on this chromosome.
Hébert L, Touzain F, de Boisséson C, Breuil MF, Duquesne F, Laugier C, Blanchard Y, Petry S.Taylorella equigenitalis is the causative agent of contagious equine metritis (CEM), a sexually transmitted infection of horses. We herein report the genome sequence of T. equigenitalis strain MCE529, isolated in 2009 from the urethral fossa of a 15-year-old Belgian Warmblood horse in France.
Sato T, Itou T, Sato G, Kobayashi Y, Endo H, Sakai T.In order to investigate the utilization of glucose in equine skeletal muscle, we determined the coding and proximal promoter sequences of the hexokinase type II (HKII) gene in thoroughbred horse, Grevy's zebra and Hartmann's mountain zebra. The deduced amino acid sequence of thoroughbred horse HKII showed 100, 100, 94.4, 92.7 and 92.6% identities with Grevy's zebra, Hartmann's mountain zebra, human, mouse and rat HKIIs, respectively. In equine HKIIs, specific amino acid substitutions, Ile 159 and Arg 610, were found in the potential binding site for glucose. In addition, the nucleotide sequenc...
Thomassen EE, Sigsgaard EE, Jensen MR, Olsen K, Hansen MDD, Svenning JC, Thomsen PF.Trophic rewilding is increasingly applied in restoration efforts, with the aim of reintroducing the ecological functions provided by large-bodied mammals and thereby promote self-regulating, biodiverse ecosystems. However, empirical evidence for the effects of megafauna introductions on the abundance and richness of other organisms such as plants and invertebrates, and the mechanisms involved still need strengthening. In this study, we use environmental DNA (eDNA) metabarcoding of dung from co-existing feral cattle and horses to assess the seasonal variation in plant diet and dung-associated a...
Cohen ND, Kahn SK, Bordin AI, Gonzales GM, da Silveira BP, Bray JM, Legere RM, Ramirez-Cortez SC.Intragastric administration of virulent Rhodococcus equi protects foals against subsequent experimental intrabronchial (IB) infection, but it is unknown whether R. equi naturally ingested by foals contributes to their susceptibility to pneumonia. Objective: Fecal concentration of virulent R. equi before IB infection with R. equi is positively associated with protection from pneumonia in foals. Methods: Twenty-one university-owned foals. Methods: Samples were collected from experimental studies. Five foals were gavaged with live, virulent R. equi (LVRE) at age 2 and 4 days; the remaining 16 f...
Oliveira-Filho JP, Monteiro LN, Delfiol DJ, Sequeira JL, Amorim RM, Fabris VE, Del Piero F, Borges AS.Sarcoidosis is a rare equine skin disease characterized primarily by an exfoliative and granulomatous dermatitis but also presenting granulomatous inflammation of multiple systems. The current report presents the clinical and histopathological findings of sarcoidosis in a 16-year-old American Quarter Horse gelding with nested polymerase chain reaction Mycobacterium spp. DNA detection within hepatic and skin samples. Mycobacterium spp. may play a role in the pathogenesis of equine sarcoidosis as has been proposed for human sarcoidosis.
Ayala-Valdovinos MA, Galindo-García J, Sánchez-Chiprés D, Duifhuis-Rivera T.Lethal white foal syndrome (LWFS) is an autosomal recessive disease of neonatal foals characterized by a white hair coat and a functional intestinal obstruction. Traditional techniques for identifying the dinucleotide mutation (TC→AG) of the endothelin receptor B gene (EDNRB) associated with LWFS are time-consuming. We developed a new technique based on mutagenically separated polymerase chain reaction (MS-PCR) for simple detection of the EDNRB genotype in horses.
van den Hoogen BM, van den Lest CH, van Weeren PR, van Golde LM, Barneveld A.In this study, the effect of different exercise regimens on proteoglycan metabolism of articular cartilage was examined in 43 newborn foals randomly divided into 3 groups: a) box-rest, b) box-rest with training and c) free pasture exercise. They were subjected to these exercise regimens from ages 1 week to 5 months and at 5 months, 24 foals (8 from each group) were sacrificed to assess short-term exercise effects. The remaining 19 foals were subjected to the same regimen of light exercise for an additional 6 months before being sacrificed to evaluate possible long-term effects. Articular carti...
Cabral LDR, Sato AP, de Sousa RS, Rossa AP, Sanches AWD, Bortoleto CT, Locatelli Dittrich R.The closely related apicomplexa protozoa, Toxoplasma gondii, Neospora spp., and Sarcocystis neurona, have all been associated with neurological and reproductive diseases in horses. However, there is limited data regarding the presence of these three parasites in equine placental tissues and amniotic fluid. The aim of the present report was to investigate the presence of the DNA of T. gondii, Neospora spp. and S. neurona in placentas and amniotic fluid in mares. Anti-T. gondii, anti- S. neurona and anti- Neospora spp. antibody titers were evaluated in 31 mares in the final third of pregnancy by...
Ipiña Z, Lussier JG, Theoret CL.To clone full-length equine pigment epithelium-derived factor (PEDF) complementary DNA (cDNA) and to evaluate its temporal expression during repair of wounds in horses. Methods: 4 clinically normal 2-to 3-year-old Standardbred mares. Methods: Full-length equine PEDF cDNA was cloned by screening size-selected cDNA libraries derived from biopsy specimens obtained from the wound edge 7 days after experimental creation of a 6.25-cm(2) full-thickness wound in the skin of the lateral thoracic wall. Expression was evaluated in normal skin and in biopsy specimens obtained weekly from experimentally in...
Głażewska I, Prusak B, Gralak B.The goal of this study was to demonstrate the usefulness of pedigree data in studies of mitochondrial DNA diversity in dogs and horses. Pedigree information allows for precisely choosing animals with distinct haplotypes for analysis, makes it possible to find rare haplotypes present exclusively in single individuals and helps to evaluate haplotype frequencies at the present and in the past. Estimating founder contributions to gene pools enables evaluating the parts of gene pools observed with the help of mtDNA analysis. An important aspect is also the financial benefits: using pedigree data, r...