The study of diseases in horses encompasses a wide range of conditions affecting equine health, including infectious diseases, metabolic disorders, and genetic abnormalities. These diseases can impact various systems within the horse, such as respiratory, gastrointestinal, and musculoskeletal systems, and can lead to significant health challenges. Research in this area focuses on understanding the pathophysiology, diagnosis, prevention, and treatment of equine diseases. Common diseases studied include equine influenza, equine herpesvirus, and laminitis. This page provides access to peer-reviewed research studies and scholarly articles that explore the etiology, clinical presentation, and management strategies of diseases in horses, contributing to the advancement of equine veterinary medicine.
Aleman M, Gillis CL, Nieto JE, Renaudin CD, Bea J.Knowledge of normal renal parameters, as documented in mature horses, is essential for the accurate evaluation of abnormal kidneys. Although the ultrasonographic appearance and location of the abdominal organs in foals and the renal dimensions in neonates have been reported, there is currently no information available for the assessment of normal organ growth in foals. The objectives of the study were to describe the ultrasonographic characteristics, location and variations of the thoracic and abdominal organs with relation to age, height and weight; and provide a growth table for comparison w...
Hultén C, Grönlund U, Hirvonen J, Tulamo RM, Suominen MM, Marhaug G, Forsberg M.Despite the importance of noninfectious joint diseases in equine medicine, little is known about the acute phase response which may be elicited if the local inflammatory process of noninfectious arthritis is sufficiently strong, Therefore the aim of this study was to monitor the systemic inflammatory response during experimentally-induced noninfectious arthritis by studying the dynamics in serum of the acute phase proteins serum amyloid A (SAA), haptoglobin, fibrinogen and alpha2-globulins. Twenty-four Standardbred horses, age 3-7 years, found healthy on thorough clinical, radiological, haemat...
Lebis C, Bourdeau P, Marzin-Keller F.Allergic diseases are often diagnosed clinically in the horse without performing diagnostic tests. The purpose of this work was to contribute to the validation of intradermal skin tests in the horse. Eighty-three horses, 14 showing skin or respiratory signs of supposed allergic origin, were subjected to an intradermal skin test using 6 different allergens, positive and negative controls. The tests were read for all animals after 20 min, and for 29 horses after 1 and 4 h. Additionally, 19 horses were tested a few months apart. The comparison after 20 min of the cutaneous reactions to allergens ...
Taouji S, Collobert C, Gicquel B, Sailleau C, Brisseau N, Moussu C, Breuil MF, Pronost S, Borchers K, Zientara S.Equine herpesviruses type 1 and 4 (EHV-1 and EHV-4) are ubiquitous in the equine population. One of their main properties is their ability to establish life-long latent infections in their hosts even in those with natural or vaccine-induced immunity. However, effect of vaccination status on prevalence and tissue tropism was not established. In this study, EHV-1 and EHV-4 were detected by polymerase chain reaction and by classical virus isolation from neural, epithelial and lymphoid tissues collected from unvaccinated (33) or vaccinated (23) horses. The percentage of EHV-1- and EHV-4-positive h...
Campo MS.Tumorigenesis due to papillomavirus (PV) infection was first demonstrated in rabbits and cattle early last century. Despite the evidence obtained in animals, the role of viruses in human cancer was dismissed as irrelevant. It took a paradigm shift in the late 1970s for some viruses to be recognised as 'tumour viruses' in humans, and in 1995, more than 60 years after Rous's first demonstration of CRPV oncogenicity, WHO officially declared that 'HPV-16 and HPV-18 are carcinogenic to humans'. Experimental studies with animal PVs have been a determining factor in this decision. Animal PVs have bee...
Perkins GA, Yeager A, Erb HN, Nydam DV, Divers TJ, Bowman JL.The purpose of this study was to determine if colostrum-deprived foals with experimentally induced Rhodococcus equi pneumonia have a decreased severity of the disease and decreased mortality rate when given hyperimmune (HI) R. equi antibody plasma (R. equi titer at least 100 % and virulence-associated protein A [VapA] at least 10000) prophylactically versus when given normal equine plasma (R. equi titer less than 20 % and VapA less than 160). Sixteen colostrum-deprived foals (R. equi titer less than 5 %) each received normal equine plasma in the first 24 hours of life (R. equi titer less than ...
Collobert-Laugier C, Hoste H, Sevin C, Dorchies P.Forty-two horses from Normandy (France) were examined post-mortem for small strongyle infections from October to March. In the positive horses, total worm numbers ranged from 234 to 90,247 (mean 11,297). Encysted larvae represented the major part of the total cyathostome burdens with a high percentage (83%) being early third stage larvae. They were mostly recovered from the caecum (48%) and ventral colon (40%) and were less present in the dorsal colon (12%). Adult cyathostomes were mainly located in the ventral colon (64%) and less frequently in the dorsal colon (27%) and caecum (9%). Twenty s...
Schmitt B.Vesicular stomatitis is an infrequent yet important vesicular disease of cattle, horses, and swine. Periodic outbreaks of this disease in the United States have caused economic losses in cattle herds because of decreased production, movement restrictions, and trade embargoes. Vesicular stomatitis causes clinical signs indistinguishable from those of foot-and-mouth disease. It is of utmost importance that appropriate samples are collected from clinical cases of vesicular disease in cattle and swine so a rapid laboratory diagnosis can be made.
Ryu SH, Bak UB, Kim JG, Yoon HJ, Seo HS, Kim JT, Park JY, Lee CW.A 7-year-old Thoroughbred horse was admitted to the Equine Hospital, Korea Racing Association with signs of colic. Based on the size of impactions, the clinical signs, the results of abdominal paracentesis and medical treatment, the prognosis was poor. The horse died 3 hours later following hopeless discharge. At necropsy, the caecum and large colon were fully filled with fecal contents and there was a rupture (10 cm in dia) in the latero- ventral caecum. The mucosa of the ileo-caecal and caeco- colic valves appeared to the hyperemic, edematous and ulcerous. There were many tapeworms in the af...
Maleski K, Magdesian KG, LaFranco-Scheuch L, Pappagianis D, Carlson GP.A 13-day-old foal with profound tachypnoea and respiratory distress was examined. Thoracic radiographs revealed a severe, diffuse miliary pattern, and the foal was markedly hypoxaemic. It failed to improve with empirical treatment, and was euthanased. Lesions associated with Coccidioides immitis infection were identified at postmortem examination, and were limited to the lower respiratory tract.
Jacks S, Giguère S, Gronwall RR, Brown MP, Merritt KA.Clarithromycin offers numerous advantages over erythromycin and thus, is an attractive alternative for the treatment of Rhodococcus equi infections in foals. The disposition of clarithromycin was investigated in 6 foals after intragastric administration at a dose of 10 mg/kg body weight. Detectable serum concentrations of clarithromycin were found in 3 of 6 foals at 10 minutes and in all foals by 20 minutes post-administration. Time to peak serum concentration (Tmax) was 1.5 hours and peak serum concentration (Cmax) was 0.92+/-0.17 microg/ml. Mean serum concentrations decreased to 0.03 microg/...
Smith MA, Ross MW.To determine features of postoperative wound infection caused by Actinobacillus spp in horses undergoing clean, elective surgery and to evaluate bacterial susceptibility profiles of bacteria isolated. Methods: Retrospective study. Methods: 10 horses. Methods: Data were retrieved from medical records and the microbiology laboratory database. Results: 1,604 horses underwent clean, elective surgical procedures during the study period. Of these, 23 (1.43%) had postoperative wound infections, and Actinobacillus spp was isolated from 10 of these 23 (43%). Surgical procedures in these 10 horses inclu...
Flaminio MJ, LaCombe V, Kohn CW, Antczak DF.A 12-year-old Quarter Horse mare that was nonresponsive to medical treatment was evaluated for chronic respiratory disease and hepatobiliary disease. Serum immunoglobulin concentrations were measured by use of radial immunodiffusion that revealed trace to nondetectable concentrations of IgG, IgG(T), IgM, and IgA. Use of serum protein electrophoresis confirmed agammaglobulinemia by the absence of the expected peak in the gamma region. In addition, vaccination with tetanus toxoid did not result in specific immunoglobulin production. Flow cytometric analysis of blood lymphocyte subpopulations rev...
Lopez AM, Hines MT, Palmer GH, Alperin DC, Hines SA.Rhodococcus equi infects and causes pneumonia in foals between 2 and 4 months of age but does not induce disease in immunocompetent adults, which are immune and remain clinically normal upon challenge. Understanding the protective response against R. equi in adult horses is important in the development of vaccine strategies, since those mechanisms likely reflect the protective phenotype that an effective vaccine would generate in the foal. Twelve adult horses were challenged with virulent R. equi and shown to be protected against clinical disease. Stimulation of cells obtained from bronchoalve...
Durando MM, Martin BB, Hammer EJ, Langsam SP, Birks EK.The primary goal was to investigate the relationship between dynamic upper airway abnormalities and arterial blood gas tensions during exercise. Horses that completed a high-speed treadmill examination consisting of upper-airway videoendoscopy, blood gas evaluation and electrocardiogams and, postexercise, echocardiograms and tracheal washes, were included. An age-matched group of fit, healthy Thoroughbreds, trained to run on a high-speed treadmill, served as controls for blood gas values at specific exercise speeds. One hundred and nineteen horses completed the treadmill examination. Sixty (50...
Menzies-Gow NJ, Patterson-Kane JC, McGowan CM.The clinical signs of chronic nodular panniculitis in a three-year-old mare were consistent with a diagnosis of sterile nodular panniculitis, but the mare had histopathological signs of both generalised steatitis and sterile nodular panniculitis. The mare was deficient in vitamin E and selenium.
Harmegnies NF, Duvivier DH, Vandenput SN, Art T, Lekeux PM, Votion DM.This study aimed to compare exercise-induced pulmonary perfusion redistribution in healthy vs. 'heavey' horses using scintigraphy, a minimally invasive technique. Six healthy (A) and 5 'heavey' horses in remission (B(I)) and during clinical signs of disease (B(II)) were investigated. Dimensions of the exercising pulmonary perfusion (QE) images were expressed in percent of the resting perfusion (QR) images. Computed QE to QR ratios (QE/QR) images enabled the definition of the region more perfused at exercise than at rest (R1). In all groups, exercise induced a major enlargement of the Q image b...
Franklin SH, Naylor JR, Lane JG.Dorsal displacement of the soft palate (DDSP) is one of the most common obstructive conditions of the upper respiratory tract in the racehorse. The present study was conducted to determine the effects of intermittent dorsal displacement of the soft palate (DDSP) on ventilation and respiratory airflow during high intensity exercise. Videoendoscopic recordings were made of the nasopharynx and larynx simultaneously with measurements of airflow and respiratory gas exchange, during high-speed treadmill exercise in 9 horses with confirmed intermittent DDSP admitted for clinical investigation of poor...
Yasuda R, Kawano J, Matsuo E, Masuda T, Shimizu A, Anzai T, Hashikura S.The prevalence of staphylococci that harbor the mecA gene responsible for methicillin resistance was examined in healthy breeding mares. Staphylococci often cause diseases of horses such as metritis, keratitis, and abscess. Methicillin-resistant staphylococci would make antibiotic treatments ineffective, so it may be significant to know the distribution of mecA-harboring staphylococci in mares. Isolation of mecA-harboring staphylococci was achieved from nares and pasterns of 100 mares in Hokkaido, Japan. From 13% of the mares, mecA-harboring staphylococci, including 15 isolates of Staphylococc...
Nieto JE, Spier S, Pipers FS, Stanley S, Aleman MR, Smith DC, Snyder JR.To compare effects of a commercially available omeprazole paste and a compounded omeprazole suspension on healing of gastric ulcers in Thoroughbred racehorses in active training. Methods: Randomized controlled trial. Methods: 32 horses with gastric ulcers. Methods: Horses were assigned to 2 groups on the basis of endoscopic gastric ulcer severity. Group-1 horses were treated with omeprazole suspension for 30 days and with omeprazole paste for an additional 30 days. Group-2 horses were treated with omeprazole paste for 30 days and omeprazole suspension for an additional 30 days. Serum omeprazol...
de Freitas CM, Leite RC, Lopes CM, Rodrigues DS, Paz GF, de Oliveira PR.Some reproductive parameters of adult stages of Amblyomma cajennense ticks were studied. The capacity of virgin females to reproduce by parthenogenesis was evaluated, during an experimental infestation, in absence of males, on a horse (Equus cabalus). Ticks were spread either completely free or in limited sites on the body of the animal. The engorged virgin females showed longer feeding periods and lighter body weights than those that had been fertilized. Some of these unmated females produced smaller egg masses, which had no embryonary development. On the other hand, females that had been ins...
Christensen H, Bisgaard M, Olsen JE.Members of Bisgaard taxon 11 have been isolated from horses. These bacteria are of importance in the veterinary clinic and also to the medical profession, since they may be isolated from infected wounds of humans bitten by horses. Six strains from different continents were identified as taxon 11, with 16S rRNA similarities between 98.0 and 99.7%. A single isolate that represented the so-called (+)L-arabinose-positive Actinobacillus equuli isolated from a diseased foal showed 99.9% 16S rRNA similarity to the type strain of A. equuli. DNA-DNA hybridizations showed that (+)L-arabinose-positive st...
Tanaka K, Asai Y, Kuwano A.At 114 ranches in the Hidaka District of Hokkaido, a total of 1,118 Thoroughbred foals that were born from January to June 2003 were examined at different times from May to September of the same year to ascertain the occurrence of clubfoot. Clubfoot was seen in a total of 179 foals (16%) at 89 ranches (78%). Also, 124 of the 179 foals (69.3%) had clubfoot of grade II or higher, and it was found that grade I was likely to be overlooked or rapidly advance. In the present study, the occurrence of clubfoot was higher than expected in the investigated region. Hence, it is necessary to establish acc...
Machida N, Yasuda J, Too K, Kudo N.The obliteration processes of the ductus arteriosus of equine foetuses and newborn foals were studied morphometrically and histologically. The length, internal and external diameters and circumference of the ductus in equine foetuses increased progressively and linearly up to 310 days with advancing foetal age, but the values, especially the internal diameter, decreased from 320 to 330 days. After birth, the ductal measurements decreased gradually and ductal closure was found in three of 14 foals examined on the first day post partum, in two of six on the second day and in nine of nine on the ...
Duckett WM, Matthews HK.Paraneoplastic eosinophilia is reported in dogs, cats, and humans. Hypereosinophilia (an eosinophil count greater than 1.5 x 10(9) L) is often associated with metastasis and a poor prognosis. This report describes a case of paraneoplastic hypereosinophilia in a pony. Neoplasia should be included in the differential diagnoses in a horse with eosinophilia.
Reef VB.Cardiac disease in the equine neonate occurs infrequently. Murmurs are often heard in foals and are not considered significant unless they persist beyond 4 days of age. Congenital cardiac defects are the most common form of primary cardiac disease in the foal, with ventricular septal defects occurring most frequently. Other neonatal foal diseases such as ruptured bladders, white muscle disease, neonatal respiratory distress syndrome, and septicemia have secondary cardiac involvement.
Socha W, Rola J, Żmudziński JF.The genetic stability of ORF1a encoding non-structural proteins nsp1, nsp2, nsp3 and nsp4 of equine arteritis virus (EAV) has been analysed for nearly seven years in a persistently infected stallion of the Malopolska breed. Between November 2004 and June 2011, 11 semen samples were collected. Viral RNA extracted from semen of this carrier stallion was amplified, sequenced and compared with the sequences of the other known strains of EAV. Sequence analysis of ORF1a showed 84 synonymous and 16 non-synonymous mutations. The most variable part of ORF1a was the region encoding nsp2 protein with 13 ...
Ramzan PH, Palmer L.Fissures of the occlusal surface of the equine cheek tooth are poorly understood and their association with dental disease is unknown. Objective: To describe the prevalence and location of occlusal fissures in the cheek teeth (CT) of a group of horses referred for dental investigation/treatment, and determine association with intercurrent dental disease. Methods: Digital video recordings of oral endoscopic examinations for all horses referred to the Rossdales Equine Hospital for dental investigation from November 2006 to June 2009 were reviewed. Location of occlusal fissures in relation to bot...
Lester GD, Bolton JR, Cambridge H, Thurgate S.The myoelectrical activity of the ileum, caecum and large colon was monitored from Ag-AgCl bipolar recording electrodes in four conscious 'parasite-naive' weanling foals. All foals were inoculated with 1000 infective 3rd-stage Strongylus vulgaris larvae and alterations to the myoelectrical activity observed. The frequencies of caecal and colonic spike bursts increased significantly in all post infection periods coinciding with assumed larval penetration into the intestinal mucosa and migration through the vasculature. Peaks in caecal and colonic activity occurred at Days 1 to 5 post infection....
Argo CM.Leisure animals now comprise the majority of working horses in industrialized nations; a shift that has decreased workloads yet improved veterinary care and lifetime health. Although many horses now progress well into their 20s without any requirement for dietary modification, age-related changes are insidious, and older animals benefit from regular veterinary monitoring to identify, address, and ameliorate the inevitable onset of age-related "disease." Basal metabolic rate decreases with age; older animals expend less energy on controlled exercise, and there can be an increased propensity tow...
Stadler P, van den Berg SS, Tustin RC.A Hansen type I cervical intervertebral disc prolapse was diagnosed in a 16-year-old American Saddler showing clinical signs of paresis and ataxia. An ante-mortem diagnosis was made by means of plain radiographs and a myelogram. The horse was euthanased and the diagnosis confirmed on a post-mortem examination.
Allombert J, Vianney A, Laugier C, Petry S, Hébert L.Taylorella equigenitalis is the causative agent of contagious equine metritis, a sexually-transmitted infection of Equidae characterised in infected mares by abundant mucopurulent vaginal discharge and a variable degree of vaginitis, cervicitis or endometritis, usually resulting in temporary infertility. The second species of the Taylorella genus, Taylorella asinigenitalis, is considered non-pathogenic, although mares experimentally infected with this bacterium can develop clinical signs of endometritis. To date, little is understood about the basic molecular virulence and persistence mechanis...
Williamson LH, Farrell RL.A case of intracranial schwannoma is described in a young horse. Clinical signs developed slowly and were suggestive of a lesion involving the left cerebrum. The filly exhibited a change in mentation, and circled to the left. Visual impairment and decreased facial sensation were noted on the right side. A solitary schwannoma which compressed the left cerebrum was found at necropsy.
Güleğen E, Cirak VY.Lice infestations of horses occur mainly during winter months and are characterized by severe pruritus and an unkempt coat. Two lice have been described for equines namely Bovicola (Damalinia) equi and Haemotopinus asini. There is a scarcity of data on the occurrence and prevalence rates of these horse pathogens in Turkey. This paper reports a thoroughbred farm, in which two horses were found to be infested with B. equi. The horses were treated with propoxur and no lice or nymphs could be found after treatment for10 days.
Rivas VN, Aleman M, Peterson JA, Dahlgren AR, Hales EN, Finno CJ.Juvenile idiopathic epilepsy (JIE) is an inherited disease characterized by recurrent seizures during the first year of life in Egyptian Arabian horses. Definitive diagnosis requires an electroencephalogram (EEG) performed by a veterinary specialist. A recent study has suggested that a 19 base-pair deletion, along with a triple-C insertion, in intron five of twelve (∆19InsCCC; chr20:29542397-29542425: GTTCAGGGGACCACATGGCTCTCTATAGA>TATCTTAAGACCC) of the () gene is associated with JIE. To confirm this association, a new sample set consisting of nine EEG-phenotyped affected and nine unaffec...