Topic:Alleles
Alleles in horses refer to the different versions of a gene that exist within the equine genome, contributing to the diversity of traits observed in horse populations. These genetic variations can influence a wide range of characteristics, including coat color, height, temperament, and susceptibility to certain diseases. Understanding alleles is crucial for breeding programs, as they help predict the inheritance of desirable traits and manage genetic disorders. Common examples include the alleles responsible for coat color variations, such as the Extension (E) and Agouti (A) loci. This page compiles peer-reviewed research studies and scholarly articles that explore the identification, function, and impact of alleles on equine genetics, offering insights into their role in shaping the phenotypic and health-related traits of horses.
Identification of the novel polymorphisms and potential genetic features of the prion protein gene (PRNP) in horses, a prion disease-resistant animal. Prion diseases, a protein misfolded disorder (PMD) caused by misfolded prion protein (PrP), present in a wide variety of hosts, ranging from ungulates to humans. To date, prion infections have not been reported in horses, which are well-known as prion disease-resistant animals. Several studies have attempted to identify distinctive features in the prion protein of horses compared to prion disease-susceptible animals, without the study on polymorphisms of the horse prion protein gene (PRNP). Since single nucleotide polymorphisms (SNPs) of PRNP in prion disease-susceptible animals are major susc...
An Independent Locus Upstream of ASIP Controls Variation in the Shade of the Bay Coat Colour in Horses. Novel coat colour phenotypes often emerge during domestication, and there is strong evidence of genetic selection for the two main genes that control base coat colour in horses- and . These genes direct the type of pigment produced, red pheomelanin () or black eumelanin (), as well as the relative concentration and the temporal-spatial distribution of melanin pigment deposits in the skin and hair coat. Here, we describe a genome-wide association study (GWAS) to identify novel genic regions involved in the determination of the shade of bay. In total, 126 horses from five different breeds were r...
Ancient Patrilineal Lines and Relatively High ECAY Diversity Preserved in Indigenous Horses Revealed With Novel Y-Chromosome Markers. Extremely low nucleotide diversity of modern horse Y-chromosome has been reported, and only poor phylogenetic resolution could be resulted from limited Y-chromosome markers. In this study, three types of horse Y-chromosome markers, including Single-nucleotide polymorphisms (SNPs), copy number variants (CNVs), and allele-specific CNVs, were developed by screening more than 300 male horses from 23 indigenous Chinese horse populations and 4 imported horse breeds. Fourteen segregating sites including a novel SNP in the AMELY gene were found in approximately 53 kb of male-specific Y-chromosome sequ...
Hanoverian F/W-line contributes to segregation of Warmblood fragile foal syndrome type 1 variant PLOD1:c.2032G>A in Warmblood horses. Warmblood fragile foal syndrome (WFFS) is a lethal condition detected in Warmblood horses. Its origin and association with performance traits and fertility among horse populations is unknown. Objective: To validate the previously identified WFFS type 1 (WFFST1)-associated missense variant PLOD1:c.2032G>A and to investigate its distribution among various horses with particular focus on Hanoverian breed, as well as its pathomorphological picture. The study aimed at identifying the origin of the mutant allele and its correlation with performance and fertility traits in Warmblood horses. Methods: ...
Assessment of the FAM174A 11G allele as a risk allele for equine metabolic syndrome. An 11G nucleotide repeat in the 3' UTR of FAM174A was recently postulated as a risk allele with a dominant mode of inheritance for equine metabolic syndrome (EMS) and laminitis status in Arabian horses. The objective of this project was to evaluate this hypothesis in a large and diverse across-breed population. A total of 301 ponies, 292 Morgans, 64 Arabians, 49 Tennessee Walking Horses and 59 Quarter Horses were genotyped for six observed G repeat alleles in the FAM174A 3' UTR. Phenotype data included laminitis status, baseline insulin, glucose, non-esterified fatty acids, triglycerides, adip...
Absence of Strong Genetic Linkage Disequilibrium between Single Nucleotide Polymorphisms (SNPs) in the Prion Protein Gene (PRNP) and the Prion-Like Protein Gene (PRND) in the Horse, a Prion-Resistant Species. Prion disease is a fatal neurodegenerative disorder caused by a deleterious prion protein (PrP). However, prion disease has not been reported in horses during outbreaks of transmissible spongiform encephalopathies (TSEs) in various animals in the UK. In previous studies, single nucleotide polymorphisms (SNPs) in the prion protein gene () have been significantly associated with susceptibility to prion disease, and strong linkage disequilibrium (LD) between and prion-like protein gene () SNPs has been identified in prion disease-susceptible species. On the other hand, weak LD values have been r...
A De Novo MITF Deletion Explains a Novel Splashed White Phenotype in an American Paint Horse. Splashed white is a coat color pattern in horses characterized by extensive white patterning on the legs, belly, and face often accompanied by blue eyes and deafness. Three mutations in microphthalmia-associated transcription factor (MITF) and two mutations in Paired Box 3 (PAX3) have been identified that explain splashed white patterns (SW1-SW5). An American Paint Horse stallion with a splashed white phenotype and blue eyes, whose parents were not white patterned, was negative for the 5 known splashed white variants and other known white spotting alleles. This novel splashed white phenotype (...
Identification of genes required for the fitness of Streptococcus equi subsp. equi in whole equine blood and hydrogen peroxide. The availability of next-generation sequencing techniques provides an unprecedented opportunity for the assignment of gene function. subspecies is the causative agent of strangles in horses, one of the most prevalent and important diseases of equids worldwide. However, the live attenuated vaccines that are utilized to control this disease cause adverse reactions in some animals. Here, we employ transposon-directed insertion-site sequencing (TraDIS) to identify genes that are required for the fitness of in whole equine blood or in the presence of HO to model selective pressures exerted by th...
Decreased genetic diversity in Kiso horses revealed through annual microsatellite genotyping. The Kiso horse is native to Japan and is on the verge of extinction. Here, we used microsatellites to characterize changes in their genetic diversity over time. We divided a population of Kiso horses that genotyped during 2007-2017 into three groups based on birth year: Group 1, 1980-1998 (70 horses); Group 2, 1999-2007 (61 horses); and Group 3, 2008-2017 (42 horses). We genotyped 31 microsatellites to calculate average number of alleles, observed heterozygosity, and expected heterozygosity. All indicators decreased across age groups. The results indicate that Kiso horses have been experiencin...
SNPs analysis of height traits in Ningqiang pony. Ningqiang pony is one of the five pony breeds in China and is listed as a rare species. It is, therefore, meaningful to conduct stature research on this breed for its efficient reproduction, utilization and protection. This study is based on four SNP variants of adjacent LCORL/NCAPG, HMGA2, ZFAT and LASP1 genes, which have been found to be associated with horse height, and then, the 4 SNP loci in 22 Ningqiang ponies were analyzed. The results showed that there were genetic variations at the four loci in Ningqiang pony, there was a SNP on LCORL/NCAPG, HMGA2 and ZFAT gene all including T allele ...
Spread of equine arteritis virus among Hucul horses with different EqCXCL16 genotypes and analysis of viral quasispecies from semen of selected stallions. Equine arteritis virus (EAV) is maintained in the horse populations through persistently infected stallions. The aims of the study were to monitor the spread of EAV among Polish Hucul horses, to analyse the variability of circulating EAVs both between- and within-horses, and to identify allelic variants of the serving stallions EqCXCL16 gene that had been previously shown to strongly correlate with long-term EAV persistence in stallions. Serum samples (n = 221) from 62 horses including 46 mares and 16 stallions were collected on routine basis between December 2010 and May 2013 and tested f...
Heterozygotes for ACAN dwarfism alleles in horses have reduced stature. Homozygous and compound heterozygous Miniature horses for ACAN alleles D1, D2, D3* and D4 exhibit chondrodysplastic dwarfism (OMIA 001271-9796). In a previous study, the carrier rate for these four alleles, combined, was 26.2%. The purpose of this study was to investigate whether carriers of these dwarfism-causing alleles had a shorter withers height than non-carriers. A total of 245 Miniature horses were tested for these four ACAN alleles and also were measured for withers height. Of these horses, 98 were carriers and 147 were non-carriers. A statistically significant difference of 1.43 inche...
A Genome-Wide Association Analysis in Noriker Horses Identifies a SNP Associated With Roan Coat Color. The roan coat color in horses is characterized by dispersed white hair and dark points. This phenotype segregates in a broad range of horse breeds, while the underlying genetic background is still unknown. Previous studies mapped the roan locus to the KIT gene on equine chromosome 3 (ECA3). However, this association could not be validated across different horse breeds. Performing a genome-wide association analysis (GWAS) in Noriker horses, we identified a single nucleotide polymorphism (SNP) (ECA3:g.79,543.439 A > G) in the intron 17 of the KIT gene. The G -allele of the top associated SNP...
Inter- and intrabreed diversity of the major histocompatibility complex (MHC) in primitive and draft horse breeds. Polymorphism of major histocompatibility complex (MHC) genes ensures effective immune responses against a wide array of pathogens. However, artificial selection, as performed in the case of domestic animals, may influence MHC diversity. Here, we investigate and compare the MHC diversity of three populations of horses, for which different breeding policies were applied, to evaluate the impact of artificial selection and the environment on MHC polymorphism. Samples of DNA were taken from 100 Polish draft horses, 38 stabled Konik Polski horses and 32 semiferal Konik Polski horses. MHC alleles and...
A novel simple genotyping assay for detection of the ‘Gait keeper’ mutation in DMRT3 and allele frequencies in Azteca and Costa Rican Saddle Horse breeds. The 'Gait keeper' mutation in the DMRT3 gene alters locomotion and gait patterns in horses. This mutation (C>A) has been found in all gaited breeds of horses analyzed but is absent in most non-gaited breeds. We developed a new mutagenically separated polymerase chain reaction (MS-PCR) based method for simple detection of horse DMRT3 genotype. Our method was applied in a preliminary study to determine DMRT3 allele frequencies in 78 Azteca horses (AZ) and 53 Costa Rican Saddle Horses (CRSH). We found a wild-type C allele frequency of 100% in the AZ horses. For the CRSH, the wild-type C freque...
Description of the D4/D4 genotype in Miniature horses with dwarfism. Four causative mutations (D1, D2, D3*, and D4) of chondrodysplastic dwarfism have been described in the equine () gene. Homozygotes for one of these mutations and heterozygotes for any combination of these mutations exhibit the disproportionate dwarfism phenotype. However, no case description of homozygotes for D4 (D4/D4) has been reported in the literature, to our knowledge. We report 2 Miniature horses with the genotype D4/D4 in the gene. Clinically, the 2 dwarfs had a domed head that was large compared to the rest of the body, mandibular prognathism, and short and bowed limbs, mainly in t...
The First Report of Genetic and Structural Diversities in the SPRN Gene in the Horse, an Animal Resistant to Prion Disease. Prion diseases are fatal neurodegenerative diseases and are characterized by the accumulation of abnormal prion protein (PrP) in the brain. During the outbreak of the bovine spongiform encephalopathy (BSE) epidemic in the United Kingdom, prion diseases in several species were reported; however, horse prion disease has not been reported thus far. In previous studies, the shadow of prion protein (Sho) has contributed to an acceleration of conversion from normal prion protein (PrP) to PrP, and the shadow of prion protein gene () polymorphisms have been significantly associated with the susceptibi...
Genetic investigation of equine recurrent uveitis in Appaloosa horses. Equine recurrent uveitis (ERU) is characterized by intraocular inflammation that often leads to blindness in horses. Appaloosas are more likely than any other breed to develop insidious ERU, distinguished by low-grade chronic intraocular inflammation, suggesting a genetic predisposition. Appaloosas are known for their white coat spotting patterns caused by the leopard complex spotting allele (LP) and the modifier PATN1. A marker linked to LP on ECA1 and markers near MHC on ECA20 were previously associated with increased ERU risk. This study aims to further investigate these loci and identify a...
Changes of sires in a breeding farm enables maintenance of DNA-level genetic variation in a produced herd of Hokkaido Native Horses. We investigated whether regular changes of the sire in a breeding farm of Hokkaido Native Horses (HKDs) enables the DNA-level genetic variation of the produced animals to be maintained. The genotypes of 31 microsatellite markers were identified and analyzed in 207 animals produced in a breeding farm in which the sire was replaced every 3 to 5 years. The mean allele number indicating the degree of genetic variation was 5.97 and was similar to those reported previously. The mean observed heterozygosity was 0.74 and was higher than the expected heterozygosity, 0.69; F was -0.07, indicating that ...
Prevalence of the Mutations Responsible for Glanzmann Thrombasthenia in Horses in Brazil. Glanzmann's thrombasthenia (GT) is an autosomal recessive inherited disorder characterized by changes in platelet aggregation, leading to hemorrhage and epistaxis. To date, two independent mutations have been described in horses and associated with this disorder, a point mutation (c.122G > C) and a 10-base-pair deletion (g.1456_1466del) in the Integrin subunit alpha2β gene (ITGA2B) of horses of different breeds (Quarter Horse, Thoroughbred, Oldenburg, and Peruvian Paso). ITGA2B codifies the αIIb subunit of the αIIbβ3 integrin, also termed platelet fibrinogen receptor. Horses with GT have b...
Genome-Wide Association Analyses of Equine Metabolic Syndrome Phenotypes in Welsh Ponies and Morgan Horses. Equine metabolic syndrome (EMS) is a complex trait for which few genetic studies have been published. Our study objectives were to perform within breed genome-wide association analyses (GWA) to identify associated loci in two high-risk breeds, coupled with meta-analysis to identify shared and unique loci between breeds. GWA for 12 EMS traits identified 303 and 142 associated genomic regions in 264 Welsh ponies and 286 Morgan horses, respectively. Meta-analysis demonstrated that 65 GWA regions were shared across breeds. Region boundaries were defined based on a fixed-size or the breakdown of li...
Characterization of abortion, stillbirth and non-viable foals homozygous for the Warmblood Fragile Foal Syndrome. Warmblood fragile foal syndrome (WFFS) is a monogenetic defect with autosomal recessive inheritance. The WFFS homozygosity is non-compatible with extra-uterine life. Although as many as 15% of Warmblood horses are WFFS carriers, there has been little veterinary focus on this condition. The aim of this study was to determine outcomes and symptoms of clinical signs and pathological abnormalities during pregnancies when there were WFFS homozygous foetuses. Diagnostic material of 15 abortion or stillbirth cases with suspected diagnosis of WFFS was available for this study. Additionally, there were...
TRIM39-RPP21 Variants (∆19InsCCC) Are Not Associated with Juvenile Idiopathic Epilepsy in Egyptian Arabian Horses. Juvenile idiopathic epilepsy (JIE) is an inherited disease characterized by recurrent seizures during the first year of life in Egyptian Arabian horses. Definitive diagnosis requires an electroencephalogram (EEG) performed by a veterinary specialist. A recent study has suggested that a 19 base-pair deletion, along with a triple-C insertion, in intron five of twelve (∆19InsCCC; chr20:29542397-29542425: GTTCAGGGGACCACATGGCTCTCTATAGA>TATCTTAAGACCC) of the () gene is associated with JIE. To confirm this association, a new sample set consisting of nine EEG-phenotyped affected and nine unaffec...
Warmblood fragile foal syndrome type 1 mutation (PLOD1 c.2032G>A) is not associated with catastrophic breakdown and has a low allele frequency in the Thoroughbred breed. Catastrophic fractures are among the most common cause of fatalities in racehorses. Several factors, including genetics, likely contribute to increased risk for fatal injuries. A variant in the procollagen-lysine, 2-oxoglutarate 5-dioxygenase1 gene (PLOD1 c.2032G>A) was shown to cause Warmblood fragile foal syndrome type 1 (WFFS), a fatal recessive defect of the connective tissue. Screening of multiple horse breeds identified the presence of the WFFS allele in the Thoroughbred. PLOD1 is involved in cross-linking of collagen fibrils and thus could potentially increase the risk of catastrophic b...
A novel 13-plex STR typing system for individual identification and parentage testing of donkeys (Equus asinus). Previous studies investigating donkey parentage and genetic diversity used horse-specific multiplex systems. However, several mis-allele and null-allele issues were found with some of the horse primers when used in donkeys. In 2017, the International Society for Animal Genetics (ISAG) recommended 13 dinucleotide short tandem repeats (STRs) (AHT4, ASB23, HMS2, HMS3, HMS6, HMS7, HMS18, HTG7, HTG10, TKY297, TKY312, TKY337 and TKY343) as a core panel that should be used to identify individuals and to test for parentage in donkeys. To date, no single multiplex STR typing system containing all 13 do...
Previously Identified Genetic Variants in ADGRL3 Are not Associated with Risk for Equine Degenerative Myeloencephalopathy across Breeds. Equine neuroaxonal dystrophy/equine degenerative myeloencephalopathy (eNAD/EDM) is a neurologic disease that has been reported in young horses from a wide range of breeds. The disease is inherited and associated with vitamin E deficiency during the first two years of life, resulting in bilateral symmetric ataxia. A missense mutation (chr3:71,917,591 C > T) within adhesion G protein-coupled receptor L3 (ADGRL3) was recently associated with risk for EDM in the Caspian breed. In order to confirm these findings, genotyping of this missense mutation, along with the three other associated single nuc...
Genome-wide association study for insect bite hypersensitivity susceptibility in horses revealed novel associated loci on chromosome 1. Equine insect bite hypersensitivity (IBH) is a pruritic skin allergy caused primarily by biting midges, Culicoides spp. IBH susceptibility has polygenic inheritance and occurs at high frequencies in several horse breeds worldwide, causing increased costs and reduced welfare of affected horses. The aim of this study was to identify and validate single nucleotide polymorphisms (SNPs) associated with equine IBH susceptibility. After quality control, 33,523 SNPs were included in a Bayesian genome-wide association study on 177 affected and 178 unaffected Icelandic horses. We report associated regio...
Equine arteritis virus long-term persistence is orchestrated by CD8+ T lymphocyte transcription factors, inhibitory receptors, and the CXCL16/CXCR6 axis. Equine arteritis virus (EAV) has the unique ability to establish long-term persistent infection in the reproductive tract of stallions and be sexually transmitted. Previous studies showed that long-term persistent infection is associated with a specific allele of the CXCL16 gene (CXCL16S) and that persistence is maintained despite the presence of local inflammatory and humoral and mucosal antibody responses. Here, we performed transcriptomic analysis of the ampullae, the primary site of EAV persistence in long-term EAV carrier stallions, to understand the molecular signatures of viral persiste...