Genetics in horses encompasses the study of hereditary traits and the genetic makeup that influences various characteristics and health conditions in equine populations. This field involves the analysis of genes and their functions, inheritance patterns, and the impact of genetic variations on traits such as coat color, performance ability, and susceptibility to diseases. Research in equine genetics employs techniques such as genome mapping, sequencing, and genetic testing to identify specific genes and mutations associated with these traits. This page gathers peer-reviewed research studies and scholarly articles that explore the genetic basis of equine traits, the methodologies used in genetic research, and the implications for breeding, health management, and conservation of horse breeds.
Chowdhary BP, Bailey E.Analysis of the horse genome is proceeding at a rapid pace. Within a short span of 6-7 years, approximately 1,500 markers have been mapped in horse, of which at least half are genes/ESTs. Health, performance and phenotypic characteristic are of major concern/interest to horse breeders and owners. Current efforts to analyze the equine genome are primarily aimed at developing critical resources (including an advanced gene map) that could readily be used in the near future to i) identify genes and mutations responsible for inherited equine diseases/disorders and to formulate approaches for accura...
Myka JL, Lear TL, Houck ML, Ryder OA, Bailey E.Przewalski's wild horse (E. przewalskii, EPR) has a diploid chromosome number of 2n = 66 while the domestic horse (E. caballus, ECA) has a diploid chromosome number of 2n = 64. Discussions about their phylogenetic relationship and taxonomic classification have hinged on comparisons of their skeletal morphology, protein and mitochondrial DNA similarities, their ability to produce fertile hybrid offspring, and on comparison of their chromosome morphology and banding patterns. Previous studies of GTG-banded karyotypes suggested that the chromosomes of both equids were homologous and the differenc...
Gustafson AL, Tallmadge RL, Ramlachan N, Miller D, Bird H, Antczak DF, Raudsepp T, Chowdhary BP, Skow LC.A physical map of ordered bacterial artificial chromosome (BAC) clones was constructed to determine the genetic organization of the horse major histocompatibility complex. Human, cattle, pig, mouse, and rat MHC gene sequences were compared to identify highly conserved regions which served as source templates for the design of overgo primers. Thirty-five overgo probes were designed from 24 genes and used for hybridization screening of the equine USDA CHORI 241 BAC library. Two hundred thirty-eight BAC clones were assembled into two contigs spanning the horse MHC region. The first contig contain...
Bowling AT, Zimmermann W, Ryder O, Penado C, Peto S, Chemnick L, Yasinetskaya N, Zharkikh T.In our continuing efforts to document genetic diversity in Przewalski's horses and relatedness with domestic horses, we report genetic variation at 22 loci of blood group and protein polymorphisms and 29 loci of DNA (microsatellite) polymorphisms. The loci have been assigned by linkage or synteny mapping to 20 autosomes and the X chromosome of the domestic horse (plus four loci unassigned to a chromosome). With cumulative data from tests of 568 Przewalski's horses using blood, hair or tooth samples, no species-defining markers were identified, however a few markers were present in the wild spe...
Park HB, Marklund S, Jeon JT, Mickelson JR, Valberg SJ, Sandberg K, Andersson L.The PRKAG3 gene encodes a muscle-specific isoform of the regulatory gamma subunit of AMP-activated protein kinase (AMPK). A major part of the coding PRKAG3 sequence was isolated from horse muscle cDNA using reverse-transcriptase (RT)-PCR analysis. Horse-specific primers were used to amplify genomic fragments containing 12 exons. Comparative sequence analysis of horse, pig, mouse, human, Fugu, and zebrafish was performed to establish the exon/intron organization of horse PRKAG3 and to study the homology among different isoforms of AMPK gamma genes in vertebrates. The results showed conclusively...
Aberle K, Wrede J, Distl O.We analysed the relationship coefficients (R) between the four German heavy horse breeds South German Coldblood, Rhenish German Draught Horse, Schleswig Draught Horse and Black Forest Draught Horse. The relationship coefficient makes it possible to ascertain crossbreeding between the breeds over time, or autonomous developments of the breeds, respectively. The investigation revealed that the relationship coefficients between the German draught horse breeds were very low. The mean relationship coefficients between the four German heavy horse breeds were largest between the South German Coldbloo...
Aberle K, Wrede J, Distl O.Gene contributions of foreign populations as well as coefficients of inbreeding and relationship were calculated in 1918 South German Coldblood horses registered in Bavaria in 2003. Based on nearly complete 8-generation-pedigrees (index of pedigree completeness: 76%) the mean coefficient of inbreeding was 23%. After considering missing pedigree data, the mean coefficient of inbreeding was 3%. The rates of inbreeding per generation in the current population amount to about 0.43% over the last eight generations and to about 0.15% in the forthcoming generation. In the total current population, th...
Payne SL, Pei XF, Jia B, Fagerness A, Fuller FJ.The molecular clones pSPeiav19 and p19/wenv17 of equine infectious anemia virus (EIAV) differ in env and long terminal repeats (LTRs) and produce viruses (EIAV(19) and EIAV(17), respectively) of dramatically different virulence phenotypes. These constructs were used to generate a series of chimeric clones to test the individual contributions of LTR, surface (SU), and transmembrane (TM)/Rev regions to the disease potential of the highly virulent EIAV(17). The LTRs of EIAV(19) and EIAV(17) differ by 16 nucleotides in the transcriptional enhancer region. The two viruses differ by 30 amino acids i...
Frazer KA, Tao H, Osoegawa K, de Jong PJ, Chen X, Doherty MF, Cox DR.Cross-species DNA sequence comparison is a fundamental method for identifying biologically important elements, because functional sequences are evolutionarily conserved, wheres nonfunctional sequences drift. A recent genome-wide comparison of human and mouse DNA discovered over 200,000 conserved noncoding sequences with unknown function. Multispecies DNA comparison has been proposed as a method to prioritize these conserved noncoding sequences for functional analysis based on the hypothesis that elements present in many species are more likely to be functional than elements present in limited ...
Cowley AB, Lukat-Rodgers GS, Rodgers KR, Benson DR.N-Acetylmicroperoxidase-8 (1) contains heme and residues 14-21 of horse mitochondrial cytochrome c (cyt c). The two thioether bonds linking protein to heme in cyt c are present in 1, and the native axial ligand His-18 remains coordinated to iron. As an approach to probing structural or functional roles played by the double covalent heme-protein linkage in cyt c, we have initiated a study in which the properties of 1 are compared with those of a synthetic mono-His coordinated heme peptide containing a single covalent linkage (2). One consequence of the greater conformational restriction imposed...
Balasuriya UBR, Hedges JF, Smalley VL, Navarrette A, McCollum WH, Timoney PJ, Snijder EJ, MacLachlan NJ.Equine arteritis virus (EAV) causes a persistent infection of the reproductive tract of carrier stallions. The authors determined the complete genome sequences of viruses (CW96 and CW01) that were present 5 years apart in the semen of a carrier stallion (CW). The CW96 and CW01 viruses respectively had only 85.6 % and 85.7 % nucleotide identity to the published sequence of EAV (EAV030). The CW96 and CW01 viruses had two 1 nt insertions and a single 1 nt deletion in the leader sequence, and a 3 nt coding insertion in ORF1a; thus their genomes included 12 708 nt as compared to the 12 704 nt in EA...
Solberg OD, Jackson KA, Millon LV, Stott JL, Vandenplas ML, Moore JN, Watson JL.Three overlapping fragments of the equine interleukin-4 receptor alpha chain gene (IL4R) were cloned and sequenced. The resulting 3553 bp cDNA sequence exhibited homology to human, murine and bovine IL4R. The equine IL4R exhibits many conserved features when compared to other species, including intron-exon boundary positions and amino acid sequence motifs characteristic of type I cytokine receptors. The IL4R gene was localized to horse chromosome ECA13 by synteny mapping on a somatic cell hybrid panel. Evidence for an alternative splice variant of IL4R was found in the genomic sequence and sub...
Nebbia C, Dacasto M, Carletti M.Little is known about the effects of aging on the hepatic drug metabolizing capacity of horses despite the relatively long lifespan characterizing this species. A wide array of cytochrome P450 (CYP)-dependent monooxygenases, carboxylesterases and transferases were assayed in liver microsomes from 50 female horses in an age range between less than 1 year to over 12 years. Rather unexpectedly, both the CYP content and the activity of NADPH cytochrome c reductase rose as a function of age. Accordingly, a general increasing trend was recorded in the rate of the in vitro metabolism of the substrate...
Farber CR, Medrano JF.In this study the flanking sequences of 1534 horse microsatellites were used in a BLAST search to identify putative human-horse homologies. BLAST searches revealed 129 flanking sequences with significant blastn matches [alignment scores (S) > or = 60 and sum probability values (E) < or = 3.0E-6], also, 25 of these produced significant blastx matches. To provide a reference point in the human genome the flanking sequences with matches were subjected to a BLAT search of the University of California Santa Cruz (UCSC) human genome assembly (July 2003 freeze). Eighty-three of the flanking seq...
van Ginneken MM, Keizer HA, Wijnberg ID, van Dam KG, Schaart G, de Graaf-Roelfsema E, van der Kolk JH, van Breda E.To investigate whether protein kinase C (PKC) isoforms are expressed in equine skeletal muscle and determine their distribution in various types of fibers by use of immunofluorescence microscopy. Methods: 5 healthy adult Dutch Warmblood horses. Methods: In each horse, 2 biopsy specimens were obtained from the vastus lateralis muscle. Cryosections of equine muscle were stained with PKC isoform (alpha, beta1, beta2, delta, epsilon, or zeta)-specific polyclonal antibodies and examined by use of a fluorescence microscope. Homogenized muscle samples were evaluated via western blot analysis. Results...
Semevolos SA, Nixon AJ, Strassheim ML.To determine the mRNA expression of bone morphogenetic protein (BMP)-6 and -2 and a BMP antagonist (Noggin) in horses with osteochondrosis. Methods: Samples of articular cartilage from affected stifle or shoulder joints of 10 immature horses with naturally acquired osteochondrosis and corresponding joints of 9 clinically normal horses of similar age; additionally, samples of distal femoral growth plate cartilage and distal femoral articular cartilage were obtained from a normal equine fetus. Methods: Cartilage specimens were snap-frozen in liquid nitrogen, and total RNA was isolated. Adjacent ...
Sato F, Yamashita S, Kugo T, Hasegawa T, Mitsui I, Kijima-Suda I.To determine the full-length complementary DNA (cDNA) sequence of equine erythropoietin (EPO) and to develop region-specific antibodies to differentiate equine EPO (eEPO) and human EPO (hEPO). Methods: RNA and lysate extracted from renal tissues of an adult Thoroughbred. Methods: Full-length cDNA was determined by use of a reverse transcriptase-polymerase chain reaction assay and a rapid amplification of cDNA ends method. The deduced amino acid sequence was compared with sequences of EPO reported for other species. Furthermore, 4 synthetic peptides were designed in 2 distinctive parts of the e...
Brown KA, Boerboom D, Bouchard N, Doré M, Lussier JG, Sirois J.17Beta-hydroxysteroid dehydrogenase type 4 (17betaHSD4) has a unique multidomain structure, with one domain involved in 17beta-estradiol inactivation. The objective of the study was to investigate the regulation of 17betaHSD4 during human chorionic gonadotropin (hCG)-induced ovulation/luteinization. The equine 17betaHSD4 cDNA was cloned and was shown to encode a 735-amino acid protein that is highly conserved (81-87% identity) compared with other mammalian orthologs. RT-PCR/Southern blot analyses were performed to study the regulation of 17betaHSD4 transcripts in equine preovulatory follicles ...
Ginther OJ, Gastal EL, Gastal MO, Beg MA.The role of the insulin-like growth factor (IGF) system in the deviation in growth rates among follicles (follicle selection) was studied in mares using an IGF binding protein (BP) to reduce the follicular-fluid concentrations of IGFs. The future dominant follicle (F1) was treated by intrafollicular injection at the expected beginning of deviation (F1 > or = 20 mm; Day 0). The experimental groups were control (no injection, n = 8), vehicle (injection of vehicle; n = 6), and BP (injection of 250 microg of recombinant human IGFBP-3; n = 6). A sample of follicular fluid was taken from F1 on Da...
Tamaki Y, Hirata H, Takabatake N, Bork S, Yokoyama N, Xuan X, Fujisaki K, Igarashi I.A Babesia caballi gene encoding the 134-kDa (BC134) protein was immunoscreened with B. caballi-infected horse serum. An enzyme-linked immunosorbent assay (ELISA) using recombinant BC134 protein could effectively differentiate B. caballi-infected horse sera from Babesia equi-infected or noninfected control horse sera. These results suggest that the recombinant BC134 protein is a potential diagnostic antigen in the detection of B. caballi infection.
Lee EJ, Raudsepp T, Kata SR, Adelson D, Womack JE, Skow LC, Chowdhary BP.Comparative genomics has served as a backbone for the rapid development of gene maps in domesticated animals. The integration of this approach with radiation hybrid (RH) analysis provides one of the most direct ways to obtain physically ordered comparative maps across evolutionarily diverged species. We herein report the development of a detailed RH and comparative map for horse chromosome 17 (ECA17). With markers distributed at an average interval of every 1.4 Mb, the map is currently the most informative among the equine chromosomes. It comprises 75 markers (56 genes and 19 microsatellites),...
Peyrou M, Higgins R, Lavoie JP.Evolution of bacterial resistance to certain antibacterial agents in horses in a veterinary hospital. A total of 255 antibiograms, conducted according to the Kirby-Bauer method from bacterial isolates collected from horses at the Hôpital Vétérinaire d'Enseignement at the Université de Montréal between 1996 and 1998 were compared with the results obtained about 10 years ago with corresponding bacterial species. A significant increase in the percentage of strains resistant to trimethoprim-sulfamethoxazole (TMP-SXT), penicilline, tetracycline, and to gentamicin was observed. The percentages ...
Choi YH, Roasa LM, Love CC, Varner DD, Brinsko SP, Hinrichs K.This study was conducted to evaluate in vivo and in vitro development of in vitro-matured equine oocytes fertilized by intracytoplasmic sperm injection. Oocytes were collected from slaughterhouse-derived ovaries, matured in vitro, and injected with frozen-thawed stallion sperm. In vivo development was assessed after transfer of injected oocytes to the oviducts of recipient mares. Mares were killed 7.5-8.5 days after transfer and the uterus and oviducts flushed for embryo recovery. Of 132 injected oocytes transferred, 69 (52%) were recovered; of these, 25 (36%) were blastocysts with a blastocoe...
Kimura T, Hasebe R, Mukaiya R, Ochiai K, Wada R, Umemura T.Intrauterine infection with equine herpesvirus-1 (EHV-1) has been considered to be the consequence of transplacental transmission of the virus following maternal cell-associated viraemia. In this study the state of EHV-1 gene expression in the placenta of seven naturally aborted equine fetuses was examined. Neither lesions nor viral antigens were detected in the placenta of the fetuses. The amount of infectious virus in the placentas was considerably lower than that in the fetal lungs, which showed pneumonia and typical herpesvirus inclusions. Quantitative dot blot hybridization with probes sp...
Shehu-Xhilaga M, Ablan S, Demirov DG, Chen C, Montelaro RC, Freed EO.The Gag proteins of a number of different retroviruses contain late or L domains that promote the release of virions from the plasma membrane. Three types of L domains have been identified to date: Pro-Thr-Ala-Pro (PTAP), Pro-Pro-X-Tyr, and Tyr-Pro-Asp-Leu. It has previously been demonstrated that overexpression of the N-terminal, E2-like domain of the endosomal sorting factor TSG101 (TSG-5') inhibits human immunodeficiency virus type 1 (HIV-1) release but does not affect the release of the PPPY-containing retrovirus murine leukemia virus (MLV), whereas overexpression of the C-terminal portion...
Olsen HF, Meuwissen T, Klemetsdal G.The aim of this study was to examine how to apply optimal contribution selection (OCS) in the Norwegian and the North-Swedish cold-blooded trotter and give practical recommendations for the future. OCS was implemented using the software Gencont with overlapping generations and selected a few, but young sires, as these turn over the generations faster and thus is less related to the mare candidates. In addition, a number of Swedish sires were selected as they were less related to the selection candidates. We concluded that implementing OCS is feasible to select sires (there is no selection on m...
Rivas VN, Aleman M, Peterson JA, Dahlgren AR, Hales EN, Finno CJ.Juvenile idiopathic epilepsy (JIE) is an inherited disease characterized by recurrent seizures during the first year of life in Egyptian Arabian horses. Definitive diagnosis requires an electroencephalogram (EEG) performed by a veterinary specialist. A recent study has suggested that a 19 base-pair deletion, along with a triple-C insertion, in intron five of twelve (∆19InsCCC; chr20:29542397-29542425: GTTCAGGGGACCACATGGCTCTCTATAGA>TATCTTAAGACCC) of the () gene is associated with JIE. To confirm this association, a new sample set consisting of nine EEG-phenotyped affected and nine unaffec...
Ahmad F.The denaturation of horse metmyoglobin by guanidine hydrochloride was studied at pH 6.4 and 25 degrees C. Measurements of both the peptide circular dichroism and the absorbance in the Soret region suggest that the extent of renaturation strongly depends on the time interval during which the protein is exposed to concentrated solutions of the denaturant. From the equilibrium measurements of the absorption in the Soret region, it is concluded that the unfolding of metmyoglobin is complex. This is further supported by kinetic studies of denaturation which suggest the occurrence of the least four ...
Henze A, Aumer F, Grabner A, Raila J, Schweigert FJ.Although horses and donkeys belong to the same genus, their genetic characteristics probably result in specific proteomes and post-translational modifications (PTM) of proteins. Since PTM can alter protein properties, specific PTM may contribute to species-specific characteristics. Therefore, the aim of the present study was to analyse differences in serum protein profiles of horses and donkeys as well as mules, which combine the genetic backgrounds of both species. Additionally, changes in PTM of the protein transthyretin (TTR) were analysed. Serum protein profiles of each species (five anima...
Rink BE, Kuhl J, Esteves CL, French HM, Watson E, Aurich C, Donadeu FX.Mesenchymal stem or stromal cells (MSCs) play key roles in tissue homeostasis. In the cyclic equine endometrium, this may be regulated by changes in serum concentrations of sex steroid hormones. This study was designed to investigate the changes in endometrial expression of MSC markers during reproductive cycles in mares and the influence of sex steroid hormones on endometrial MSC proliferation in vitro. Endometrial biopsies were collected from pony mares at different reproductive stages (estrus; day 5 and 13 after ovulation; seasonal anestrus; 20 h and 7days post-partum; n = 5 per stag...
da Piedade I, Skive B, Christensen H, Bojesen AM.We present the draft genome sequence of Streptococcus equi subsp. zooepidemicus S31A1, a strain isolated from equine infectious endometritis in Denmark. Comparative analyses of this genome were done with four published reference genomes: S. zooepidemicus strains MGCS10565, ATCC 35246, and H70 and S. equi subsp. equi strain 4047.
Beintema JJ.Parts of the amino acid sequences of horse and dromedary pancreatic ribonuclease were reinvestigated. The sequence of residues 21-25 in horse ribonuclease is Ser-Asn-Pro-Thr-Tyr or Ser-Asn-Ser-Thr-Tyr. The asparagine in the latter sequence is glycosylated. Horse ribonuclease possesses four additional amino acid residues at the C-terminus, like a number of other ribonucleases. Position 39 in horse and dromedary ribonuclease is not deleted but is occupied by tryptophan.
Ipiña Z, Lussier JG, Theoret CL.To clone full-length equine pigment epithelium-derived factor (PEDF) complementary DNA (cDNA) and to evaluate its temporal expression during repair of wounds in horses. Methods: 4 clinically normal 2-to 3-year-old Standardbred mares. Methods: Full-length equine PEDF cDNA was cloned by screening size-selected cDNA libraries derived from biopsy specimens obtained from the wound edge 7 days after experimental creation of a 6.25-cm(2) full-thickness wound in the skin of the lateral thoracic wall. Expression was evaluated in normal skin and in biopsy specimens obtained weekly from experimentally in...
Dong J, Cook FR, Haga T, Horii Y, Norimine J, Misawa N, Goto Y, Zhu W.Although equine infectious anemia virus (EIAV) poses a major threat to the equine industry worldwide, the molecular epidemiology of this virus is poorly understood. Recently, an EIAV strain (EIAVMiyazaki2011-A) representing a new monophyletic group was discovered in feral horses in southern Japan. In the present study, the EIAVMiyazaki2011-A proviral genome is compared with evolutionarily divergent EIAV isolates to investigate conservation of functional elements or motifs within the long terminal repeats (LTRs) and structural genes. This analysis represents a significant step forward in increa...
Johnson GC, Kohn CW, Johnson CW, Garry F, Scott D, Martin S.Ultrastructural examination of a mechanobullous disease of probable hereditary nature in Belgian foals, confirmed light microscopic findings that separation of the dermo-epidermal junction occurred through the lamina lucida of the basement membrane, leaving the intact lamina densa adherent to the dermis and the plasmalemma of the basal epithelial cells intact. The location of the cleft and the presence of small hemidesmosomes in adjacent intact skin are additional characteristics which make this condition similar to junctional epidermolysis bullosa of man.
Samitz EM, Biberstein EL.Thirty-seven local isolates of Actinobacillus suis-like organisms from diseased and clinically normal horses and 1 llama were compared with reference strains of A suis, A lignieresii, A equuli, A capsulatus, A hominis, A (Pasteurella) ureae, and equine A suis-like organisms (ASLO) previously described in literature. Comparison was by cultural characteristics, carbohydrate fermentation, enzyme profiles, and whole-cell protein polyacrylamide gel electrophoresis. Carbohydrate fermentation, determined by API-CH gallery, divided 36 equine ASLO isolates into 6 API-CH biotypes. The llama isolate was ...
Hess-Dudan F, Vacher PY, Bruckmaier RM, Weishaupt MA, Burger D, Blum JW.Concentration of (total) globulin was relatively stable in blood plasma of mares, but rapidly decreased in colostrum to very low levels within 2 days after parturition. In foals, after intake of the first colostrum, globulin increased within 1 day in blood plasma, but remained at lower concentrations than those measured in mare plasma. Concentrations of immunoreactive insulin (iI) were high during the first 2 months of lactation in blood plasma of mares and then decreased, were high in first colostrum and then decreased drastically, and remained at low concentrations up to weaning in blood of ...
Escande F, Vallee E, Aubart F.The isolation of Pasteurella caballi from an horse-bite wound in a 56-year-old man is reported. Biochemical characteristics are described and compared with the other species representing the genus Pasteurella. This strain probably represents the first human isolate of P. caballi in France.
Schlater LR.Thirteen strains of a gram-negative, fermentative bacterium that produced gas from glucose were isolated from horses with a variety of clinical conditions. The morphological and biochemical characteristics of this bacterium are similar to those described for the family Pasteurellaceae. These strains appear to constitute a new taxon within the genus Pasteurella; however, the final taxonomic position of this group depends upon more detailed genetic studies. Case histories indicate that this bacterium may be a primary respiratory pathogen and may play a secondary role in various other disease con...
Lewis N, Canesin H, Choi YH, Foss R, Felix M, Rader K, Hinrichs K.Information on factors associated with developmental competence of equine in vitro -produced (IVP) blastocysts is lacking. Objective: To determine the relationships of stage, grade, day of development, and specific morphological parameters of equine IVP blastocysts, to pregnancy and foaling rates. Methods: Photomicrographs of 316 IVP embryos with known pregnancy outcomes were scrutinised individually by four observers. Inter-observer variation was assessed, and pregnancy outcome evaluated in relation to day of blastocyst development and assigned grade and stage. Individual component analysis w...
Geelen SN, Bernadina WE, Grinwis GC, Kalsbeek HC.A 15-year-old Dutch warmblood mare was presented because of lethargy, which had been present for several weeks, and severe anaemia. Total protein was high and serum electrophoresis revealed a monoclonal peak in the alpha-2 region. Monoclonal immunoglobulin, IgG(T), was detected by immuno-electrophoresis in serum and urine. Postmortem examination revealed a relatively large number of plasmacytoid cells in the bone marrow and a monotonous population of plasmacytoid cells in the spleen. These findings are suggestive of a plasma cell myeloma.