The study of diseases in horses encompasses a wide range of conditions affecting equine health, including infectious diseases, metabolic disorders, and genetic abnormalities. These diseases can impact various systems within the horse, such as respiratory, gastrointestinal, and musculoskeletal systems, and can lead to significant health challenges. Research in this area focuses on understanding the pathophysiology, diagnosis, prevention, and treatment of equine diseases. Common diseases studied include equine influenza, equine herpesvirus, and laminitis. This page provides access to peer-reviewed research studies and scholarly articles that explore the etiology, clinical presentation, and management strategies of diseases in horses, contributing to the advancement of equine veterinary medicine.
Paradis MR.Owners of older horses have generally owned them for a long time. They have developed a bond that is similar to that seen with companion animals. Their desire to have their animal(s) age gracefully with comfort and mobility has stirred research in the field of equine geriatric medicine. Equine geriatric medicine is to the first decade of the twenty-first century as neonatal medicine was to the 1980s. Hopefully, the demographics discussed in this article highlight area where research can be most helpful.
Davis E, Rush BR.Recurrent airway obstruction is a condition that affects some older horses maintained in confinement. Clinical signs range from exercise intolerance with occasional cough to dyspnea at rest. Bronchoalveolar lavage cytology is characterized by neutrophilic leukocytosis (15%-85%) and is recommended for making the diagnosis in horses with mild to moderate disease. Environmental management combined with periodic bronchodilator and antiinflammatory corticosteroid therapy yields the best prognosis for disease remission.
Botha CJ, Naudé TW.Well-known plant poisonings such as 'dunsiekte' (seneciosis) and 'jaagsiekte' (crotalariosis) of horses in southern Africa are briefly reviewed. Relatively unfamiliar mycotoxicoses such as stachybotryotoxicosis and perennial rye grass staggers and potentially occurring exotic intoxications such as equine nigropallidal encephalomalacia and ergot alkaloid poisoning are also discussed. This article is aimed at informing the southern African equine practitioner about probable poisonings that might occur locally in horses.
Okulewicz A, Lonc E, Borgsteede FH.The biology of the ascarid nematodes has been discussed in the context of their important economic role in farm animals, pet animals and zoo animals with special attention to carnivores and primates. In farm animals, infection with the most common roundworm of horses (Parascaris equorum) and swine (Ascaris suum) depend on many factors such as environmental conditions (larval development in the egg and egg survival), age of the host, breed, husbandry system, hygiene and treatment schedule. The monoxenic ascarids Toxocara canis and T. cati are the most important nematodes in carnivorous animals ...
Donahue JM, Williams NM, Sells SF, Labeda DP.Over the course of the past decade, actinomycetes have been isolated from the placentas of horses diagnosed with nocardioform placentitis. The incidence of this infection has generally been low, with typically no more than 30 animals affected in most years, but the incidence increased through 1999, with placentas from 144 mares found to be infected. Approximately half of the cases result in loss of the foal. A typical actinomycete with branching mycelium was isolated from placental lesions, and a comparison of the sequence of the 16S rDNA gene against the public databases indicated a relations...
Fintl C, Milne EM, McGorum BC.To determine whether urinalysis can aid the diagnosis of equine grass sickness, samples of urine from 15 horses with acute grass sickness, eight horses with subacute grass sickness, 17 co-grazing horses and 17 stabled control horses were analysed. The samples from all of the horses with grass sickness had a significantly higher specific gravity, higher protein and creatinine concentrations and a significantly lower pH; the samples from the horses with acute grass sickness also had significantly higher glucose concentrations. These differences may support a diagnosis of grass sickness but they ...
Daly P, Doyle S.Equine herpesvirus-1 (EHV-1) infection is of significant animal welfare and economic importance. Yet, no standardised molecular techniques are available for diagnosis or confirmation of viral infection. The purpose of this study was to develop a standardised and quantitative assay system for the reliable detection of EHV-1 infection which was capable of eliminating the likelihood of false negative results. A region within the EHV-1 glycoprotein B gene was amplified by polymerase chain reaction (PCR), cloned and subjected to site-directed mutagenesis to generate a control plasmid, amplifiable b...
Ferrell EA, Gavin PR, Tucker RL, Sellon DC, Hines MT.Magnetic resonance (MR) imaging was used as a neurodiagnostic modality in the assessment of 12 horses with neurologic disease localized cranial to the foramen magnum. This retrospective study included a mixed population of horse breeds and consisted of three foals and nine adult horses. MR sequences of the head and central nervous system of each horse were acquired. Routine MR sequences included transverse T1 weighted (T1wt), T2 weighted (T2wt), and proton density images. Additional imaging sequences were obtained on a patient-dependent basis. Eight neurologic related diseases were diagnosed. ...
Gonçalves S, Julliand V, Leblond A.Many factors have been identified as risk factors for colic in horses in several epidemiological studies. The aim of our paper was to review the results of 12 epidemiological studies, in order to assess the impact of each risk factor for colic. According to the literature, the factors that increase the risk of colic are feeding practices (type and quality of food, type and changes of feeding), the intrinsic factors of horses (sex, age and breed), management (type and changes of housing and activity), medical history (a previous colic, administration of a medical treatment) and parasite control...
Cable CS, Ducharme NG, Hackett RP, Erb HN, Mitchell LM, Soderholm LV.To investigate whether upper airway sounds of horses exercising with laryngeal hemiplegia and alar fold paralysis have distinct sound characteristics, compared with unaffected horses. Methods: 6 mature horses. Methods: Upper airway sounds were recorded in horses exercising on a high-speed treadmill at maximum heart rate (HR(MAX)) under 3 treatment conditions (ie, normal upper airway function [control condition], and after induction of left laryngeal hemiplegia or bilateral alar fold paralysis) in a randomized crossover design. Fundamental frequency, spectrograms using Gabor transform, and inte...
McGowan CM, Fordham T, Christley RM.Telephone surveys of 34 racing yards with 1276 horses in training were made to establish the overall incidence of exertional rhabdomyolysis in the previous year. A case-control study was used to investigate the risk factors for the syndrome in 12 yards selected on the basis of the routine confirmation of diagnoses by the evaluation of the serum activities of creatine kinase and aspartate aminotransferase. The overall incidence of the syndrome was 6.7 per cent and 80 per cent of the trainers had at least one affected horse. In 74 per cent of the affected horses it frequently recurred, with an a...
Aleman M, Gillis CL, Nieto JE, Renaudin CD, Bea J.Knowledge of normal renal parameters, as documented in mature horses, is essential for the accurate evaluation of abnormal kidneys. Although the ultrasonographic appearance and location of the abdominal organs in foals and the renal dimensions in neonates have been reported, there is currently no information available for the assessment of normal organ growth in foals. The objectives of the study were to describe the ultrasonographic characteristics, location and variations of the thoracic and abdominal organs with relation to age, height and weight; and provide a growth table for comparison w...
Hultén C, Grönlund U, Hirvonen J, Tulamo RM, Suominen MM, Marhaug G, Forsberg M.Despite the importance of noninfectious joint diseases in equine medicine, little is known about the acute phase response which may be elicited if the local inflammatory process of noninfectious arthritis is sufficiently strong, Therefore the aim of this study was to monitor the systemic inflammatory response during experimentally-induced noninfectious arthritis by studying the dynamics in serum of the acute phase proteins serum amyloid A (SAA), haptoglobin, fibrinogen and alpha2-globulins. Twenty-four Standardbred horses, age 3-7 years, found healthy on thorough clinical, radiological, haemat...
Lebis C, Bourdeau P, Marzin-Keller F.Allergic diseases are often diagnosed clinically in the horse without performing diagnostic tests. The purpose of this work was to contribute to the validation of intradermal skin tests in the horse. Eighty-three horses, 14 showing skin or respiratory signs of supposed allergic origin, were subjected to an intradermal skin test using 6 different allergens, positive and negative controls. The tests were read for all animals after 20 min, and for 29 horses after 1 and 4 h. Additionally, 19 horses were tested a few months apart. The comparison after 20 min of the cutaneous reactions to allergens ...
Taouji S, Collobert C, Gicquel B, Sailleau C, Brisseau N, Moussu C, Breuil MF, Pronost S, Borchers K, Zientara S.Equine herpesviruses type 1 and 4 (EHV-1 and EHV-4) are ubiquitous in the equine population. One of their main properties is their ability to establish life-long latent infections in their hosts even in those with natural or vaccine-induced immunity. However, effect of vaccination status on prevalence and tissue tropism was not established. In this study, EHV-1 and EHV-4 were detected by polymerase chain reaction and by classical virus isolation from neural, epithelial and lymphoid tissues collected from unvaccinated (33) or vaccinated (23) horses. The percentage of EHV-1- and EHV-4-positive h...
Campo MS.Tumorigenesis due to papillomavirus (PV) infection was first demonstrated in rabbits and cattle early last century. Despite the evidence obtained in animals, the role of viruses in human cancer was dismissed as irrelevant. It took a paradigm shift in the late 1970s for some viruses to be recognised as 'tumour viruses' in humans, and in 1995, more than 60 years after Rous's first demonstration of CRPV oncogenicity, WHO officially declared that 'HPV-16 and HPV-18 are carcinogenic to humans'. Experimental studies with animal PVs have been a determining factor in this decision. Animal PVs have bee...
Perkins GA, Yeager A, Erb HN, Nydam DV, Divers TJ, Bowman JL.The purpose of this study was to determine if colostrum-deprived foals with experimentally induced Rhodococcus equi pneumonia have a decreased severity of the disease and decreased mortality rate when given hyperimmune (HI) R. equi antibody plasma (R. equi titer at least 100 % and virulence-associated protein A [VapA] at least 10000) prophylactically versus when given normal equine plasma (R. equi titer less than 20 % and VapA less than 160). Sixteen colostrum-deprived foals (R. equi titer less than 5 %) each received normal equine plasma in the first 24 hours of life (R. equi titer less than ...
Collobert-Laugier C, Hoste H, Sevin C, Dorchies P.Forty-two horses from Normandy (France) were examined post-mortem for small strongyle infections from October to March. In the positive horses, total worm numbers ranged from 234 to 90,247 (mean 11,297). Encysted larvae represented the major part of the total cyathostome burdens with a high percentage (83%) being early third stage larvae. They were mostly recovered from the caecum (48%) and ventral colon (40%) and were less present in the dorsal colon (12%). Adult cyathostomes were mainly located in the ventral colon (64%) and less frequently in the dorsal colon (27%) and caecum (9%). Twenty s...
Schmitt B.Vesicular stomatitis is an infrequent yet important vesicular disease of cattle, horses, and swine. Periodic outbreaks of this disease in the United States have caused economic losses in cattle herds because of decreased production, movement restrictions, and trade embargoes. Vesicular stomatitis causes clinical signs indistinguishable from those of foot-and-mouth disease. It is of utmost importance that appropriate samples are collected from clinical cases of vesicular disease in cattle and swine so a rapid laboratory diagnosis can be made.
Ryu SH, Bak UB, Kim JG, Yoon HJ, Seo HS, Kim JT, Park JY, Lee CW.A 7-year-old Thoroughbred horse was admitted to the Equine Hospital, Korea Racing Association with signs of colic. Based on the size of impactions, the clinical signs, the results of abdominal paracentesis and medical treatment, the prognosis was poor. The horse died 3 hours later following hopeless discharge. At necropsy, the caecum and large colon were fully filled with fecal contents and there was a rupture (10 cm in dia) in the latero- ventral caecum. The mucosa of the ileo-caecal and caeco- colic valves appeared to the hyperemic, edematous and ulcerous. There were many tapeworms in the af...
Morice P, Allano M, Provost C, Fairbrother JH, Gagnon CA, Sauvé F.Genomic characterization was conducted on 2 methicillin-resistant Staphylococcus aureus (MRSA) strains isolated from 2 horses hospitalized during an overlapping period of time and 2 methicillin-sensitive S. aureus (MSSA) strains isolated from 2 distinct horses. Phylogenetic proximity was traced and the genotypic and phenotypic characteristics of the antimicrobial resistance of the strains were compared. Whole genome sequencing of MRSA strains for this report was similar but differed from whole genome sequencing of MSSA strains. The MRSA strains were closely related, belonging to sequence type ...
Tanaka K, Asai Y, Kuwano A.At 114 ranches in the Hidaka District of Hokkaido, a total of 1,118 Thoroughbred foals that were born from January to June 2003 were examined at different times from May to September of the same year to ascertain the occurrence of clubfoot. Clubfoot was seen in a total of 179 foals (16%) at 89 ranches (78%). Also, 124 of the 179 foals (69.3%) had clubfoot of grade II or higher, and it was found that grade I was likely to be overlooked or rapidly advance. In the present study, the occurrence of clubfoot was higher than expected in the investigated region. Hence, it is necessary to establish acc...
Machida N, Yasuda J, Too K, Kudo N.The obliteration processes of the ductus arteriosus of equine foetuses and newborn foals were studied morphometrically and histologically. The length, internal and external diameters and circumference of the ductus in equine foetuses increased progressively and linearly up to 310 days with advancing foetal age, but the values, especially the internal diameter, decreased from 320 to 330 days. After birth, the ductal measurements decreased gradually and ductal closure was found in three of 14 foals examined on the first day post partum, in two of six on the second day and in nine of nine on the ...
Duckett WM, Matthews HK.Paraneoplastic eosinophilia is reported in dogs, cats, and humans. Hypereosinophilia (an eosinophil count greater than 1.5 x 10(9) L) is often associated with metastasis and a poor prognosis. This report describes a case of paraneoplastic hypereosinophilia in a pony. Neoplasia should be included in the differential diagnoses in a horse with eosinophilia.
Reef VB.Cardiac disease in the equine neonate occurs infrequently. Murmurs are often heard in foals and are not considered significant unless they persist beyond 4 days of age. Congenital cardiac defects are the most common form of primary cardiac disease in the foal, with ventricular septal defects occurring most frequently. Other neonatal foal diseases such as ruptured bladders, white muscle disease, neonatal respiratory distress syndrome, and septicemia have secondary cardiac involvement.
Socha W, Rola J, Żmudziński JF.The genetic stability of ORF1a encoding non-structural proteins nsp1, nsp2, nsp3 and nsp4 of equine arteritis virus (EAV) has been analysed for nearly seven years in a persistently infected stallion of the Malopolska breed. Between November 2004 and June 2011, 11 semen samples were collected. Viral RNA extracted from semen of this carrier stallion was amplified, sequenced and compared with the sequences of the other known strains of EAV. Sequence analysis of ORF1a showed 84 synonymous and 16 non-synonymous mutations. The most variable part of ORF1a was the region encoding nsp2 protein with 13 ...
Ramzan PH, Palmer L.Fissures of the occlusal surface of the equine cheek tooth are poorly understood and their association with dental disease is unknown. Objective: To describe the prevalence and location of occlusal fissures in the cheek teeth (CT) of a group of horses referred for dental investigation/treatment, and determine association with intercurrent dental disease. Methods: Digital video recordings of oral endoscopic examinations for all horses referred to the Rossdales Equine Hospital for dental investigation from November 2006 to June 2009 were reviewed. Location of occlusal fissures in relation to bot...
Lester GD, Bolton JR, Cambridge H, Thurgate S.The myoelectrical activity of the ileum, caecum and large colon was monitored from Ag-AgCl bipolar recording electrodes in four conscious 'parasite-naive' weanling foals. All foals were inoculated with 1000 infective 3rd-stage Strongylus vulgaris larvae and alterations to the myoelectrical activity observed. The frequencies of caecal and colonic spike bursts increased significantly in all post infection periods coinciding with assumed larval penetration into the intestinal mucosa and migration through the vasculature. Peaks in caecal and colonic activity occurred at Days 1 to 5 post infection....
Argo CM.Leisure animals now comprise the majority of working horses in industrialized nations; a shift that has decreased workloads yet improved veterinary care and lifetime health. Although many horses now progress well into their 20s without any requirement for dietary modification, age-related changes are insidious, and older animals benefit from regular veterinary monitoring to identify, address, and ameliorate the inevitable onset of age-related "disease." Basal metabolic rate decreases with age; older animals expend less energy on controlled exercise, and there can be an increased propensity tow...
Stadler P, van den Berg SS, Tustin RC.A Hansen type I cervical intervertebral disc prolapse was diagnosed in a 16-year-old American Saddler showing clinical signs of paresis and ataxia. An ante-mortem diagnosis was made by means of plain radiographs and a myelogram. The horse was euthanased and the diagnosis confirmed on a post-mortem examination.
Allombert J, Vianney A, Laugier C, Petry S, Hébert L.Taylorella equigenitalis is the causative agent of contagious equine metritis, a sexually-transmitted infection of Equidae characterised in infected mares by abundant mucopurulent vaginal discharge and a variable degree of vaginitis, cervicitis or endometritis, usually resulting in temporary infertility. The second species of the Taylorella genus, Taylorella asinigenitalis, is considered non-pathogenic, although mares experimentally infected with this bacterium can develop clinical signs of endometritis. To date, little is understood about the basic molecular virulence and persistence mechanis...
Williamson LH, Farrell RL.A case of intracranial schwannoma is described in a young horse. Clinical signs developed slowly and were suggestive of a lesion involving the left cerebrum. The filly exhibited a change in mentation, and circled to the left. Visual impairment and decreased facial sensation were noted on the right side. A solitary schwannoma which compressed the left cerebrum was found at necropsy.
Güleğen E, Cirak VY.Lice infestations of horses occur mainly during winter months and are characterized by severe pruritus and an unkempt coat. Two lice have been described for equines namely Bovicola (Damalinia) equi and Haemotopinus asini. There is a scarcity of data on the occurrence and prevalence rates of these horse pathogens in Turkey. This paper reports a thoroughbred farm, in which two horses were found to be infested with B. equi. The horses were treated with propoxur and no lice or nymphs could be found after treatment for10 days.
Rivas VN, Aleman M, Peterson JA, Dahlgren AR, Hales EN, Finno CJ.Juvenile idiopathic epilepsy (JIE) is an inherited disease characterized by recurrent seizures during the first year of life in Egyptian Arabian horses. Definitive diagnosis requires an electroencephalogram (EEG) performed by a veterinary specialist. A recent study has suggested that a 19 base-pair deletion, along with a triple-C insertion, in intron five of twelve (∆19InsCCC; chr20:29542397-29542425: GTTCAGGGGACCACATGGCTCTCTATAGA>TATCTTAAGACCC) of the () gene is associated with JIE. To confirm this association, a new sample set consisting of nine EEG-phenotyped affected and nine unaffec...