Disease diagnosis in horses involves the identification and characterization of illnesses through various diagnostic methods and tools. This process is essential for effective veterinary care and management of equine health. Techniques used in diagnosing diseases in horses include clinical examinations, laboratory tests, imaging modalities such as ultrasonography and radiography, and molecular diagnostics. Blood tests are frequently utilized to assess parameters such as complete blood count and biochemical profiles, which can indicate underlying health issues. Additionally, advancements in genetic testing and biomarker identification have enhanced the ability to detect specific diseases early. This page aggregates peer-reviewed research studies and scholarly articles that explore diagnostic methodologies, their applications, and their impact on equine health management.
Viitanen M, Bird J, Smith R, Tulamo RM, May SA.The study hypothesis was that navicular disease is a process analogous to degenerative joint disease, which leads to changes in navicular fibrocartilage and in deep digital flexor tendon (DDFT) matrix composition and that the process extends to the adjacent distal interphalangeal joint. The objectives were to compare the biochemical composition of the navicular articular and palmar cartilages from 18 horses with navicular disease with 49 horses with no history of front limb lameness, and to compare navicular fibrocartilage with medial meniscus of the stifle and collateral cartilage of the hoof...
Villegas-Castagnasso EE, Díaz S, Giovambattista G, Dulout FN, Peral-García P.The second exon of equine leucocyte antigen (ELA)-DQB genes was amplified from genomic DNA of 32 Argentine Creole horses by PCR. Amplified DNA was analysed by PCR-restriction fragment length polymorphism (RFLP) and PCR-single-strand conformation polymorphism (SSCP). The PCR-RFLP analysis revealed two HaeIII patterns, four RsaI patterns, five MspI patterns and two HinfI patterns. EcoRI showed no variation in the analysed sample. Additional patterns that did not account for known exon 2 DNA sequences were observed, suggesting the existence of novel ELA-DQB alleles. PCR-SSCP analysis exhibited se...
Ramzan PH, Newton JR, Shepherd MC, Head MJ.Tibial stress fractures are an important cause of lameness in the Thoroughbred racehorse. While it is recognised that these injuries can vary in clinical presentation and radiographic or scintigraphic appearance, little has been done to quantify lesion severity. By contrast the scintigraphic grading of tibial stress fractures in human athletes is widely reported and assists in the selection of appropriate management regimes. Objective: To determine the relationship between scintigraphic grade, clinical severity and radiographic appearance of tibial stress fractures. Methods: The current study ...
Denoix JM, Thibaud D, Riccio B.Bisphosphonates, such as tiludronate, are used to normalise bone metabolism via inhibition of bone resorption. Areas of increased bone resorption and formation are typical lesions in a diseased navicular bone. Objective: To determine if bone remodelling changes occurring in navicular disease may be corrected with therapies regulating bone metabolism. Methods: We designed a double-blind, placebo-controlled clinical trial to compare 2 doses of tiludronate, 0.5 mg/kg and 1 mg/kg bwt administered via daily i.v. injections over 10 days for the treatment of navicular disease. Seventy-three horses, s...
Kane AJ, McIlwraith CW, Park RD, Rantanen NW, Morehead JP, Bramlage LR.Although the radiographic examination of yearlings has become commonplace at some large Thoroughbred sales, there are few data to support the decisions facing veterinarians who are asked to evaluate future racing potential. Objective: To identify radiographic changes in the fetlocks, proximal sesamoid bones, carpi, tarsi, stifles and fore feet of Thoroughbred yearlings associated with future racing performance during ages 2 and 3 years. Methods: Radiographs from routine pre- and post sale examinations of 1162 yearlings were used to identify individual radiographic changes in sale yearlings. St...
Spike-Pierce DL, Bramlage LR.Proximal sesamoiditis has been a common and confusing radiographic diagnosis in Thoroughbred yearling surveys. This study categorised the radiographic appearance of yearling proximal sesamoid bones and determined their effect on the number of races started and earning potential for racing at ages 2 and 3 years. Objective: Yearlings with moderate to severe proximal sesamoiditis have decreased performance at age 2 and 3 years. Methods: Survey radiographs of 487 Thoroughbred yearlings were reviewed. Proximal sesamoid bones were examined and findings placed into 7 categories, 5 of which measured s...
Walmsley JR, Phillips TJ, Townsend HG.There is little published information available describing clinical signs, arthroscopic findings and prognosis of meniscal injuries in horses. Objective: To evaluate the effect on the outcome not only of the arthroscopic findings and treatment, but also of the clinical and radiographic signs in these horses. Methods: The following were recorded for each case: the meniscal injury, graded according to severity; clinical and radiographic findings prior to surgery; any concurrent injury in the joint seen at arthroscopy. The effect of these factors and the grade of injury on the outcome were analys...
Vengust M, Arroyo LG, Weese JS, Baird JD.Clostridial myonecrosis is caused by histotoxic or tissue-
destroying clostridia (Allen et al. 1999). Clostridium perfringens
and C. septicum are the most common isolates in horses, followed
by C. chauvoei, C. novyi and C. fallax (McLaughlin et al. 1979;
Westman et al. 1979; Hagemoser et al. 1980; Murphy 1980; Van
Heerden and Botha 1982; Coloe et al. 1983; Valberg and
McKinnon 1984; Rebhun et al. 1985; Perdrizet et al. 1987). The
disease is characterised by a rapid spread of tissue necrosis
combined with a lack of leucocyte infiltration at the site of
infection (Stevens et al. 1987). ...
Frankeny RL.Five horses with unilateral epidermal inclusion cysts located in the nasal diverticula were sedated and treated with intralesional injection of neutral-buffered 10% formalin (volume range, 2 to 4.5 mL). After aspiration of the cyst, formalin was injected intralesionally until leakage of fluid around the needle was observed. After several weeks, desiccation of the cyst was evident; it was excised 2 weeks after treatment in 3 horses, digitally removed by the owner of 1 horse, and never removed in 1 horse, because the owner declined further treatment after resolution of the original swelling of t...
Gerst S, Borchers K, Gower SM, Smith KC.EHV-1 and EHV-4 abortion diagnosis is based upon detailed examination of the aborted fetus. However, in some cases, only the placenta is available for examination. Furthermore, the contribution of lesions in the placenta to pathogenesis and diagnosis of EHV-1 and EHV-4 abortion has been neglected. Objective: To assess the utility of placental examination in equine herpesvirus-1 (EHV-1) and EHV-4 abortion diagnosis. Methods: Sections of allantochorion from 49 herpesvirus abortions were analysed by PCR, in situ hybridisation and immunostaining. Results: Virus-specific nested PCR confirmed the pr...
Schumacher J, Schumacher J, Gillette R, DeGraves F, Schramme M, Smith R, Perkins J, Coker M.Analgesia of the palmar digital (PD) nerves has been demonstrated to cause analgesia of the distal interphalangeal (DIP) joint as well as the sole. Because the PD nerves lie in close proximity to the navicular bursa, we suspected that that analgesia of the navicular bursa would anaesthetise the PD nerves, which would result in analgesia of the DIP joint. Objective: To determine the response of horses with pain in the DIP joint to instillation of local anaesthetic solution into the navicular bursa. Methods: Lameness was induced in 6 horses by creating painful synovitis in the DIP joint of one f...
Loretti AP, Colodel EM, Gimeno EJ, Driemeier D.This study reports a neurological disease unrecognised until now in ponies in southern Brazil. Objective: Epidemiological data strongly suggests that the ingestion of Sida carpinifolia is involved in the aetiology. We tested the hypothesis that it is an acquired lyosomal storage disease. Methods: Following the death of 3 ponies, all ponies from the premises were closely monitored; epidemiological data and clinical findings carefully recorded. Fragments of several organs, including CNS, were fixed in neutral formalin and embedded in paraffin-wax. Sections were stained with haematoxylin and eosi...
Wilkins RJ, Fairfax TP, Davies ME, Muzyamba MC, Gibson JS.Ca2+ homeostasis in articular chondrocytes affects synthesis and degradation of the cartilage matrix, as well as other cellular functions, thereby contributing to joint integrity. Although it will be affected by mechanical loading, the sensitivity of intracellular Ca2+ concentration ([Ca2+]i) in equine articular chondrocytes to many stimuli remains unknown. Objective: An improved understanding of Ca2+ homeostasis in equine articular chondrocytes, and how it is altered during joint loading and pathology, will be important in understanding how joints respond to mechanical loads. Methods: [Ca2+]i...
Smith KC, Blunden AS, Whitwell KE, Dunn KA, Wales AD.A detailed review of laboratory records for equine abortion is fundamental in establishing current disease trends and suggesting problems important for further research. Objective: To review the causes of abortion and neonatal death in equine diagnostic submissions to the Animal Health Trust over a 10 year period. Methods: The diagnoses in 1252 equine fetuses and neonatal foals were reviewed and analysed into categories. Results: Problems associated with the umbilical cord, comprising umbilical cord torsion and the long cord/cervical pole ischaemia disorder, were the most common diagnoses (38....
Königová A, Várady M, Corba J.The objective of the study was to compare the in vitro egg hatch test (EHT), larval development test (LDT) and in vivo faecal egg count reduction test (FECR test) for the detection of benzimidazole resistance in equine strongyles. The presence of resistant or susceptible strongyle populations was determined in 25 stud farms using the in vivo FECR test and in vitro EHT. On the basis of the FECR values, resistance to fenbendazole was detected on 15 of the 25 farms (60%). The ED50 value (anthelmintic concentration producing 50% inhibition of hatching) for suspected resistant populations varied fr...
Dai CB, Xiao Y, Lu H, Shen RX, Shao YM.Membrane protein GP90 of China equine infectious anemia virus (EIAV) vaccine strain (DLV) and its parental wild type LN strain were expressed with Bac-to-Bac baculovirus expression system and BALB/c mice were inoculated with purified protein, thereby to explore the availability of protein for differential diagnosis and potential for preparing genetically engineered vaccine. Methods: The authors infected donkey PBMC culture with China EIAV vaccine strain (DLV) and its parental wild type LN strain, extracted its proviral DNA as template, amplified the GP90 of DLV and LN, respectively, and expres...
Hoque S, Derar RI, Osawa T, Taya K, Watanabe G, Miyake Y.A 21 year old thoroughbred mare with granulosa theca cell tumor (GTCT) in the right side and atrophic contralateral ovary was investigated in this study. After arrival at our laboratory on 10th December 1999, the clinical diagnosis of GTCT was examined by rectal palpation and ultrasonographic image of ovaries. Plasma from peripheral blood was collected in the breeding and non-breeding seasons for hormonal analysis. The results showed that the contralateral ovary regained normal activity without any treatment of the GTCT affected ovary and contained follicles showing different sizes 19 months l...
Hoque S, Derar RI, Senba H, Osawa T, Kano K, Taya K, Miyake Y.To clarify the morphological and immunohistochemical characteristics in mares with granulosa theca cell tumor (GTCT), the localization of inhibin subunits (alpha, betaA, betaB) and aromatase in the granulosa cell layers and theca layers in the ovarian follicles were determined by immunohistochemical staining. The follicles were obtained from the ovaries of 6 mares with GTCT and 4 normal mares as controls. Immunohistochemically, inhibin alpha-subunit was localized in the granulosa cells of all follicles showing different sizes in all GTCT cases and betaA- subunit was localized in two GTCT cases...
Scarpulla M, Caristo ME, Macri G, Lillini E.The authors review equine granulocytic ehrlichiosis (EGE) in Italy from 1996 to 2002. In 1996, the first case of EGE has been observed in a horse affected with specific symptomatology (fever, lethargy, anorexia, limb edema, thrombocytopenia, and petechiae). In 1997, a seroepidemiological survey was performed in the province of Rome on 563 animals using IFAT. The authors describe the last case, which occurred on 2002 in a 15-year-old male, bay, half-breed, tick-infested horse. Clinical features included fever, lethargy, limb edema, icterus, leukocytopenia, and thrombocytopenia. Laboratory tests...
Spyrou V, Papanastassopoulou M, Psychas V, Billinis Ch, Koumbati M, Vlemmas J, Koptopoulos G.There appears to be a lack of information concerning responses of mules to natural infection or experimental inoculation with equine infectious anemia virus (EIAV). In the present study EIAV was isolated from mules, for the first time, and its pathogenicity in naturally infected and experimentally inoculated animals was investigated. Two naturally infected (A and B) and three EIAV free mules (C, D and E) were used for this purpose. Mule A developed clinical signs, whereas mule B remained asymptomatic until the end of the study. Mules C and D were each inoculated with 10ml of blood from mule A ...
Dawson K.Sourcing of horses naturally infected with parasites such as Anoplocephala perfoliata and Gasterophilus intestinalis for antiparasitic efficacy slaughter studies is often difficult, expensive, and usually excessive numbers of animals must be slaughtered before significant data can be obtained. To overcome this problem a "Modified Critical Treatment Method" was developed. This method does not require the horses to be sacrificed, but relies on the collection and processing of all faecal material containing expelled parasites from test animals. Efficacy is assessed by comparing, in the same horse...
Peters M, Brandt K, Wohlsein P.An intracranial epidermoid cyst was diagnosed in a Haflinger gelding aged 12 years suffering from episodes of neurological disturbance, apathy and fever. The extracerebral cyst was located in the region of the tentorium cerebelli and measured 9 x 8 x 5 cm. It displaced the cerebral hemispheres anteriorly and compressed the cerebellum and brainstem underneath. Histologically, the cyst was lined by keratinizing, stratified squamous epithelium and contained keratin scales, debris, focal haemorrhages, and degenerating inflammatory cells. The epithelium was supported by a vascularized fibrous capsu...
Oke SL, Hurtig MB, Keates RA, Wright JR, Lumsden JH.To determine whether 3 variations of the 1,9-dimethylmethylene blue (DMMB) assay yield comparable results when measuring sulfated glycosaminoglycan (sGAG) concentrations in equine synovial fluid (SF). Methods: 25 samples of SF collected from affected joints of 13 horses and 13 samples of SF collected from nonaffected (control) joints of 4 horses. Methods: Sulfated glycosaminoglycan concentrations were measured by the direct spectrophotometric (ie, Farndale), microplate, and indirect DMMB assays in samples of SF collected from normal and affected joints and in samples digested with nucleases, p...
Morgan SJ, Hood DM, Wagner IP, Postl SP.To describe submural histopathologic changes attributable to peracute laminitis in horses. Methods: 20 adult horses. Methods: A concurrent-control design was used to compare laminar lesions in 10 horses subjected to carbohydrate-induced laminitis with laminar characteristics of 10 sex- and aged-matched control horses with normal feet. Horses in the treatment group were administered an overload of carbohydrate. Tissues were obtained by biopsy 4 to 8 hours after onset of lameness or 72 hours after administration of the carbohydrate overload when lameness did not develop. Sections were stained wi...
Oke SL, Hurtig MB, Keates RA, Wright JR.To develop a new 1,9-dimethylmethylene blue (DMMB) assay for measurement of sulfated glycosaminoglycan (sGAG) concentrations in equine synovial fluid (SF) by use of membrane technology and to compare the assay's ability to measure sGAG concentrations with that of 2 other established DMMB assays. Methods: 25 samples of SF collected from affected joints of 14 horses and 13 samples of SF collected from nonaffected (control) joints of 4 horses. Methods: A solid-phase DMMB assay was developed to measure sGAG concentrations in SE Results for the assay were then compared with results obtained by use ...
Misdorp W.The literature on congenital tumours and tumour-like lesions in horses was reviewed. Included were embryonic tumours and teratomas. Special attention was paid to the ubiquitous adenomatous hyperplasia of the placenta. It appears that temporal teratomas, interstitial hamartomas and placental adenomatous hyperplasia are unique in the horse. Benign teratoma of the undescended testis is far more frequent in the horse than in other species. In horses, as in calves and pigs, congenital skin tumours were of papillomatous, vascular and melanocytic types. The sporadic occurrence of congenital tumours i...
Burns SJ, Westerman AG, Harrison LR.Mare Reproductive Loss Syndrome (MRLS) is the term given to abortions in mares associated with Eastern Tent caterpillars (ETC; Malacosoma americanum). This paper aims to examine if the hypothesis for a toxin as the cause of MRLS holds up to testing using Westerman's Correlates of Causal Strength of Evidence (WCCSE) and fits with known environmental factors that influence the occurrence of MRLS. Using WCCSE all correlates fit with a toxin as a potential causative agent. Environmental factors also fitted with this hypothesis. MRLS events were associated with higher than normal ambient temperatur...
Steffey EP, Farver T, Zinkl J, Wheat JD, Meagher DM, Brown MP.Quantitative changes in hematologic and serum biochemical values associated with prolonged general anesthesia produced by known alveolar doses of halothane in oxygen were determined in six young, healthy horses under laboratory conditions. In addition, 25 young equine patients anesthetized for shorter periods under clinical conditions were similarly (except hematologic values) prospectively evaluated. In normal horses, muscle- and hepatic-derived serum biochemical values were mildly increased immediately after anesthesia. Values after anesthesia remained at greater than base-line values for up...
Rickards KJ, Page CP, Lees P, Cunningham FM.Neutrophils are recruited to the lungs of horses with chronic obstructive pulmonary disease (COPD) and exhibit increased activity after antigen challenge. Phosphodiesterase type4 (PDE4) inhibitors have been shown to attenuate human neutrophil activation. The aim of this study was to establish the PDE isoenzyme profile of equine neutrophils using isoenzyme selective inhibitors to determine if these compounds should be evaluated in horses with COPD. Total cAMP and cGMP dependent PDE activity was no different in neutrophils from normal (156.2+/-7.1 and 6.8+/-0.6 pmol/min/mg for cAMP and cGMP, res...
Nielsen IL, Jacobs KA, Huntington PJ, Chapman CB, Lloyd KC.Adverse reactions to intramuscular injections of procaine penicillin G are reported in 11 horses, five of which died. The clinical findings are presented and suggest central nervous involvement in most cases. Post mortem findings in one horse were consistent with anaphylaxis whereas in other cases the clinical findings, duration of treatment, speed of onset and subsequent completion of treatment supports diagnosis of an acute procaine toxicity syndrome.
Bone reportsJanuary 5, 2023
Volume 18 101653 doi: 10.1016/j.bonr.2023.101653
Grissom SK, Semevolos SA, Duesterdieck-Zellmer K.The objective of this study is to better understand the pathogenesis of early equine osteochondrosis (OC) by identifying differences in gene and protein expression of extracellular matrix components and regulators in normal and diseased cartilage and bone, focusing on the osteochondral junction and cells surrounding the cartilage canals. We expected to find an upregulation of matrix metalloproteinases and a decrease in extracellular matrix constituent expression along the osteochondral junction and cells surrounding the cartilage canals in OC samples. Paraffin-embedded osteochondral samples (6...
Brumbaugh GW, Benson PA.Samples of pleural fluid from 20 horses with effusive pleural diseases of various causes were evaluated; samples from 19 horses were used for the study. There were differences for pH (P = 0.001) and partial pressure of oxygen (PO2) between arterial blood and nonseptic pleural fluid (P = 0.0491), but there were no differences for pH, PO2, partial pressure of carbon dioxide (PCO2), and concentrations of bicarbonate (HCO3-), lactate, and glucose between venous blood and nonseptic pleural fluid. Paired comparisons of venous blood and nonseptic pleural fluid from the same horse indicated no differe...
Argo CM.Leisure animals now comprise the majority of working horses in industrialized nations; a shift that has decreased workloads yet improved veterinary care and lifetime health. Although many horses now progress well into their 20s without any requirement for dietary modification, age-related changes are insidious, and older animals benefit from regular veterinary monitoring to identify, address, and ameliorate the inevitable onset of age-related "disease." Basal metabolic rate decreases with age; older animals expend less energy on controlled exercise, and there can be an increased propensity tow...
Stadler P, van den Berg SS, Tustin RC.A Hansen type I cervical intervertebral disc prolapse was diagnosed in a 16-year-old American Saddler showing clinical signs of paresis and ataxia. An ante-mortem diagnosis was made by means of plain radiographs and a myelogram. The horse was euthanased and the diagnosis confirmed on a post-mortem examination.
Sá e Silva M, da Costa MM, de Avila Botton S, Barretta C, Groff AC, de Vargas AC.Strangles is an acute and contagious disease characterized by inflammation of the upper respiratory tract of horses. The etiological agent of strangles is the bacteria S. equi subsp. equi, which belongs to the Lancefield group C. Opportunistic agents from the same group are frequently isolated from horses with strangles and may induce mistaken diagnoses. Among the subspecies of S. equi, the phenotypic features are almost undistinguishable; however, the pathogenic potential is widely differentiated. The aim of this study was to characterize S. equi isolates obtained from clinical samples of str...
Neumann SM, Kainer RA, Severin GA.In the main study, hyperthermia was induced by radio-frequency current to obtain a single, central, corneal lesion in the right eye and 2 separate limbal lesions in the left eye of 13 light horses and 8 ponies. Intracorneal and intralimbal temperature profiles for the procedure were obtained in a separate study from the eyes of a horse and a pony treated in the same manner. After treatment of the principal eyes and 6 sham-treated eyes, clinical observations were conducted for up to 6 months, using indirect ophthalmoscopy, biomicroscopy, and fluorescein staining. Immediately after hyperthermic ...
Hwang H, Ro Y, Lee H, Kim J, Lee K, Choi EJ, Bae YC, So B, Kwon D, Kim H, Lee I.Since 2013, the number of requests for diagnosis for horses based on neurological symptoms has increased rapidly in South Korea. The affected horses have commonly exhibited symptoms of acute seasonal hindlimb ataxia. A previous study from 2015-2016 identified as the causative agent. Objective: This study is an epidemiological investigation to find out risk factors related to the rapid increase in hindlimb ataxia of horses due to aberrant parasites in South Korea. Methods: An epidemiological investigation was conducted on 155 cohabiting horses in 41 horse ranches where the disease occurred. Th...
Wenker C, Hoby S, Steck BL, Ramsauer AS, Blatter S, Tobler K.Equine sarcoids (ES) were diagnosed in 12 Somali wild asses (SWA) () from 10 different institutions of the SWA European Endangered Species Programme from 1976 to 2019. Samples of surgically excised masses, biopsies, or necropsy samples were submitted for histologic and virologic analysis. In addition, tissue samples from one onager (), one kulan (), and two Hartmann's mountain zebras (HMZ) () were examined. Histology confirmed the diagnosis of ES exhibiting the typical microscopic features. Polymerase chain reaction detected bovine papillomavirus type 1 (BPV1) DNA in eight SWA samples and bovi...
Caporale VP, Biancifiori F, Frescura F, Di Matteo A, Nannini D, Urbani G.Comparative tests such as FAT, ELISA, RIA, IEO and CF in the diagnosis of dourine in the horse have proved a satisfactory concordance ratio of the ELISA with CF, which seems to be the most reliable test. Discrepancies have been observed as to the other tests which appear less sensitive than CF test.
Williamson LH, Farrell RL.A case of intracranial schwannoma is described in a young horse. Clinical signs developed slowly and were suggestive of a lesion involving the left cerebrum. The filly exhibited a change in mentation, and circled to the left. Visual impairment and decreased facial sensation were noted on the right side. A solitary schwannoma which compressed the left cerebrum was found at necropsy.
Rivas VN, Aleman M, Peterson JA, Dahlgren AR, Hales EN, Finno CJ.Juvenile idiopathic epilepsy (JIE) is an inherited disease characterized by recurrent seizures during the first year of life in Egyptian Arabian horses. Definitive diagnosis requires an electroencephalogram (EEG) performed by a veterinary specialist. A recent study has suggested that a 19 base-pair deletion, along with a triple-C insertion, in intron five of twelve (∆19InsCCC; chr20:29542397-29542425: GTTCAGGGGACCACATGGCTCTCTATAGA>TATCTTAAGACCC) of the () gene is associated with JIE. To confirm this association, a new sample set consisting of nine EEG-phenotyped affected and nine unaffec...
Enders F, Weber A.Fecal samples of 146 horses were culturally investigated for occurrence of Prototheca spp. using a selective medium, developed by PORE (1973). Prototheca zopfii could be isolated in monoculture from 9 fecal samples (6.2%). The results of this pilot study show that horses too can harbour and shed Prototheca spp. in variable frequency.
Marshall JF, Moorman VJ, Moll HD.To determine the incidence of unilaterally castrated horses among horses admitted to the hospital for castration and to compare horses that underwent previous unilateral castration with horses that had cryptorchism. Methods: Retrospective case series. Methods: 16 unilaterally castrated horses and 44 cryptorchid horses. Methods: Medical records of horses that were admitted to the veterinary medical teaching hospital for castration, including cryptorchid and unilaterally castrated horses, between January 2002 and December 2006 were reviewed. Medical records of unilaterally castrated horses and c...
Tuvshintulga B, Nugraha AB, Mizutani T, Liu M, Ishizaki T, Sivakumar T, Xuan X, Yokoyama N, Igarashi I.Theileria equi, an intraerythrocytic protozoan parasite, causes equine piroplasmosis, a disease which negatively impacts the global horse industry. Genetic manipulation is one of the research tools under development as a control method for protozoan parasites, but this technique needs to be established for T. equi. Herein, we report on the first development of a stable transgenic T. equi line expressing enhanced green fluorescent protein/blasticidin S deaminase (eGFP/BSD). To express the exogenous fusion gene in T. equi, regulatory regions of the elongation factor-1 alpha (ef-1α) gene were id...
Sutton DG, Bahr A, Preston T, Cohen ND, Love S, Roussel AJ.The 13C-octanoic acid breath test has been correlated significantly to radioscintigraphy for measurement of gastric emptying indices in healthy horses. The objective of this study was to investigate the validity of the test for measurement of equine delayed gastric emptying, prior to its potential clinical application for this purpose. A model of atropine-induced gastroparesis was used. Gastric emptying rate was measured twice in 8 horses using concurrent radioscintigraphy and/or breath test after treatment i.v. with either atropine (0.035 mg/kg bwt) or saline in randomised order. Analysis of ...