The study of diseases in horses encompasses a wide range of conditions affecting equine health, including infectious diseases, metabolic disorders, and genetic abnormalities. These diseases can impact various systems within the horse, such as respiratory, gastrointestinal, and musculoskeletal systems, and can lead to significant health challenges. Research in this area focuses on understanding the pathophysiology, diagnosis, prevention, and treatment of equine diseases. Common diseases studied include equine influenza, equine herpesvirus, and laminitis. This page provides access to peer-reviewed research studies and scholarly articles that explore the etiology, clinical presentation, and management strategies of diseases in horses, contributing to the advancement of equine veterinary medicine.
Duarte PC, Daft BM, Conrad PA, Packham AE, Gardner IA.A serum indirect fluorescent antibody test (IFAT) was compared with a Western blot (WB) and a modified Western blot (mWB) for diagnosis of equine protozoal myeloencephalitis (EPM). Using receiver-operating characteristic (ROC) analysis, the area under the curve of the IFAT was greater than the areaunder the curves of the WB and the mWB (P = 0.025 and P = 0.044, respectively). There was no statistically significant difference between the areas under the curves of the WBs (P > 0.05). On the basis of an arbitrarily chosen cut-off titer for a positive test result of 1:80 for the IFAT and interpret...
Toribio RE, Kohn CW, Leone GW, Capen CC, Rosol TJ.In this study, we describe the cloning and tissue expression of equine calcitonin (CT), calcitonin-gene related peptide (CGRP)-I, and CGRP-II cDNA. We also describe a novel divergent form of CGRP (CGRP-I). Equine CT has greatest homology (>85%) to human, rat and mouse subgroups of calcitonins. Equine CGRP-I has low homology (80% homology to chicken, human, rat, ovine, swine, and bovine CGRPs. The homology between equine CGRP-I and CGRP-II is low (56%). The high homology of equine CGRP-II and the low homology of equine CGRP-I to CGRP in other species were unexpected findings. Northern blot a...
Crespo MJ, Abarca ML, Cabañes FJ.During a study on the occurrence of Malassezia spp. in 112 animals (50 horses, 25 goats, 25 sheep and 12 cows), Malassezia spp. were isolated from 60% of horses, 28% of sheep, 44% of goats and 58% of cows. In these animals, the occurrence of lipid-dependent species (42%) was much greater than the occurrence observed for M. pachydermatis (3%). Among the results obtained, we point out the first isolation of M. sympodialis, M. globosa and M. restricta from sheep, M. pachydermatis, M. furfur, M. sympodialis, M. obtusa, M. globosa and M. restricta from goats and M. furfur, M. slooffiae, M. obtusa, ...
Gilger BC, Pizzirani S, Johnston LC, Urdiales NR.A hydroxyapatite orbital implant was used after enucleation of an eye from a 5-year-old performance horse. A custom-made corneoscleral prosthesis was made and fitted over the hydroxyapatite implant. The implant and surgery were well tolerated. Placement of a cosmetic prosthesis is desired after enucleation of equine eyes to allow horses to return to competition. Synthetic spheres consisting of methylmethacrylate or silicone have been used, although reported complications have included extrusion, infection, and poor cosmetic results. Hydroxyapatite orbital implants made from marine coral allow ...
Kettner NU, Parker JE, Watrous BJ.A 2-week-old Morgan filly examined because of lameness of 5 days' duration was found, on the basis of clinical and radiographic findings, to have septic physitis of the distal end of the radius. The foal was treated by means of intraosseous regional perfusion with penicillin and amikacin and systemic administration of antimicrobials. Intraosseous regional perfusion was performed 3 times. The foal was anesthetized for the first episode of intraosseous regional perfusion, but was only sedated for the subsequent 2 episodes. Antimicrobials were administered systemically for 22 days. Foals with sep...
Berezowski C.A 14-year-old quarter horse mare had a 2-year history of infertility and the presence of a mass in the right uterine horn. Prior to surgery, the mass was determined to be invasive by using ultrasonography and hysteroscopy. A partial ovariohysterectomy was performed. The mass was diagnosed histologically as a uterine leiomyoma.
Cohen ND, Carey VJ, Donahue JG, Seahorn JL, Donahoe JK, Williams DM, Harrison LR.To identify factors associated with abortions of mares during late gestation attributed to mare reproductive loss syndrome (MRLS). Methods: Case-control study. Methods: 282 broodmares from 62 farms in central Kentucky, including 137 mares that had late-term abortions (LTAs) associated with MRLS, 98 mares from the same farms that did not abort, and 48 mares that aborted from causes other than MRLS. Methods: Farm managers were interviewed to obtain data on a wide range of management practices and environmental exposures for the mares. Data for case and control horses were compared to identify ri...
Ruohoniemi M, Ahtiainen H, Ojala M.Ossification of the cartilages in the foot is common in coldblooded horses, but prevalence as well as ossification pattern varies between breeds; research on estimation of heritability for the condition has been limited. Objective: Our purpose was to calculate estimates of 1) heritability for ossification parameters of the cartilages in the front feet of the Finnhorse and 2) genetic correlations between the different ossification parameters. Methods: Estimates of heritability for different ossification parameters of the cartilages in the front feet and of genetic correlations between different...
Akiba M, Uchida I, Nishimori K, Tanaka K, Anzai T, Kuwamoto Y, Wada R, Ohya T, Ito H.Equine paratyphoid is caused by Salmonella enterica serovar Abortusequi, and manifests mainly as abortion in the mare. We compared S. Abortusequi strains isolated in Japan and other countries using pulsed-field gel electrophoresis (PFGE) and fluorescent amplified-fragment length polymorphism (FAFLP) analysis. PFGE analysis of S. Abortusequi strains gave 21-27 fragments ranging in size from 33 to 602kb. Although two PFGE profiles were observed among the 20 S. Abortusequi isolates in Japan, the restriction fragments originating from the chromosome were common between the two profiles. The simila...
Båverud V.In human medicine, Clostridium (C.) difficile is since many years a well-known cause of nosocomial diarrhea induced by antibiotic treatment. In horses, C. difficile was recently suggested as a possible enteric pathogen. The bacterium is associated with acute colitis in mature horses following treatment with antibiotics. C. difficile, and/or its cytotoxin, is also associated with acute colitis in mares when their foals are being treated with erythromycin and rifampicin for Rhodococcus equi pneumonia. The colitis can have resulted from an accidental ingestion of erythromycin by the mares. In an ...
The Journal of parasitologyJanuary 23, 2003
Volume 88, Issue 6 1164-1170 doi: 10.1645/0022-3395(2002)088[1164:EIOEPM]2.0.CO;2
Sofaly CD, Reed SM, Gordon JC, Dubey JP, Ogleebee MJ, Njoku CJ, Grover DL, Saville WJ.The effect of inoculation dose of Sarcocystis neurona sporocysts on the development of clinical neurologic disease in horses was investigated. Twenty-four seronegative weanling horses were subjected to the natural stress of transport and then randomly assigned to 6 treatment groups of 4 horses each. Horses were then immediately inoculated with either 10(2), 10(3), 10(4), 10(5), or 10(6) S. neurona sporocysts or placebo using nasogastric tube and housed indoors. Weekly neurologic examinations were performed by a blinded observer. Blood was collected weekly for antibody determination by Western ...
van der Meulen KM, Nauwynck HJ, Pensaert MB.Equine herpesvirus-1 (EHV-1) may cause abortion in vaccination- and infection-immune horses. EHV-1-infected peripheral blood mononuclear cells (PBMCs) play an important role in virus immune evasion. The mechanisms by which infected PBMCs can avoid destruction by EHV-1-specific antibody and equine complement were examined. The majority of EHV-1-infected PBMCs (68.6 %) lacked surface expression of viral antigens and these cells were not susceptible to complement-mediated lysis. In infected PBMCs with surface expression of viral antigens, 63 % showed focal surface expression, whereas 37 % showed ...
Pitel PH, Lindsay DS, Caure S, Romand S, Pronost S, Gargala G, Mitchell SM, Hary C, Thulliez P, Fortier G, Ballet JJ.Sarcocystis neurona is considered a leading cause of equine protozoal myeloencephalitis (EPM), a common infectious neurological disease in horses in the Americas. EPM-like cases associated with S. neurona peptide reactive antibodies in Western blots were recently described in Normandy, France. In this report, antibodies reacting with S. neurona merozoites were detected using an agglutination assay at titers ranging from 50 to 500 in sera from 18/50 healthy horses from two farms with a previous EPM-like case. Higher values were found in older animals. Four out of six horses which traveled or st...
Monzon CM, Mancebo OA, Russo AM.An ELISA test was used to determine the persistence of antibody levels in horses following treatment for Trypanosoma evansi. In 17 horses with T. evansi from two farms treated and cured with quinapyramine sulphate, ELISA antibody levels fell progressively post-treatment, but remained with positive results for 22.6 months in one horse, 12.8 months in a second, 4.1 months in another four and 2.3 months in three, whilst the rest became negative at 2.3 months. In two horses that suffered a post-treatment infection relapse the decrease in ELISA levels was only temporary, and a new increase in antib...
Brommer H, van Weeren PR, Brama PA.To evaluate a modified digital imaging technique for quantitative assessment of the grade of osteoarthritis across the proximal articular surface of the first phalanx in horses. Methods: 6 metacarpophalangeal (fet-lock) joint specimens from 6 horses with various stages of osteoarthritis. Methods: First phalanx specimens, together with 4 gray scale reference calibration targets, were positioned in a bath with the proximal articular cartilage surface submerged in saline (0.9% NaCl) solution. Digital images were obtained from the articular surface before and after staining with Indian ink. Comput...
Dickinson CE, Lori DN.In the absence of debilitating medical problems, the geriatric horse can maintain a normal body condition when provided with an appropriate diet, adequate shelter, and preventive health care that includes regular dental care and deworming. Failures in management can lead to inadequate nutritional support, exposure to adverse environmental conditions, advanced dental disease, parasitism, and failure to detect developing medical problems. All these circumstances can lead to loss of condition and debilitation in the aged horse. Weight loss in the aged horse should be approached with an understand...
Paradis MR.Owners of older horses have generally owned them for a long time. They have developed a bond that is similar to that seen with companion animals. Their desire to have their animal(s) age gracefully with comfort and mobility has stirred research in the field of equine geriatric medicine. Equine geriatric medicine is to the first decade of the twenty-first century as neonatal medicine was to the 1980s. Hopefully, the demographics discussed in this article highlight area where research can be most helpful.
Davis E, Rush BR.Recurrent airway obstruction is a condition that affects some older horses maintained in confinement. Clinical signs range from exercise intolerance with occasional cough to dyspnea at rest. Bronchoalveolar lavage cytology is characterized by neutrophilic leukocytosis (15%-85%) and is recommended for making the diagnosis in horses with mild to moderate disease. Environmental management combined with periodic bronchodilator and antiinflammatory corticosteroid therapy yields the best prognosis for disease remission.
Botha CJ, Naudé TW.Well-known plant poisonings such as 'dunsiekte' (seneciosis) and 'jaagsiekte' (crotalariosis) of horses in southern Africa are briefly reviewed. Relatively unfamiliar mycotoxicoses such as stachybotryotoxicosis and perennial rye grass staggers and potentially occurring exotic intoxications such as equine nigropallidal encephalomalacia and ergot alkaloid poisoning are also discussed. This article is aimed at informing the southern African equine practitioner about probable poisonings that might occur locally in horses.
Okulewicz A, Lonc E, Borgsteede FH.The biology of the ascarid nematodes has been discussed in the context of their important economic role in farm animals, pet animals and zoo animals with special attention to carnivores and primates. In farm animals, infection with the most common roundworm of horses (Parascaris equorum) and swine (Ascaris suum) depend on many factors such as environmental conditions (larval development in the egg and egg survival), age of the host, breed, husbandry system, hygiene and treatment schedule. The monoxenic ascarids Toxocara canis and T. cati are the most important nematodes in carnivorous animals ...
Donahue JM, Williams NM, Sells SF, Labeda DP.Over the course of the past decade, actinomycetes have been isolated from the placentas of horses diagnosed with nocardioform placentitis. The incidence of this infection has generally been low, with typically no more than 30 animals affected in most years, but the incidence increased through 1999, with placentas from 144 mares found to be infected. Approximately half of the cases result in loss of the foal. A typical actinomycete with branching mycelium was isolated from placental lesions, and a comparison of the sequence of the 16S rDNA gene against the public databases indicated a relations...
Fintl C, Milne EM, McGorum BC.To determine whether urinalysis can aid the diagnosis of equine grass sickness, samples of urine from 15 horses with acute grass sickness, eight horses with subacute grass sickness, 17 co-grazing horses and 17 stabled control horses were analysed. The samples from all of the horses with grass sickness had a significantly higher specific gravity, higher protein and creatinine concentrations and a significantly lower pH; the samples from the horses with acute grass sickness also had significantly higher glucose concentrations. These differences may support a diagnosis of grass sickness but they ...
Allombert J, Vianney A, Laugier C, Petry S, Hébert L.Taylorella equigenitalis is the causative agent of contagious equine metritis, a sexually-transmitted infection of Equidae characterised in infected mares by abundant mucopurulent vaginal discharge and a variable degree of vaginitis, cervicitis or endometritis, usually resulting in temporary infertility. The second species of the Taylorella genus, Taylorella asinigenitalis, is considered non-pathogenic, although mares experimentally infected with this bacterium can develop clinical signs of endometritis. To date, little is understood about the basic molecular virulence and persistence mechanis...
Williamson LH, Farrell RL.A case of intracranial schwannoma is described in a young horse. Clinical signs developed slowly and were suggestive of a lesion involving the left cerebrum. The filly exhibited a change in mentation, and circled to the left. Visual impairment and decreased facial sensation were noted on the right side. A solitary schwannoma which compressed the left cerebrum was found at necropsy.
Güleğen E, Cirak VY.Lice infestations of horses occur mainly during winter months and are characterized by severe pruritus and an unkempt coat. Two lice have been described for equines namely Bovicola (Damalinia) equi and Haemotopinus asini. There is a scarcity of data on the occurrence and prevalence rates of these horse pathogens in Turkey. This paper reports a thoroughbred farm, in which two horses were found to be infested with B. equi. The horses were treated with propoxur and no lice or nymphs could be found after treatment for10 days.
Rivas VN, Aleman M, Peterson JA, Dahlgren AR, Hales EN, Finno CJ.Juvenile idiopathic epilepsy (JIE) is an inherited disease characterized by recurrent seizures during the first year of life in Egyptian Arabian horses. Definitive diagnosis requires an electroencephalogram (EEG) performed by a veterinary specialist. A recent study has suggested that a 19 base-pair deletion, along with a triple-C insertion, in intron five of twelve (∆19InsCCC; chr20:29542397-29542425: GTTCAGGGGACCACATGGCTCTCTATAGA>TATCTTAAGACCC) of the () gene is associated with JIE. To confirm this association, a new sample set consisting of nine EEG-phenotyped affected and nine unaffec...
Enders F, Weber A.Fecal samples of 146 horses were culturally investigated for occurrence of Prototheca spp. using a selective medium, developed by PORE (1973). Prototheca zopfii could be isolated in monoculture from 9 fecal samples (6.2%). The results of this pilot study show that horses too can harbour and shed Prototheca spp. in variable frequency.
Schaudien D, Müller JM, Baumgärtner W.A well-circumscribed mass 70 x 35 x 28 cm in size and 41 kg in weight was detected at necropsy in a male adult horse within the omentum major without any association to the gastrointestinal tract. The tumor consisted of multiple white-to-yellow lobules and displayed a firm consistency. In addition, multiple cysts filled with blood-like fluid, and multifocal areas of necrosis were observed. Histologically, the mass consisted of slightly pleomorphic spindloid-shaped cells arranged in interlacing bundles containing elongated nuclei with blunt ends. The majority of tumor cells revealed a positive ...
Mair TS, Taylor FG, Gibbs C, Lucke VM.THE horse appears to possess a strong innate resistance to
tuberculosis because the disease is infrequently recognised even
in countries where the condition is common in other species
(Luke 1958). Reports of the disease are now scarce and earlier
records of infections in horses usually implicated the bovine
strain of Mycobacterium tuberculosis, although avian and
human strains have been isolated. Of 55 equine cases reviewed
by Griffith (1937), 53 were caused by the bovine strain and two
were independently infected with avian and human strains.
Since the implementation of the bovine tu...
Beard WL, Robertson JT, Leeth B.Congenital frontal sinus cysts were found bilaterally in the frontal sinuses of a one-year-old miniature horse. Diagnosis was based on radiography of the head and cytologic examination of tissue aspirated from the frontal sinuses. The cysts were surgically removed, using a hinged bone flap technique bilaterally over the frontal sinuses.
Green SL.With the continued increase in the number of wildlife rabies cases reported across the United States and Canada, this disease will remain a threat to the horse as the potential for exposure to infected wildlife and other domestic animals is likely to also increase. Because there are no rapid, definitive antemortem diagnostic tests, the tentative diagnosis is based upon the variable and sometimes nonspecific clinical signs. Although the CSF analysis may be helpful in some cases, it may not be abnormal. Nor is collection of the specimen always practical in the field situation. The FAT on neural ...
Fjordbakk CT, Kenney DG, Rodriguez-Palacios A, Keller S, Stalker M.An inflammatory aural polyp was identified in a 1-year-old standardbred filly, which presented with otorrhea and head rubbing. The polyp was removed by traction-avulsion, and the filly showed no subsequent signs of otorrhea. Aural polyps have not been reported in horses, but they are commonly seen in companion animals and humans. Un polype auditif inflammatoire a été identifié chez une pouliche Standardbred d’un an présentée pour otorrhée et frottage de tête. Le polype a été retiré par traction-avulsion et la pouliche n’a pas manifesté de signes subséquents d’otorrhée. Les ...
Paciello O, Passantino G, Costagliola A, Papparella S, Perillo A.Histiocytic diseases in veterinary medicine have been revised in the last few decades, but these are considered relatively rare in horses. This report describes a 9-year-old female horse, Dutch Warmblood, presented for investigation of severe nasal bleeding. A multinodular bilateral mass of 5 cm, reddish to white in color, that invaded and destroyed the surrounding tissues, was observed during a clinical examination of the nostril The morphological features of the tumor cells were represented by cytologically bizarre, highly phagocytic, multinucleated giant cells. These findings, together with...
Koterba AM, Brewer B, Drummond WH.Foal septicemia is a major cause of neonatal morbidity and mortality. In order to improve success rates, earlier diagnosis and treatment are essential. This article stresses methods to prevent and treat infections in the compromised equine neonate.
Cope RB, Camp C, Lohr CV.Despite the well-founded reputation of plants of the genus Taxus as being amongst the most toxic plants for domestic livestock in the US, there are surprisingly few published case reports of yew poisoning in horses. This report documents 2 acute fatalities in horses in the central Willamette Valley, OR associated with the consumption of Taxus sp. The predominant features of the intoxication were peracute death, with no signs of struggling or convulsions, in otherwise fit and well managed adult horses. The most significant gross necropsy findings were limited to pulmonary congestion and hemorrh...
Niilo L, Bainborough AR.Sera from human, cattle, sheep, swine, and horse populations in western Canada were tested for the presence of Clostridium perfringens enterotoxin antibody by the passive hemagglutination (PHA) test, supplemented by an immunodiffusion test and by counterimmunoelectrophoresis. A total of 224 human, 345 cattle, 165 sheep, 620 swine, and 768 horse serum samples were examined. Low-titer reactions in the PHA test were detected in human, cattle, horse, and swine sera, in that order, with no titers demonstrated in sheep. The titers in human sera ranged up to 1:128 and three of these samples were also...