Veterinary care in horses encompasses the medical and preventive measures taken to maintain and improve the health and well-being of equine patients. It includes a wide range of practices such as routine health examinations, vaccinations, dental care, parasite control, and management of injuries and diseases. Veterinary care also involves diagnostic procedures, surgical interventions, and therapeutic treatments tailored to the specific needs of horses. This page gathers peer-reviewed research studies and scholarly articles that explore various aspects of equine veterinary care, including advancements in diagnostic techniques, treatment protocols, and health management strategies to support the well-being and performance of horses.
Aoki Y, Hakamata H, Igarashi Y, Uchida K, Kobayashi H, Hirayama N, Kotani A, Kusu F.A simple method for determination of mosapride citrate and its metabolite, des-p-fluorobenzyl mosapride (M-1), in equine muscle, liver, kidney, adipose tissue and intestine by liquid chromatography-tandem mass spectrometry has been developed. (+/-)-4-Amino-5-chloro-2-ethoxy-N-[[4-(2-chlorobenzyl)morpholinyl]methyl]benzamide was used as an internal standard. The analytes and internal standard were spiked and extracted from tissues by acetonitrile. The chromatographic separation was performed on a reversed-phase TSK-GEL SUPER ODS column with a mobile phase of acetonitrile-0.05% (v/v) formic acid...
Russell T, Wainscott M.Twenty-seven horses were treated for epiglottic entrapment by using an oral, hand-assisted bistoury knife technique, under general anaesthesia; 26 of them returned successfully to racing, but one developed a permanently displaced soft palate. After the surgery 13 of the horses had an increased handicap rating and 13 had a decreased rating.
Sampson SN, Schneider RK, Tucker RL, Gavin PR, Zubrod CJ, Ho CP.Injury to the oblique and straight distal sesamoidean ligaments is becoming recognized as a more common cause of lameness in horses than was previously thought. The purpose of this study was to review the magnetic resonance (MR) imaging findings of 27 horses affected with desmitis of the oblique and/or straight distal sesamoidean ligament and determine long-term prognosis for horses with this diagnosis. Imaging was performed with horses in right lateral recumbency in a high-field 1 T magnet. All horses had lameness localized to the digit or metacarpophalangeal/metatarsophalangeal joint region ...
Vlaminck LE, Steenhault M, Maes D, Huys L, Gasthuys F.This study investigated the placement of an intra-alveolar prosthesis of bone substitute on gingival/periodontal health in 5 ponies following repulsion of cheek teeth 108 and 208. In each pony, one randomly chosen alveolus was allowed to heal by second intention while the other was filled with a non-resorbable, biocompatible bone substitute. At 6, 12 and 24-months after surgery, both maxillary arches were evaluated for wear abnormalities and for gingival health using a periodontal scoring system. Recorded changes included development of overgrowths on mandibular cheek teeth, widening of maxill...
Koneberg DG, Edinger J.The purpose of this in vitro study was to evaluate the value of three-dimensional (3D) ultrasonography for the diagnosis of equine meniscal and trochlear ridge lesions under in vitro conditions. Lesions were created in the isolated meniscus and femoral trochlea of 25 cadaver stifle joints. Cylindric, conic, and cuboid lesions were created on the trochlear ridge. Five different meniscal tear configurations were created. A total of 107 lesions of the trochlear ridge and 103 lesions of the meniscus were created. 3D ultrasonography was performed in a waterbath, using a 7.5 MHz 3D scanner. Trochlea...
Golomidova A, Kulikov E, Isaeva A, Manykin A, Letarov A.The diversity of coliphages and indigenous coliform strains (ICSs) simultaneously present in horse feces was investigated by culture-based and molecular methods. The richness of coliforms (as estimated by the Chao1 method) is about 1,000 individual ICSs distinguishable by genomic fingerprinting present in a single sample of feces. This unexpectedly high value indicates that some factor limits the competition of coliform bacteria in the horse gut microbial system. In contrast, the diversity of phages active against any selected ICS is generally limited to one to three viral genotypes present in...
Ribeiro BI, Love LB, Choi YH, Hinrichs K.Use of assisted reproduction to obtain foals from valuable mares post-mortem typically necessitates holding of ovaries during shipment to a laboratory. The present study evaluated whether holding ovaries briefly at a warm ( approximately 30 degrees C) temperature improves meiotic and developmental competence of oocytes, as determined after maturation in vitro and intracytoplasmic sperm injection. Ovaries were packaged in pairs in insulated containers, and held either at 24 or 25-35 degrees C for 4h, followed by cooling. Ovaries in both treatments were held for either a short (mean, 7-7.4h) or ...
Dietz JP, Sertich PL, Boston RC, Benson CE.Ticarcillin and piperacillin were compared to determine their effect on sperm motility and bacterial growth of equine semen samples diluted in Kenney's glucose skim milk semen extender. Each ejaculate (n=11) was divided into three portions and glucose skim milk semen extender solution was added. The control semen extender solution contained extended semen and no antibiotic, whereas ticarcillin and piperacillin solutions contained extended semen plus 1.0mg/mL of ticarcillin or piperacillin, respectively. An aliquot was removed (1h after collection) to evaluate sperm motility and microbial conce...
Boscan P, Steffey EP.To assess the changes in colloid osmotic pressure (COP) in horses undergoing surgery for colic. Methods: Prospective clinical evaluation. Methods: Twenty-nine adult horses presented for emergency laparotomy. Methods: Horses were premedicated with intravenous (IV) xylazine and anesthesia was induced with ketamine, diazepam and guaifenesin and was maintained with isoflurane as required. Lactated Ringer's solution (LRS) was given to all horses during anesthesia. Blood was collected in heparin before, and every 30 minutes during, anesthesia to measure COP, total protein concentration (TP), osmolal...
Charman RE, Vasey JR.Chronic facial defects extending into the sinuses of two mares were repaired using periosteal flaps. Partial osseous bridging was established over the defects following repair. Previous attempts to close the defects with skin alone had failed. A periosteal flap is a simple surgical technique that provides the foundations for successful repair, despite the chronicity of some fistulae.
Johns IC, Del Piero F, Wilkins PA.An 11-year-old Thoroughbred broodmare was evaluated for suspected hepatic dysfunction. Clinical signs of hepatic encephalopathy were evident at admission. Hepatic ultrasonographic evaluation revealed an increase in hepatic size, rounded borders and normal echogenicity. There was no evidence of cholelithiasis or bile duct distention. Increased activity of hepatic enzymes, increased bile acid and bilirubin concentration and an increased ammonia concentration were supportive of a diagnosis of hepatic disease and hepatic encephalopathy. Histopathological evaluation of a liver biopsy specimen was c...
Rossignol F, Perrin R, Boening KJ.To evaluate the efficacy of a laparoscopic peritoneal flap hernioplasty (PFH) to close anatomically the vaginal ring and to evaluate its protective effect in horses with a history of strangulated inguinal hernia (SIH) against future herniation. Methods: Prospective study. Methods: A first group of 5 ponies, 3 horses and 1 donkey with no history of SIH and a second group of 4 horses 'clinical cases' with a history of SIH. Methods: A laparoscopic PFH was effected on all horses under general anaesthesia. Peritoneum ventro-lateral to the vaginal ring was elevated and cut on 3 sides, separated from...
Pearson RA, Krecek RC.Problems have been identified in the delivery of extension messages about the maintenance of healthy and well-fed working animals. The different factors that need to be considered in developing effective disease control and prevention programmes for working oxen and equids including vector-borne diseases, helminth disease, and vaccination programmes have been reported and discussed and experiences in improving husbandry including footcare, harness, and worm management reported. Most draught animals are owned by people who lack the financial means to pay for or to access the information needed ...
Labeda DP, Donahue JM, Sells SF, Kroppenstedt RM.A novel actinomycete, designated strain LDDC 2876-05(T), was isolated from an equine placenta during the course of routine diagnostic tests for nocardioform placentitis. In a preliminary study, the strain was observed to be phylogenetically distinct from the genera Crossiella and Amycolatopsis and probably a member of the genus Lentzea. A polyphasic study of strain LDDC 2876-05(T) confirmed its identification as a member of Lentzea on the basis of its chemotaxonomic and morphological similarity to all of the known species of the genus. Moreover, the strain could be distinguished from other spe...
Richardson LE, Dudhia J, Clegg PD, Smith R.Stem cells have evoked considerable excitement in the animal-owning public because of the promise that stem cell technology could deliver tissue regeneration for injuries for which natural repair mechanisms do not deliver functional recovery and for which current therapeutic strategies have minimal effectiveness. This review focuses on the current use of stem cells within veterinary medicine, whose practitioners have used mesenchymal stem cells (MSCs), recovered from either bone marrow or adipose tissue, in clinical cases primarily to treat strain-induced tendon injury in the horse. The backgr...
Masri M, Lombardero G, Velasquillo C, Martínez V, Neri R, Villegas H, Ibarra C.The goal of this study is to evaluate the efficiency of obtaining a large number of viable cells within a construct that will not be detached by high fluid flow during arthroscopic implantation. Methods: Arthroscopic osteochondral biopsy specimens were obtained from the medial femoral trochlea of 8 horses. Chondrocytes were isolated by collagenase digestion and expanded in M199 media until confluency. After 10 to 12 days, cultures were trypsinized and cells resuspended in culture media. Then, 5 x 10(6) cells x mL(-1) were seeded on a culture dish and the same amount in a flask. Once extracellu...
Iwatani S, Zendo T, Yoneyama F, Nakayama J, Sonomoto K.A novel bacteriocin, lacticin Z, produced by Lactococcus lactis QU 14 isolated from a horse's intestinal tract was identified. Lacticin Z was purified through a three step procedure comprised of hydrophobic-interaction, cation-exchange chromatography, and reverse-phase HPLC. ESI-TOF MS determined the molecular mass of lacticin Z to be 5,968.9 Da. The primary structure of lacticin Z was found to consist of 53 amino acid residues without any leader sequence or signal peptide. Lacticin Z showed homology to lacticin Q from L. lactis QU 5, aureocin A53 from Staphylococcus aureus A53, and mutacin BH...
Egenvall A, Bonnett B, Wattle O, Emanuelson U.Our objective was to determine the amount, type and cost of veterinary care during a 5-year follow-up period, in Swedish warmblooded riding horses with and without locomotor problems as recorded in 1997. The study population comprised horses with complete insurance both for veterinary care and life during 1997. The horses were followed from the beginning of January 1998 to the end of December 2002. The exposed cohort was composed of 1558 horses that had experienced >or=1 veterinary-care event because of locomotor problems in 1997 (LP-cohort). The exposure-negative (LN) cohort was composed of 1...
Lowden S, Gray S, Dawson K.The horse biting louse (Werneckiella equi) is a common global equine ectoparasite. To our knowledge, benzoyl(phenyl)urea insecticides (triflumuron, diflubenzuron) commonly used as sheep lousicides, have not been evaluated for efficacy against W. equi. The aim of this study was to determine louse control efficacy, general wellness and dermal safety following triflumuron application as a backline pour-on to horses. Two efficacy trials using 25 adult naturally infested lousy horses, and a dermal safety trial using 10 adult louse-free horses were conducted over a 14-month period. Lousy animals wer...
Pauwels FF, Hawkins JF, MacHarg MA, Rothenbuhler RD, Baird DK, Moulton JS.3 Horses were examined and treated because of sudden onset of signs of abdominal pain. Results: All horses had a retrosternal (Morgagni) hernia involving the right side of the diaphragm. In each horse, the large colon was incarcerated in a right muscular defect in the diaphragm with a large hernial sac. Results: Definitive surgical repair of the hernia was not performed during the initial celiotomy. The hernia was repaired with mesh herniorrhaphy, but without resection of the hernia sac in 2 horses. For 1 horse, conservative management was applied. In the 2 horses treated with surgical correct...
Westermann CM, Dorland L, Wijnberg ID, van der Kolk JH.This review gives an overview of the presently known human and equine metabolic myopathies with emphasis on the diagnostic approach. Metabolic myopathies are muscle disorders caused by a biochemical defect of the skeletal muscle energy system, which results in inefficient muscle performance. Myopathies can arise in different levels of the metabolic system. In this review the metabolic myopathies are categorized in disorders of the carbohydrate metabolism, lipid metabolism, mitochondrial myopathies (other than those described in lipid metabolism), disorders of purine metabolism, primary disorde...
Argo CM.Leisure animals now comprise the majority of working horses in industrialized nations; a shift that has decreased workloads yet improved veterinary care and lifetime health. Although many horses now progress well into their 20s without any requirement for dietary modification, age-related changes are insidious, and older animals benefit from regular veterinary monitoring to identify, address, and ameliorate the inevitable onset of age-related "disease." Basal metabolic rate decreases with age; older animals expend less energy on controlled exercise, and there can be an increased propensity tow...
Stadler P, van den Berg SS, Tustin RC.A Hansen type I cervical intervertebral disc prolapse was diagnosed in a 16-year-old American Saddler showing clinical signs of paresis and ataxia. An ante-mortem diagnosis was made by means of plain radiographs and a myelogram. The horse was euthanased and the diagnosis confirmed on a post-mortem examination.
Soma LR, Beech J, Gerber NH.The effect of disodium cromoglycate (cromolyn) in preventing the pulmonary dysfunction caused by the inhalation of barn and hay dust was studied in 5 horses with confirmed chronic obstructive pulmonary disease (COPD). The horses were studied before (Con) and after exposure to hay and dust allergens (Expos) and after pretreatment with cromolyn followed by exposure (Cr-Expos). There was a significant reduction in PaO2 from 86.8 +/- 8.3 to 73.1 +/- 8.8 when the horses were exposed to hay and dust allergens. The PaO2 after pretreatment with cromolyn and exposures was 78.1 +/- 5.5. There were no si...
Wenker C, Hoby S, Steck BL, Ramsauer AS, Blatter S, Tobler K.Equine sarcoids (ES) were diagnosed in 12 Somali wild asses (SWA) () from 10 different institutions of the SWA European Endangered Species Programme from 1976 to 2019. Samples of surgically excised masses, biopsies, or necropsy samples were submitted for histologic and virologic analysis. In addition, tissue samples from one onager (), one kulan (), and two Hartmann's mountain zebras (HMZ) () were examined. Histology confirmed the diagnosis of ES exhibiting the typical microscopic features. Polymerase chain reaction detected bovine papillomavirus type 1 (BPV1) DNA in eight SWA samples and bovi...
Caporale VP, Biancifiori F, Frescura F, Di Matteo A, Nannini D, Urbani G.Comparative tests such as FAT, ELISA, RIA, IEO and CF in the diagnosis of dourine in the horse have proved a satisfactory concordance ratio of the ELISA with CF, which seems to be the most reliable test. Discrepancies have been observed as to the other tests which appear less sensitive than CF test.
Williamson LH, Farrell RL.A case of intracranial schwannoma is described in a young horse. Clinical signs developed slowly and were suggestive of a lesion involving the left cerebrum. The filly exhibited a change in mentation, and circled to the left. Visual impairment and decreased facial sensation were noted on the right side. A solitary schwannoma which compressed the left cerebrum was found at necropsy.
Rivas VN, Aleman M, Peterson JA, Dahlgren AR, Hales EN, Finno CJ.Juvenile idiopathic epilepsy (JIE) is an inherited disease characterized by recurrent seizures during the first year of life in Egyptian Arabian horses. Definitive diagnosis requires an electroencephalogram (EEG) performed by a veterinary specialist. A recent study has suggested that a 19 base-pair deletion, along with a triple-C insertion, in intron five of twelve (∆19InsCCC; chr20:29542397-29542425: GTTCAGGGGACCACATGGCTCTCTATAGA>TATCTTAAGACCC) of the () gene is associated with JIE. To confirm this association, a new sample set consisting of nine EEG-phenotyped affected and nine unaffec...
Sutton DG, Bahr A, Preston T, Cohen ND, Love S, Roussel AJ.The 13C-octanoic acid breath test has been correlated significantly to radioscintigraphy for measurement of gastric emptying indices in healthy horses. The objective of this study was to investigate the validity of the test for measurement of equine delayed gastric emptying, prior to its potential clinical application for this purpose. A model of atropine-induced gastroparesis was used. Gastric emptying rate was measured twice in 8 horses using concurrent radioscintigraphy and/or breath test after treatment i.v. with either atropine (0.035 mg/kg bwt) or saline in randomised order. Analysis of ...
Turner AS, Yovich JV, White NA, Embertson RE, Santschi EM, Slone DE.A retrospective study was performed to evaluate the healing of ventral midline abdominal incisions, closed with a simple continuous suture pattern using absorbable suture material, in 139 horses and foals. Dehiscence and incisional hernia developed separately in two horses. The low incidence of dehiscence and incisional hernia, compared with their reported incidence following the use of interrupted suture repair, leads the authors to recommend this alternative method of abdominal incision closure in horses. The security of closure is not sacrificed and the advantages of a rapid closure are des...
Beard WL, Robertson JT, Leeth B.Congenital frontal sinus cysts were found bilaterally in the frontal sinuses of a one-year-old miniature horse. Diagnosis was based on radiography of the head and cytologic examination of tissue aspirated from the frontal sinuses. The cysts were surgically removed, using a hinged bone flap technique bilaterally over the frontal sinuses.
Patil DB, Adamiak Z, Piórek A.The present review informs about the current status regarding use of interlocking nailing for fracture repair in animals. The clinical limitations of interlocking nailing and its subsequent improvement by evolving novel nail design or supplementation with type I ESF using hybrid nail bolt/ESF pin has been dealt. The biomechanical and clinical evaluation of novel interlocking nail supplements and its possible clinical use is included.
Hinton M.The literature published over the last 150 years provides confusing and often conflicting advice on the ideal way to water horses. Many of the problems associated with watering appear to be caused by either mismanagement or ignorance. An obvious way to prevent trouble is to provide adequate water at all times when a horse is at rest and to allow sufficient opportunity to drink while working.
Riley CB, McCallum S, MacDonald JA, Hill KE.To determine the period prevalence of needlestick injury (NSI) at the Massey University Veterinary Teaching Hospital (VTH) and to identify handling and disposal practices that may contribute to the risk of NSI. Methods: Observations of personnel were conducted in the equine (EVH) and companion animal (CAH) clinics of the VTH during scheduled clinical activities over 9- and 10-day periods, respectively. The number and type of NSI incidents, needle uncapping, capping and disposal events were recorded for veterinarians, nurses and other personnel (visitors and students). The number of needle-rela...
Fjordbakk CT, Kenney DG, Rodriguez-Palacios A, Keller S, Stalker M.An inflammatory aural polyp was identified in a 1-year-old standardbred filly, which presented with otorrhea and head rubbing. The polyp was removed by traction-avulsion, and the filly showed no subsequent signs of otorrhea. Aural polyps have not been reported in horses, but they are commonly seen in companion animals and humans. Un polype auditif inflammatoire a été identifié chez une pouliche Standardbred d’un an présentée pour otorrhée et frottage de tête. Le polype a été retiré par traction-avulsion et la pouliche n’a pas manifesté de signes subséquents d’otorrhée. Les ...
Düsterdieck-Zellmer KF.Systemic administration of tiludronate or clodronate decreases lameness in some horses suffering from navicular syndrome within 2-6 months of treatment. In horses that fail to respond to the first treatment, a follow-up treatment may still improve the lameness. Horses with a lameness duration of less than 6 months have better odds of experiencing improvement in lameness. Bisphosphonate (BP) treatment can result in renal damage, and it is recommended to assess renal function prior to and after treatment. Horses with pre-existing renal compromise should not be treated with BP, as this may promot...