Omneity® Pellets
All-In-One Vitamin & Mineral Pellet
Topic:Alleles
Alleles in horses refer to the different versions of a gene that exist within the equine genome, contributing to the diversity of traits observed in horse populations. These genetic variations can influence a wide range of characteristics, including coat color, height, temperament, and susceptibility to certain diseases. Understanding alleles is crucial for breeding programs, as they help predict the inheritance of desirable traits and manage genetic disorders. Common examples include the alleles responsible for coat color variations, such as the Extension (E) and Agouti (A) loci. This page compiles peer-reviewed research studies and scholarly articles that explore the identification, function, and impact of alleles on equine genetics, offering insights into their role in shaping the phenotypic and health-related traits of horses.
SNPs analysis of height traits in Ningqiang pony. Ningqiang pony is one of the five pony breeds in China and is listed as a rare species. It is, therefore, meaningful to conduct stature research on this breed for its efficient reproduction, utilization and protection. This study is based on four SNP variants of adjacent LCORL/NCAPG, HMGA2, ZFAT and LASP1 genes, which have been found to be associated with horse height, and then, the 4 SNP loci in 22 Ningqiang ponies were analyzed. The results showed that there were genetic variations at the four loci in Ningqiang pony, there was a SNP on LCORL/NCAPG, HMGA2 and ZFAT gene all including T allele ...
Spread of equine arteritis virus among Hucul horses with different EqCXCL16 genotypes and analysis of viral quasispecies from semen of selected stallions. Equine arteritis virus (EAV) is maintained in the horse populations through persistently infected stallions. The aims of the study were to monitor the spread of EAV among Polish Hucul horses, to analyse the variability of circulating EAVs both between- and within-horses, and to identify allelic variants of the serving stallions EqCXCL16 gene that had been previously shown to strongly correlate with long-term EAV persistence in stallions. Serum samples (n = 221) from 62 horses including 46 mares and 16 stallions were collected on routine basis between December 2010 and May 2013 and tested f...
Heterozygotes for ACAN dwarfism alleles in horses have reduced stature. Homozygous and compound heterozygous Miniature horses for ACAN alleles D1, D2, D3* and D4 exhibit chondrodysplastic dwarfism (OMIA 001271-9796). In a previous study, the carrier rate for these four alleles, combined, was 26.2%. The purpose of this study was to investigate whether carriers of these dwarfism-causing alleles had a shorter withers height than non-carriers. A total of 245 Miniature horses were tested for these four ACAN alleles and also were measured for withers height. Of these horses, 98 were carriers and 147 were non-carriers. A statistically significant difference of 1.43 inche...
A Genome-Wide Association Analysis in Noriker Horses Identifies a SNP Associated With Roan Coat Color. The roan coat color in horses is characterized by dispersed white hair and dark points. This phenotype segregates in a broad range of horse breeds, while the underlying genetic background is still unknown. Previous studies mapped the roan locus to the KIT gene on equine chromosome 3 (ECA3). However, this association could not be validated across different horse breeds. Performing a genome-wide association analysis (GWAS) in Noriker horses, we identified a single nucleotide polymorphism (SNP) (ECA3:g.79,543.439 A > G) in the intron 17 of the KIT gene. The G -allele of the top associated SNP...
Inter- and intrabreed diversity of the major histocompatibility complex (MHC) in primitive and draft horse breeds. Polymorphism of major histocompatibility complex (MHC) genes ensures effective immune responses against a wide array of pathogens. However, artificial selection, as performed in the case of domestic animals, may influence MHC diversity. Here, we investigate and compare the MHC diversity of three populations of horses, for which different breeding policies were applied, to evaluate the impact of artificial selection and the environment on MHC polymorphism. Samples of DNA were taken from 100 Polish draft horses, 38 stabled Konik Polski horses and 32 semiferal Konik Polski horses. MHC alleles and...
A novel simple genotyping assay for detection of the ‘Gait keeper’ mutation in DMRT3 and allele frequencies in Azteca and Costa Rican Saddle Horse breeds. The 'Gait keeper' mutation in the DMRT3 gene alters locomotion and gait patterns in horses. This mutation (C>A) has been found in all gaited breeds of horses analyzed but is absent in most non-gaited breeds. We developed a new mutagenically separated polymerase chain reaction (MS-PCR) based method for simple detection of horse DMRT3 genotype. Our method was applied in a preliminary study to determine DMRT3 allele frequencies in 78 Azteca horses (AZ) and 53 Costa Rican Saddle Horses (CRSH). We found a wild-type C allele frequency of 100% in the AZ horses. For the CRSH, the wild-type C freque...
Description of the D4/D4 genotype in Miniature horses with dwarfism. Four causative mutations (D1, D2, D3*, and D4) of chondrodysplastic dwarfism have been described in the equine () gene. Homozygotes for one of these mutations and heterozygotes for any combination of these mutations exhibit the disproportionate dwarfism phenotype. However, no case description of homozygotes for D4 (D4/D4) has been reported in the literature, to our knowledge. We report 2 Miniature horses with the genotype D4/D4 in the gene. Clinically, the 2 dwarfs had a domed head that was large compared to the rest of the body, mandibular prognathism, and short and bowed limbs, mainly in t...
The First Report of Genetic and Structural Diversities in the SPRN Gene in the Horse, an Animal Resistant to Prion Disease. Prion diseases are fatal neurodegenerative diseases and are characterized by the accumulation of abnormal prion protein (PrP) in the brain. During the outbreak of the bovine spongiform encephalopathy (BSE) epidemic in the United Kingdom, prion diseases in several species were reported; however, horse prion disease has not been reported thus far. In previous studies, the shadow of prion protein (Sho) has contributed to an acceleration of conversion from normal prion protein (PrP) to PrP, and the shadow of prion protein gene () polymorphisms have been significantly associated with the susceptibi...
Genetic investigation of equine recurrent uveitis in Appaloosa horses. Equine recurrent uveitis (ERU) is characterized by intraocular inflammation that often leads to blindness in horses. Appaloosas are more likely than any other breed to develop insidious ERU, distinguished by low-grade chronic intraocular inflammation, suggesting a genetic predisposition. Appaloosas are known for their white coat spotting patterns caused by the leopard complex spotting allele (LP) and the modifier PATN1. A marker linked to LP on ECA1 and markers near MHC on ECA20 were previously associated with increased ERU risk. This study aims to further investigate these loci and identify a...
Changes of sires in a breeding farm enables maintenance of DNA-level genetic variation in a produced herd of Hokkaido Native Horses. We investigated whether regular changes of the sire in a breeding farm of Hokkaido Native Horses (HKDs) enables the DNA-level genetic variation of the produced animals to be maintained. The genotypes of 31 microsatellite markers were identified and analyzed in 207 animals produced in a breeding farm in which the sire was replaced every 3 to 5 years. The mean allele number indicating the degree of genetic variation was 5.97 and was similar to those reported previously. The mean observed heterozygosity was 0.74 and was higher than the expected heterozygosity, 0.69; F was -0.07, indicating that ...
Prevalence of the Mutations Responsible for Glanzmann Thrombasthenia in Horses in Brazil. Glanzmann's thrombasthenia (GT) is an autosomal recessive inherited disorder characterized by changes in platelet aggregation, leading to hemorrhage and epistaxis. To date, two independent mutations have been described in horses and associated with this disorder, a point mutation (c.122G > C) and a 10-base-pair deletion (g.1456_1466del) in the Integrin subunit alpha2β gene (ITGA2B) of horses of different breeds (Quarter Horse, Thoroughbred, Oldenburg, and Peruvian Paso). ITGA2B codifies the αIIb subunit of the αIIbβ3 integrin, also termed platelet fibrinogen receptor. Horses with GT hav...
Genome-Wide Association Analyses of Equine Metabolic Syndrome Phenotypes in Welsh Ponies and Morgan Horses. Equine metabolic syndrome (EMS) is a complex trait for which few genetic studies have been published. Our study objectives were to perform within breed genome-wide association analyses (GWA) to identify associated loci in two high-risk breeds, coupled with meta-analysis to identify shared and unique loci between breeds. GWA for 12 EMS traits identified 303 and 142 associated genomic regions in 264 Welsh ponies and 286 Morgan horses, respectively. Meta-analysis demonstrated that 65 GWA regions were shared across breeds. Region boundaries were defined based on a fixed-size or the breakdown of li...
Characterization of abortion, stillbirth and non-viable foals homozygous for the Warmblood Fragile Foal Syndrome. Warmblood fragile foal syndrome (WFFS) is a monogenetic defect with autosomal recessive inheritance. The WFFS homozygosity is non-compatible with extra-uterine life. Although as many as 15% of Warmblood horses are WFFS carriers, there has been little veterinary focus on this condition. The aim of this study was to determine outcomes and symptoms of clinical signs and pathological abnormalities during pregnancies when there were WFFS homozygous foetuses. Diagnostic material of 15 abortion or stillbirth cases with suspected diagnosis of WFFS was available for this study. Additionally, there were...
TRIM39-RPP21 Variants (∆19InsCCC) Are Not Associated with Juvenile Idiopathic Epilepsy in Egyptian Arabian Horses. Juvenile idiopathic epilepsy (JIE) is an inherited disease characterized by recurrent seizures during the first year of life in Egyptian Arabian horses. Definitive diagnosis requires an electroencephalogram (EEG) performed by a veterinary specialist. A recent study has suggested that a 19 base-pair deletion, along with a triple-C insertion, in intron five of twelve (∆19InsCCC; chr20:29542397-29542425: GTTCAGGGGACCACATGGCTCTCTATAGA>TATCTTAAGACCC) of the () gene is associated with JIE. To confirm this association, a new sample set consisting of nine EEG-phenotyped affected and nine unaffec...
Warmblood fragile foal syndrome type 1 mutation (PLOD1 c.2032G>A) is not associated with catastrophic breakdown and has a low allele frequency in the Thoroughbred breed. Catastrophic fractures are among the most common cause of fatalities in racehorses. Several factors, including genetics, likely contribute to increased risk for fatal injuries. A variant in the procollagen-lysine, 2-oxoglutarate 5-dioxygenase1 gene (PLOD1 c.2032G>A) was shown to cause Warmblood fragile foal syndrome type 1 (WFFS), a fatal recessive defect of the connective tissue. Screening of multiple horse breeds identified the presence of the WFFS allele in the Thoroughbred. PLOD1 is involved in cross-linking of collagen fibrils and thus could potentially increase the risk of catastrophi...
A novel 13-plex STR typing system for individual identification and parentage testing of donkeys (Equus asinus). Previous studies investigating donkey parentage and genetic diversity used horse-specific multiplex systems. However, several mis-allele and null-allele issues were found with some of the horse primers when used in donkeys. In 2017, the International Society for Animal Genetics (ISAG) recommended 13 dinucleotide short tandem repeats (STRs) (AHT4, ASB23, HMS2, HMS3, HMS6, HMS7, HMS18, HTG7, HTG10, TKY297, TKY312, TKY337 and TKY343) as a core panel that should be used to identify individuals and to test for parentage in donkeys. To date, no single multiplex STR typing system containing all 13 do...
Previously Identified Genetic Variants in ADGRL3 Are not Associated with Risk for Equine Degenerative Myeloencephalopathy across Breeds. Equine neuroaxonal dystrophy/equine degenerative myeloencephalopathy (eNAD/EDM) is a neurologic disease that has been reported in young horses from a wide range of breeds. The disease is inherited and associated with vitamin E deficiency during the first two years of life, resulting in bilateral symmetric ataxia. A missense mutation (chr3:71,917,591 C > T) within adhesion G protein-coupled receptor L3 (ADGRL3) was recently associated with risk for EDM in the Caspian breed. In order to confirm these findings, genotyping of this missense mutation, along with the three other associated single ...
Genome-wide association study for insect bite hypersensitivity susceptibility in horses revealed novel associated loci on chromosome 1. Equine insect bite hypersensitivity (IBH) is a pruritic skin allergy caused primarily by biting midges, Culicoides spp. IBH susceptibility has polygenic inheritance and occurs at high frequencies in several horse breeds worldwide, causing increased costs and reduced welfare of affected horses. The aim of this study was to identify and validate single nucleotide polymorphisms (SNPs) associated with equine IBH susceptibility. After quality control, 33,523 SNPs were included in a Bayesian genome-wide association study on 177 affected and 178 unaffected Icelandic horses. We report associated regio...
Equine arteritis virus long-term persistence is orchestrated by CD8+ T lymphocyte transcription factors, inhibitory receptors, and the CXCL16/CXCR6 axis. Equine arteritis virus (EAV) has the unique ability to establish long-term persistent infection in the reproductive tract of stallions and be sexually transmitted. Previous studies showed that long-term persistent infection is associated with a specific allele of the CXCL16 gene (CXCL16S) and that persistence is maintained despite the presence of local inflammatory and humoral and mucosal antibody responses. Here, we performed transcriptomic analysis of the ampullae, the primary site of EAV persistence in long-term EAV carrier stallions, to understand the molecular signatures of viral persiste...
In silico and in vitro analysis of genetic variants of the equine CYP3A94, CYP3A95 and CYP3A97 isoenzymes. Cytochrome P450 enzymes (CYPs) of the equine CYP3A subfamily are predominantly involved in drug metabolism. In this study, genetic variants of the equine CYP3A94, CYP3A95, and CYP3A97 were identified and characterized using in silico modeling and in vitro enzyme kinetics. The genomes of 81 horses were sequenced to obtain the genetic variants. Structural CYP modifications of the most frequent variants were analyzed in silico using the 3D-structures predicted by homology modeling. Enzyme kinetic analyses were performed using testosterone as substrate. Twenty genetic variants were found including...
MHC haplotype diversity in Icelandic horses determined by polymorphic microsatellites. The Icelandic horse has been maintained as a closed population in its eponymous homeland for many generations, with no recorded introductions of new horses of any breed since the year 1000 CE. Here we determined the diversity of major histocompatibility complex (MHC) haplotypes in 156 Icelandic horses from two groups, based on a panel of 12 polymorphic intra-MHC microsatellites tested in families of various composition. We identified a total of 79 MHC haplotypes in these two groups, including one documented intra-MHC recombination event from a total of 147 observed meioses. None of these MHC h...
Warmblood Fragile Foal Syndrome causative single nucleotide polymorphism frequency in Warmblood horses in Brazil. Warmblood Fragile Foal Syndrome (WFFS) is an autosomal recessive genetic disorder caused by a mutation in the procollagen-lysine, 2-oxoglutarate 5-dioxygenase 1 (PLOD1) gene, associated with collagen biosynthesis. WFFS causes lesions and malformations of the skin in neonatal foals, and abortion. The objective of this study was to investigate the allelic frequency of the single nucleotide polymorphism (SNP) c.2032G>A in the PLOD1 gene in warmblood samples from Brazil. Of the 374 Warmblood horses tested, 41 animals (11%) were identified as heterozygous for the WFFS SNP and 333 (89%) were homo...
Genetic screening for cerebellar abiotrophy, severe combined immunodeficiency and lavender foal syndrome in Arabian horses in Poland. The highly selective breeding of Arabian horses results in inbreeding depression and genetic disorders, thereby causing significant economic loss. The Polish population of Arabians has a great impact on many breeding programmes. The aim of the current study was to monitor genetic variants involved in the most common genetic disorders of this breed. A total of 808 elite Arabian horses were screened for cerebellar abiotrophy (CA), severe combined immunodeficiency (SCID) and lavender foal syndrome (LFS) genetic disorders by Sanger sequencing and allelic discrimination methods. The investigated po...
Genetic analysis of Streptococcus equi subsp. equi isolated from horses imported into Japan. Strangles is a commonly diagnosed and important infectious disease of equids worldwide, caused by Streptococcus equi subsp. equi. We determined the SeM genotypes of S. equi isolated from imported horses at the Japanese border within the past 8 years, which allowed us to classify 12 strains isolated from these horses from each exporter into four allelic groups. These alleles were different from the alleles of past isolates found in Japan. Furthermore, four strains classified into the same allele were isolated from horses from one exporter over several years. In this study, S. equi isolates from...
A candidate gene approach identifies variants in SLC45A2 that explain dilute phenotypes, pearl and sunshine, in compound heterozygote horses. Variations in the SLC45A2 gene are responsible for the dilution phenotypes cream and pearl in domestic horses. Cream dilution is inherited in an incomplete dominant manner, diluting only red in the heterozygous state but both red and black pigments when two alleles are present. The pearl dilution is recessive and dilutes only the red and black pigment in the homozygous state or when paired with a cream allele. Horses that inherit one copy of pearl (C ) and one copy of the dominant cream allele (C ) display a dilution phenotype similar to that of homozygous cream, suggesting that pearl is the ...
Modelling the development of anthelmintic resistance in cyathostomin parasites: The importance of genetic and fitness parameters. Previously described models for the free-living and parasitic phases of the cyathostomin life-cycle were combined into a single model for the complete life-cycle. The model simulates a single free-living population on pasture utilising parasite egg output from the horses and localised temperature and rainfall data to estimate infective larval density on herbage. Multiple horses of different ages are possible, each with an individualised anthelmintic treatment programme. Genotypes for anthelmintic resistance are included allowing for up to three resistance genes with 2 alleles each. Because lit...
A missense mutation in damage-specific DNA binding protein 2 is a genetic risk factor for ocular squamous cell carcinoma in Belgian horses. Belgian horses are commonly affected with ocular squamous cell carcinoma (SCC), the most common cancer of the equine eye. A missense mutation in damage-specific DNA binding protein 2 (DDB2 c.1013C>T, p.Thr338Met) has been established as a recessive genetic risk factor for ocular SCC in the Haflinger breed. A sample of Belgian horses with unknown SCC phenotype was shown to possess this variant at a similar frequency to the Haflinger breed. Retrospective studies indicate that chestnut coat colour may predispose to the development of SCC. Objective: To determine if DDB2 c.1013C>T is a risk ...
Explicit evidence for a missense mutation in exon 4 of SLC45A2 gene causing the pearl coat dilution in horses. Four loci seem responsible for the dilution of the basic coat colours in horse: Dun (D), Silver Dapple (Z), Champagne (CH) and Cream (C). Apart from the current phenotypes ascribed to these loci, pearl has been described as yet another diluted coat colour in this species. To date, this coat colour seems to segregate only in the Iberian breeds Purebred Spanish horse and Lusitano and has also been described in breeds of Iberian origin, such as Quarter Horses and Paint Horse, where it is referred to as the 'Barlink Factor'. This phenotype segregates in an autosomal recessive manner and resembles ...
Comparing assignment-based approaches to breed identification within a large set of horses. Considering the extensive data sets and statistical techniques, animal breeding embodies a branch of machine learning that has a constantly increasing impact on breeding. In our study, information regarding the potential of machine learning and data mining within a large set of horses and breeds is presented. The individual assignment methods and factors influencing the success rate of the procedure are compared at the Czech population scale. The fixation index values ranged from 0.057 (HMS1) to 0.144 (HTG6), and the overall genetic differentiation amounted to 8.9% among the breeds. The highes...
Genetic characteristics of feral Misaki horses based on polymorphisms of microsatellites and mitochondrial DNA. The Misaki horse is a Japanese native horse, known as the "feral horse of Cape Toi". In this study, we acquired the genetic information to establish their studbook, and analyzed their genetic characteristics for conservation. We genotyped 32 microsatellites and a mitochondrial D-loop region in 77 Misaki horses (80.2% of the population). The average number of alleles, observed heterozygosity, and expected heterozygosity were 3.4, 0.509, and 0.497, respectively. A neighbor-joining phylogenetic tree of individuals was constructed. Moreover, the results suggested that Misaki horses experienced a b...
