Genetics in horses encompasses the study of hereditary traits and the genetic makeup that influences various characteristics and health conditions in equine populations. This field involves the analysis of genes and their functions, inheritance patterns, and the impact of genetic variations on traits such as coat color, performance ability, and susceptibility to diseases. Research in equine genetics employs techniques such as genome mapping, sequencing, and genetic testing to identify specific genes and mutations associated with these traits. This page gathers peer-reviewed research studies and scholarly articles that explore the genetic basis of equine traits, the methodologies used in genetic research, and the implications for breeding, health management, and conservation of horse breeds.
Lieto LD, Cothran EG.Epitheliogenesis imperfecta (EI) is a hereditary junctional mechanobullous disease that occurs in newborn American Saddlebred foals. The pathological signs of epitheliogenesis imperfecta closely match a similar disease in humans known as Herlitz junctional epidermolysis bullosa, which is caused by a mutation in one of the genes (LAMA3, LAMB3 and LAMC2) coding for the subunits of the laminin 5 protein (laminin alpha3, laminin beta3 and laminin gamma2). The LAMA3 gene has been assigned to equine chromosome 8 and LAMB3 and LAMC2 have been mapped to equine chromosome 5. Linkage disequilibrium betw...
Myka JL, Lear TL, Houck ML, Ryder OA, Bailey E.The genus Equus is unusual in that five of the ten extant species have documented centric fission (Robertsonian translocation) polymorphisms within their populations, namely E. hemionus onager, E. hemionus kulan, E. kiang, E. africanus somaliensis, and E. quagga burchelli. Here we report evidence that the polymorphism involves the same homologous chromosome segments in each species, and that these chromosome segments have homology to human chromosome 4 (HSA4). Bacterial artificial chromosome clones containing equine genes SMARCA5 (ECA2q21 homologue to HSA4q31. 21) and UCHL1 (ECA3q22 homologue ...
Chowdhary BP, Bailey E.Analysis of the horse genome is proceeding at a rapid pace. Within a short span of 6-7 years, approximately 1,500 markers have been mapped in horse, of which at least half are genes/ESTs. Health, performance and phenotypic characteristic are of major concern/interest to horse breeders and owners. Current efforts to analyze the equine genome are primarily aimed at developing critical resources (including an advanced gene map) that could readily be used in the near future to i) identify genes and mutations responsible for inherited equine diseases/disorders and to formulate approaches for accura...
Myka JL, Lear TL, Houck ML, Ryder OA, Bailey E.Przewalski's wild horse (E. przewalskii, EPR) has a diploid chromosome number of 2n = 66 while the domestic horse (E. caballus, ECA) has a diploid chromosome number of 2n = 64. Discussions about their phylogenetic relationship and taxonomic classification have hinged on comparisons of their skeletal morphology, protein and mitochondrial DNA similarities, their ability to produce fertile hybrid offspring, and on comparison of their chromosome morphology and banding patterns. Previous studies of GTG-banded karyotypes suggested that the chromosomes of both equids were homologous and the differenc...
Gustafson AL, Tallmadge RL, Ramlachan N, Miller D, Bird H, Antczak DF, Raudsepp T, Chowdhary BP, Skow LC.A physical map of ordered bacterial artificial chromosome (BAC) clones was constructed to determine the genetic organization of the horse major histocompatibility complex. Human, cattle, pig, mouse, and rat MHC gene sequences were compared to identify highly conserved regions which served as source templates for the design of overgo primers. Thirty-five overgo probes were designed from 24 genes and used for hybridization screening of the equine USDA CHORI 241 BAC library. Two hundred thirty-eight BAC clones were assembled into two contigs spanning the horse MHC region. The first contig contain...
Bowling AT, Zimmermann W, Ryder O, Penado C, Peto S, Chemnick L, Yasinetskaya N, Zharkikh T.In our continuing efforts to document genetic diversity in Przewalski's horses and relatedness with domestic horses, we report genetic variation at 22 loci of blood group and protein polymorphisms and 29 loci of DNA (microsatellite) polymorphisms. The loci have been assigned by linkage or synteny mapping to 20 autosomes and the X chromosome of the domestic horse (plus four loci unassigned to a chromosome). With cumulative data from tests of 568 Przewalski's horses using blood, hair or tooth samples, no species-defining markers were identified, however a few markers were present in the wild spe...
Park HB, Marklund S, Jeon JT, Mickelson JR, Valberg SJ, Sandberg K, Andersson L.The PRKAG3 gene encodes a muscle-specific isoform of the regulatory gamma subunit of AMP-activated protein kinase (AMPK). A major part of the coding PRKAG3 sequence was isolated from horse muscle cDNA using reverse-transcriptase (RT)-PCR analysis. Horse-specific primers were used to amplify genomic fragments containing 12 exons. Comparative sequence analysis of horse, pig, mouse, human, Fugu, and zebrafish was performed to establish the exon/intron organization of horse PRKAG3 and to study the homology among different isoforms of AMPK gamma genes in vertebrates. The results showed conclusively...
Aberle K, Wrede J, Distl O.We analysed the relationship coefficients (R) between the four German heavy horse breeds South German Coldblood, Rhenish German Draught Horse, Schleswig Draught Horse and Black Forest Draught Horse. The relationship coefficient makes it possible to ascertain crossbreeding between the breeds over time, or autonomous developments of the breeds, respectively. The investigation revealed that the relationship coefficients between the German draught horse breeds were very low. The mean relationship coefficients between the four German heavy horse breeds were largest between the South German Coldbloo...
Aberle K, Wrede J, Distl O.Gene contributions of foreign populations as well as coefficients of inbreeding and relationship were calculated in 1918 South German Coldblood horses registered in Bavaria in 2003. Based on nearly complete 8-generation-pedigrees (index of pedigree completeness: 76%) the mean coefficient of inbreeding was 23%. After considering missing pedigree data, the mean coefficient of inbreeding was 3%. The rates of inbreeding per generation in the current population amount to about 0.43% over the last eight generations and to about 0.15% in the forthcoming generation. In the total current population, th...
Payne SL, Pei XF, Jia B, Fagerness A, Fuller FJ.The molecular clones pSPeiav19 and p19/wenv17 of equine infectious anemia virus (EIAV) differ in env and long terminal repeats (LTRs) and produce viruses (EIAV(19) and EIAV(17), respectively) of dramatically different virulence phenotypes. These constructs were used to generate a series of chimeric clones to test the individual contributions of LTR, surface (SU), and transmembrane (TM)/Rev regions to the disease potential of the highly virulent EIAV(17). The LTRs of EIAV(19) and EIAV(17) differ by 16 nucleotides in the transcriptional enhancer region. The two viruses differ by 30 amino acids i...
Frazer KA, Tao H, Osoegawa K, de Jong PJ, Chen X, Doherty MF, Cox DR.Cross-species DNA sequence comparison is a fundamental method for identifying biologically important elements, because functional sequences are evolutionarily conserved, wheres nonfunctional sequences drift. A recent genome-wide comparison of human and mouse DNA discovered over 200,000 conserved noncoding sequences with unknown function. Multispecies DNA comparison has been proposed as a method to prioritize these conserved noncoding sequences for functional analysis based on the hypothesis that elements present in many species are more likely to be functional than elements present in limited ...
Cowley AB, Lukat-Rodgers GS, Rodgers KR, Benson DR.N-Acetylmicroperoxidase-8 (1) contains heme and residues 14-21 of horse mitochondrial cytochrome c (cyt c). The two thioether bonds linking protein to heme in cyt c are present in 1, and the native axial ligand His-18 remains coordinated to iron. As an approach to probing structural or functional roles played by the double covalent heme-protein linkage in cyt c, we have initiated a study in which the properties of 1 are compared with those of a synthetic mono-His coordinated heme peptide containing a single covalent linkage (2). One consequence of the greater conformational restriction imposed...
Balasuriya UBR, Hedges JF, Smalley VL, Navarrette A, McCollum WH, Timoney PJ, Snijder EJ, MacLachlan NJ.Equine arteritis virus (EAV) causes a persistent infection of the reproductive tract of carrier stallions. The authors determined the complete genome sequences of viruses (CW96 and CW01) that were present 5 years apart in the semen of a carrier stallion (CW). The CW96 and CW01 viruses respectively had only 85.6 % and 85.7 % nucleotide identity to the published sequence of EAV (EAV030). The CW96 and CW01 viruses had two 1 nt insertions and a single 1 nt deletion in the leader sequence, and a 3 nt coding insertion in ORF1a; thus their genomes included 12 708 nt as compared to the 12 704 nt in EA...
Solberg OD, Jackson KA, Millon LV, Stott JL, Vandenplas ML, Moore JN, Watson JL.Three overlapping fragments of the equine interleukin-4 receptor alpha chain gene (IL4R) were cloned and sequenced. The resulting 3553 bp cDNA sequence exhibited homology to human, murine and bovine IL4R. The equine IL4R exhibits many conserved features when compared to other species, including intron-exon boundary positions and amino acid sequence motifs characteristic of type I cytokine receptors. The IL4R gene was localized to horse chromosome ECA13 by synteny mapping on a somatic cell hybrid panel. Evidence for an alternative splice variant of IL4R was found in the genomic sequence and sub...
Nebbia C, Dacasto M, Carletti M.Little is known about the effects of aging on the hepatic drug metabolizing capacity of horses despite the relatively long lifespan characterizing this species. A wide array of cytochrome P450 (CYP)-dependent monooxygenases, carboxylesterases and transferases were assayed in liver microsomes from 50 female horses in an age range between less than 1 year to over 12 years. Rather unexpectedly, both the CYP content and the activity of NADPH cytochrome c reductase rose as a function of age. Accordingly, a general increasing trend was recorded in the rate of the in vitro metabolism of the substrate...
Farber CR, Medrano JF.In this study the flanking sequences of 1534 horse microsatellites were used in a BLAST search to identify putative human-horse homologies. BLAST searches revealed 129 flanking sequences with significant blastn matches [alignment scores (S) > or = 60 and sum probability values (E) < or = 3.0E-6], also, 25 of these produced significant blastx matches. To provide a reference point in the human genome the flanking sequences with matches were subjected to a BLAT search of the University of California Santa Cruz (UCSC) human genome assembly (July 2003 freeze). Eighty-three of the flanking seq...
van Ginneken MM, Keizer HA, Wijnberg ID, van Dam KG, Schaart G, de Graaf-Roelfsema E, van der Kolk JH, van Breda E.To investigate whether protein kinase C (PKC) isoforms are expressed in equine skeletal muscle and determine their distribution in various types of fibers by use of immunofluorescence microscopy. Methods: 5 healthy adult Dutch Warmblood horses. Methods: In each horse, 2 biopsy specimens were obtained from the vastus lateralis muscle. Cryosections of equine muscle were stained with PKC isoform (alpha, beta1, beta2, delta, epsilon, or zeta)-specific polyclonal antibodies and examined by use of a fluorescence microscope. Homogenized muscle samples were evaluated via western blot analysis. Results...
Semevolos SA, Nixon AJ, Strassheim ML.To determine the mRNA expression of bone morphogenetic protein (BMP)-6 and -2 and a BMP antagonist (Noggin) in horses with osteochondrosis. Methods: Samples of articular cartilage from affected stifle or shoulder joints of 10 immature horses with naturally acquired osteochondrosis and corresponding joints of 9 clinically normal horses of similar age; additionally, samples of distal femoral growth plate cartilage and distal femoral articular cartilage were obtained from a normal equine fetus. Methods: Cartilage specimens were snap-frozen in liquid nitrogen, and total RNA was isolated. Adjacent ...
Sato F, Yamashita S, Kugo T, Hasegawa T, Mitsui I, Kijima-Suda I.To determine the full-length complementary DNA (cDNA) sequence of equine erythropoietin (EPO) and to develop region-specific antibodies to differentiate equine EPO (eEPO) and human EPO (hEPO). Methods: RNA and lysate extracted from renal tissues of an adult Thoroughbred. Methods: Full-length cDNA was determined by use of a reverse transcriptase-polymerase chain reaction assay and a rapid amplification of cDNA ends method. The deduced amino acid sequence was compared with sequences of EPO reported for other species. Furthermore, 4 synthetic peptides were designed in 2 distinctive parts of the e...
Brown KA, Boerboom D, Bouchard N, Doré M, Lussier JG, Sirois J.17Beta-hydroxysteroid dehydrogenase type 4 (17betaHSD4) has a unique multidomain structure, with one domain involved in 17beta-estradiol inactivation. The objective of the study was to investigate the regulation of 17betaHSD4 during human chorionic gonadotropin (hCG)-induced ovulation/luteinization. The equine 17betaHSD4 cDNA was cloned and was shown to encode a 735-amino acid protein that is highly conserved (81-87% identity) compared with other mammalian orthologs. RT-PCR/Southern blot analyses were performed to study the regulation of 17betaHSD4 transcripts in equine preovulatory follicles ...
Ginther OJ, Gastal EL, Gastal MO, Beg MA.The role of the insulin-like growth factor (IGF) system in the deviation in growth rates among follicles (follicle selection) was studied in mares using an IGF binding protein (BP) to reduce the follicular-fluid concentrations of IGFs. The future dominant follicle (F1) was treated by intrafollicular injection at the expected beginning of deviation (F1 > or = 20 mm; Day 0). The experimental groups were control (no injection, n = 8), vehicle (injection of vehicle; n = 6), and BP (injection of 250 microg of recombinant human IGFBP-3; n = 6). A sample of follicular fluid was taken from F1 on Da...
Tamaki Y, Hirata H, Takabatake N, Bork S, Yokoyama N, Xuan X, Fujisaki K, Igarashi I.A Babesia caballi gene encoding the 134-kDa (BC134) protein was immunoscreened with B. caballi-infected horse serum. An enzyme-linked immunosorbent assay (ELISA) using recombinant BC134 protein could effectively differentiate B. caballi-infected horse sera from Babesia equi-infected or noninfected control horse sera. These results suggest that the recombinant BC134 protein is a potential diagnostic antigen in the detection of B. caballi infection.
Lee EJ, Raudsepp T, Kata SR, Adelson D, Womack JE, Skow LC, Chowdhary BP.Comparative genomics has served as a backbone for the rapid development of gene maps in domesticated animals. The integration of this approach with radiation hybrid (RH) analysis provides one of the most direct ways to obtain physically ordered comparative maps across evolutionarily diverged species. We herein report the development of a detailed RH and comparative map for horse chromosome 17 (ECA17). With markers distributed at an average interval of every 1.4 Mb, the map is currently the most informative among the equine chromosomes. It comprises 75 markers (56 genes and 19 microsatellites),...
Peyrou M, Higgins R, Lavoie JP.Evolution of bacterial resistance to certain antibacterial agents in horses in a veterinary hospital. A total of 255 antibiograms, conducted according to the Kirby-Bauer method from bacterial isolates collected from horses at the Hôpital Vétérinaire d'Enseignement at the Université de Montréal between 1996 and 1998 were compared with the results obtained about 10 years ago with corresponding bacterial species. A significant increase in the percentage of strains resistant to trimethoprim-sulfamethoxazole (TMP-SXT), penicilline, tetracycline, and to gentamicin was observed. The percentages ...
Choi YH, Roasa LM, Love CC, Varner DD, Brinsko SP, Hinrichs K.This study was conducted to evaluate in vivo and in vitro development of in vitro-matured equine oocytes fertilized by intracytoplasmic sperm injection. Oocytes were collected from slaughterhouse-derived ovaries, matured in vitro, and injected with frozen-thawed stallion sperm. In vivo development was assessed after transfer of injected oocytes to the oviducts of recipient mares. Mares were killed 7.5-8.5 days after transfer and the uterus and oviducts flushed for embryo recovery. Of 132 injected oocytes transferred, 69 (52%) were recovered; of these, 25 (36%) were blastocysts with a blastocoe...
Harrington JP, Carrier TL.The effect of several different types of perturbants and pH on the rate of autoxidation of horse heart ferrocytochrome c was investigated. The kinetic behavior is unique to each perturbant used. Rates of autoxidation followed first-order kinetics over the time span (0-180 min) studied. The Cl- and Br- anions exhibit an initial increase in the rate of autoxidation up to 100 mM, followed by a decrease in kinetics at 500 mM anion concentration. The ClO4- anion exhibits only an increase in the rate of autoxidation with increasing ionic strength, where as, propylurea, a hydrophobic perturbant, is n...
Schuh JC, Valentine BA.Basal cell tumors from 11 horses were examined histologically. Distinct patterns identified in the order of frequency are adenoid (six), solid (three), and medusoid (two). A minor component of most of these neoplasms was a ribbon pattern and cystic spaces. Hyalinized connective tissue and clear cells reminiscent of hair follicle glassy membranes and outer root sheath were present in a solid and the medusoid tumors. Heavy melanin pigmentation was present in one solid basal cell tumor. In eight cases for which information was available, the tumors had not recurred 3 to 8 years after excision.
Sato T, Itou T, Sato G, Kobayashi Y, Endo H, Sakai T.In order to investigate the utilization of glucose in equine skeletal muscle, we determined the coding and proximal promoter sequences of the hexokinase type II (HKII) gene in thoroughbred horse, Grevy's zebra and Hartmann's mountain zebra. The deduced amino acid sequence of thoroughbred horse HKII showed 100, 100, 94.4, 92.7 and 92.6% identities with Grevy's zebra, Hartmann's mountain zebra, human, mouse and rat HKIIs, respectively. In equine HKIIs, specific amino acid substitutions, Ile 159 and Arg 610, were found in the potential binding site for glucose. In addition, the nucleotide sequenc...
Goudet G.The mammalian oviduct plays a crucial role in the preparation of gametes for fertilisation (transport and final maturation) and fertilisation itself. An increasing number of studies offers a comprehensive overview of the functions of the oviduct and its secretions, but this topic has had limited investigation in the horse. Limited data are available on the final oocyte maturation in the equine oviduct. However, in vitro and in vivo systems have been established to analyse the influence of equine oviduct epithelial cells (OEC) during maturation on the potential of oocytes for fertilisation and ...
Antczak DF.The development of placentation that coincided with the evolution of mammals presented new challenges to the transmission of life from one generation to the next, particularly with regard to the possibility of maternal immunological recognition and destruction of the developing conceptus. The balance between immunity and tolerance dominates the immunological relationship between mother and fetus during mammalian pregnancy, and the focal point of this relationship lies at the interface between the trophoblast cells that comprise the outermost layer of the placenta and the maternal endometrial t...
Hicks J, Stuber T, Lantz K, Erdman M, Robbe-Austerman S, Huang X.Contagious equine metritis is a disease of worldwide concern in equids. The United States is considered to be free of the disease although sporadic outbreaks have occurred over the last few decades that were thought to be associated with the importation of horses. The objective of this study was to create finished, reference quality genomes that characterize the diversity of Taylorella equigenitalis isolates introduced into the USA, and identify their differences. Five isolates of T. equigenitalis associated with introductions into the USA from unique sources were sequenced using both short an...
We compared the composition and content of fatty acids (FAs) in the liver, muscles, and subcutaneous fat of Yakut horses inhabiting extreme environment in the Cryolithozone. Essential linoleic and alpha-linolenic acids, supplied to horses with their food, were accumulated in different tissues. Linoleic acid was accumulated in the liver but alpha-linolenic acid was accumulated in muscle and subcutaneous fat. Such a distribution indicates different roles of these fatty acids in the metabolism of horses. Yakut horse meat is a valuable dietary product owing to its fatty acid composition and conten...
Studdert MJ.Set in a context of immunodeficiency diseases in general this paper provides a brief, illustrated review of a primary, severe, combined immunodeficiency (PSCID) disease of Arabian foals. Affected foals are clinically normal at birth but beginning at about 10 days of age they develop a range of clinical signs particularly bronchopneumonia and diarrhoea with which adenoviruses are peculiarly associated. Despite intensive therapy foals invariably die by about 3 months of age. Affected foals are profoundly lymphopagenic (greater than 1000 lymphcoytes per mm3). There is thymic and lymph node hypopl...
Berti A, Liguri G, Stefani M, Nassi P, Ramponi G.Horse muscle acylphosphatase antibodies were obtained by immunizing rabbits with the highly purified antigen cross-linked with glutaraldehyde. Specific antibodies were purified from the immunoglobulin fraction by affinity chromatography using a matrix coupled with the pure antigen as immunoadsorbent. The purified antibodies were partially characterized by immunodiffusion and immunoprecipitin techniques. These antibodies could be used to study aspects of the muscle acylphosphatase structure, localization and other biological properties.
Laing JA, Leech FB.In a group of 852 Thoroughbred mares, 69-7% had foals which survived beyond 6 weeks, 7-1% had dead, premature or full-term foals and 1-1% had foals which died within 6 weeks after birth. Possible factors which may have influenced these data are mentioned.
van Ginneken MM, Keizer HA, Wijnberg ID, van Dam KG, Schaart G, de Graaf-Roelfsema E, van der Kolk JH, van Breda E.To investigate whether protein kinase C (PKC) isoforms are expressed in equine skeletal muscle and determine their distribution in various types of fibers by use of immunofluorescence microscopy. Methods: 5 healthy adult Dutch Warmblood horses. Methods: In each horse, 2 biopsy specimens were obtained from the vastus lateralis muscle. Cryosections of equine muscle were stained with PKC isoform (alpha, beta1, beta2, delta, epsilon, or zeta)-specific polyclonal antibodies and examined by use of a fluorescence microscope. Homogenized muscle samples were evaluated via western blot analysis. Results...
Valera M, Galisteo AM, Molina A, Miró F, Gómez MD, Cano MR, Agüera E.The purpose of this study was to estimate the genetic parameters of biokinematic variables in Spanish Purebred (SPB) horses in order to select those of sufficient interest to be measured in the pre-selection of the animals for possible inclusion in the breeding programme. Kinematic analysis of 130 SPB horses 4.6+/-1.5 years old were recorded at the trot (4m/s) on a treadmill. Genetic parameters were estimated using VCE software and a bivariate mixed animal model including age and stud as fixed effects and animal additive genetic effect and residual error as random effects. In general, heritabi...
Koziorowska-Gilun M, Gilun P, Mietelska K, Kordan W.The key prerequisite for successful insemination is sperm characterized to have positive values for morphological and biological variables which are determined by, among others, effective antioxidant protection during the lifespan of sperm cells. This study evaluated the activity and relative abundance of mRNA for antioxidant enzymes in stallion testicular and epididymal tissues during breeding (n = 5) and non-breeding (n = 5) seasons. The activity of superoxide dismutase (SOD) was greater (P < 0.05) during the breeding season, in particular in the testes and the caput epididymis, ...
Cavalcante AL, Dias LM, Alves JT, Veras AA, Guimarães LC, Rocha FS, Gala-García A, Retamal P, Ramos RT, Azevedo V, Silva A, Carneiro AR.Corynebacterium pseudotuberculosis is related to several diseases infecting horses and small ruminants, causing economic losses to agribusiness. Here, we present the genome sequence of C. pseudotuberculosis strain E19. The genome includes one circular chromosome 2,367,956 bp (52.1% G+C content), with 2,112 genes predicted, 12 rRNAs, and 48 tRNAs.
Berger J, Kock M, Cunningham C, Dodson N.Twenty-three (9 male, 14 female) wild horses (Equus caballus) in the Great Basin Desert were immobilized by ground techniques with succinylcholine chloride during 1,950 person-hr. Induction (means = 2.09 +/- 0.59 min) and recovery (means = 12.4 +/- 5.0 min) were rapid and most animals were returned in less than 10 min to original bands. Dosages ranged from 0.66-0.77 mg/kg body weight and neither abortions nor band changes in group membership resulted. However, a few concerted efforts up to 24 hr were needed to return some animals to original bands and three non-drug related mortalities occurre...
Olsen HF, Meuwissen T, Klemetsdal G.The aim of this study was to examine how to apply optimal contribution selection (OCS) in the Norwegian and the North-Swedish cold-blooded trotter and give practical recommendations for the future. OCS was implemented using the software Gencont with overlapping generations and selected a few, but young sires, as these turn over the generations faster and thus is less related to the mare candidates. In addition, a number of Swedish sires were selected as they were less related to the selection candidates. We concluded that implementing OCS is feasible to select sires (there is no selection on m...
Rivas VN, Aleman M, Peterson JA, Dahlgren AR, Hales EN, Finno CJ.Juvenile idiopathic epilepsy (JIE) is an inherited disease characterized by recurrent seizures during the first year of life in Egyptian Arabian horses. Definitive diagnosis requires an electroencephalogram (EEG) performed by a veterinary specialist. A recent study has suggested that a 19 base-pair deletion, along with a triple-C insertion, in intron five of twelve (∆19InsCCC; chr20:29542397-29542425: GTTCAGGGGACCACATGGCTCTCTATAGA>TATCTTAAGACCC) of the () gene is associated with JIE. To confirm this association, a new sample set consisting of nine EEG-phenotyped affected and nine unaffec...