Analyze Diet

Topic:Disease

The study of diseases in horses encompasses a wide range of conditions affecting equine health, including infectious diseases, metabolic disorders, and genetic abnormalities. These diseases can impact various systems within the horse, such as respiratory, gastrointestinal, and musculoskeletal systems, and can lead to significant health challenges. Research in this area focuses on understanding the pathophysiology, diagnosis, prevention, and treatment of equine diseases. Common diseases studied include equine influenza, equine herpesvirus, and laminitis. This page provides access to peer-reviewed research studies and scholarly articles that explore the etiology, clinical presentation, and management strategies of diseases in horses, contributing to the advancement of equine veterinary medicine.
The contribution of domestic animals to the transmission of schistosomiasis japonica in the Lindu Subdistrict of the Central Sulawesi Province, Indonesia.
Veterinary world    October 23, 2019   Volume 12, Issue 10 1591-1598 doi: 10.14202/vetworld.2019.1591-1598
Budiono NG, Satrija F, Ridwan Y, Handharyani E, Murtini S.Schistosomiasis is endemic in Indonesia and is found in three remote areas in Central Sulawesi Province. Non-human mammals serve as reservoir hosts, meaning the disease is zoonotic. The previous schistosomiasis studies in animals from the Lindu Subdistrict did not determine which domestic animal species can serve as the primary source of transmission. No animals have been treated in Indonesia to control the disease; therefore, the parasite's life cycle is not blocked entirely. This study aimed to determine the prevalence and identify the risk factors associated with, infection in animals, and...
Differences in microbiome and virome between cattle and horses in the same farm.
Asian-Australasian journal of animal sciences    October 22, 2019   Volume 33, Issue 6 1042-1055 doi: 10.5713/ajas.19.0267
Park J, Kim EB.The ecosystem of an animal farm is composed of various elements, such as animals, farmers, plants, feed, soil, and microorganisms. A domesticated animal's health is largely connected with the reservoir of bacteria and viruses in animal farms. Although a few studies have focused on exploring the gut microbiome of animals, communities of microbiota and viruses in feedlots have not been thoroughly investigated. Methods: Here, we collected feces and dust samples (4 groups: cattle feces, C_F; horse feces, H_F; cattle dust, C_D; and horse dust, H_D) from cattle and horse farms sharing the same housi...
Cauda equina syndrome in an ovarian malignant-mixed müllerian tumor with leptomeningeal spread.
Clinical case reports    October 22, 2019   Volume 7, Issue 12 2341-2345 doi: 10.1002/ccr3.2472
Bernstock JD, Ostby S, Fox B, Sotoudeh H, Janssen A, Kang YJ, Chen J, Prattipati V, Elsayed G, Chagoya G, Yamashita D, Friedman GK, Nabors B, Huh WK....Leptomeningeal metastasis is extremely rare in patients with ovarian cancer, but should be considered in patients presenting with neurologic deficits such as cauda equine syndrome. Given its poor prognosis and lack of data currently on management, additional studies are needed to optimize treatment regimens and improve outcomes.
Molecular investigation and phylogeny of species of the Anaplasmataceae infecting animals and ticks in Senegal.
Parasites & vectors    October 22, 2019   Volume 12, Issue 1 495 doi: 10.1186/s13071-019-3742-y
Dahmani M, Davoust B, Sambou M, Bassene H, Scandola P, Ameur T, Raoult D, Fenollar F, Mediannikov O.Our study aimed to assess the diversity of the species of Anaplasmataceae in Senegal that infect animals and ticks in three areas: near Keur Momar Sarr (northern region), Dielmo and Diop (Sine Saloum, central region of Senegal), and in Casamance (southern region of Senegal). Methods: A total of 204 ticks and 433 blood samples were collected from ruminants, horses, donkeys and dogs. Ticks were identified morphologically and by molecular characterization targeting the 12S rRNA gene. Molecular characterization of species of Anaplasmataceae infecting Senegalese ticks and animals was conducted usin...
[Ovarian Mixed Tumor in a Mare].
Tierarztliche Praxis. Ausgabe G, Grosstiere/Nutztiere    October 21, 2019   Volume 47, Issue 5 328 doi: 10.1055/a-1004-9889
Pinna AE, Okada CTC, Ferreira CSC et al. Double ovarian tumor in the mare: case report. Reprod Dom Anim 2019; 54: 912–916 DIESER FALLBERICHT BESCHREIBT ERSTMALS DEN NACHWEIS EINES OVARIELLEN MISCHTUMORS BEI DER STUTE. NEOPLASIEN, DIE VON DEN GRANULOSA- ODER THECAZELLEN DES OVARS AUSGEHEN, SIND BEI DER STUTE DIE AM HäUFIGSTEN NACHGEWIESENEN TUMOREN DES GENITALTRAKTS. ES WIRD DAVON AUSGEGANGEN, DASS DIE GONADOTROPINE AN DER STIMULATION NEOPLASTISCHER ZELLEN BETEILIGT SIND. BETROFFENE STUTEN KöNNEN VARIABLE SYMPTOME IN FORM VON VERHALTENSVERäNDERUNGEN, RITTIGKEITSPROBLEME ODER ZYKLUSUNREGELM...
Transendoscopic correction of epiglottic entrapment with a silicone-covered laser guide and diode laser in 29 horses.
Veterinary surgery : VS    October 21, 2019   Volume 49, Issue 1 131-137 doi: 10.1111/vsu.13338
Beste KJ, Ortved KF, Rossignol F, Ducharme NG.To describe the use of a silicone-covered laser guide and diode laser for surgical correction of epiglottic entrapment and report postoperative outcomes in horses with epiglottic entrapment. Methods: Retrospective case series. Methods: Thoroughbred and standardbred racehorses (n = 29) with epiglottic entrapment. Methods: A silicone-covered laser guide was placed endoscopically to direct the diode laser cutting action during transection of the entrapping subepiglottic membrane and to act as a physical barrier between the membrane and the epiglottic cartilage. Postoperative complications and tra...
Longitudinal study of electrical, functional and structural remodelling in an equine model of atrial fibrillation.
BMC cardiovascular disorders    October 21, 2019   Volume 19, Issue 1 228 doi: 10.1186/s12872-019-1210-4
Hesselkilde EZ, Carstensen H, Flethøj M, Fenner M, Kruse DD, Sattler SM, Tfelt-Hansen J, Pehrson S, Braunstein TH, Carlson J, Platonov PG....Large animal models are important in atrial fibrillation (AF) research, as they can be used to study the pathophysiology of AF and new therapeutic approaches. Unlike other animal models, horses spontaneously develop AF and could therefore serve as a bona fide model in AF research. We therefore aimed to study the electrical, functional and structural remodelling caused by chronic AF in a horse model. Nine female horses were included in the study, with six horses tachypaced into self-sustained AF and three that served as a time-matched sham-operated control group. Acceleration in atrial fibrilla...
Equine Rhinitis A Virus Infection in Thoroughbred Racehorses-A Putative Role in Poor Performance?
Viruses    October 18, 2019   Volume 11, Issue 10 doi: 10.3390/v11100963
Back H, Weld J, Walsh C, Cullinane A.The aim of this study was to identify respiratory viruses circulating amongst elite racehorses in a training yard by serological testing of serial samples and to determine their impact on health status and ability to race. A six-month longitudinal study was conducted in 30 Thoroughbred racehorses (21 two-year-olds, five three-year-olds and four four-year-olds) during the Flat racing season. Sera were tested for the presence of antibodies against equine herpesvirus 1 and 4 (EHV-1 and EHV-4) and equine rhinitis viruses A and B (ERAV and ERBV) by complement fixation (CF) and equine arteritis viru...
Fatal Peritoneal Migration of Strongylus edentatus in a Foal.
Journal of comparative pathology    October 18, 2019   Volume 172 88-92 doi: 10.1016/j.jcpa.2019.09.004
Gonzales-Viera O, Fritz H, Mete A.A 7-month-old female mixed breed foal with a 2-day history of recumbency and inability to open its mouth convulsed acutely and died and was submitted for necropsy examination. The foal was thin and large patches of haemorrhage were present throughout the peritoneal wall, the diaphragmatic surfaces and the retroperitoneum. Numerous nematode larvae were visible on the serosal surfaces and penetrated and embedded into the subserosa associated with the haemorrhages. The dorsal portion of the abdominal diaphragm had a partial tear and large numbers of nematodes were within the muscle fibres. Histol...
Characterization of abortion, stillbirth and non-viable foals homozygous for the Warmblood Fragile Foal Syndrome.
Animal reproduction science    October 17, 2019   Volume 211 106202 doi: 10.1016/j.anireprosci.2019.106202
Aurich C, Müller-Herbst S, Reineking W, Müller E, Wohlsein P, Gunreben B, Aurich J.Warmblood fragile foal syndrome (WFFS) is a monogenetic defect with autosomal recessive inheritance. The WFFS homozygosity is non-compatible with extra-uterine life. Although as many as 15% of Warmblood horses are WFFS carriers, there has been little veterinary focus on this condition. The aim of this study was to determine outcomes and symptoms of clinical signs and pathological abnormalities during pregnancies when there were WFFS homozygous foetuses. Diagnostic material of 15 abortion or stillbirth cases with suspected diagnosis of WFFS was available for this study. Additionally, there were...
TRIM39-RPP21 Variants (∆19InsCCC) Are Not Associated with Juvenile Idiopathic Epilepsy in Egyptian Arabian Horses.
Genes    October 16, 2019   Volume 10, Issue 10 816 doi: 10.3390/genes10100816
Rivas VN, Aleman M, Peterson JA, Dahlgren AR, Hales EN, Finno CJ.Juvenile idiopathic epilepsy (JIE) is an inherited disease characterized by recurrent seizures during the first year of life in Egyptian Arabian horses. Definitive diagnosis requires an electroencephalogram (EEG) performed by a veterinary specialist. A recent study has suggested that a 19 base-pair deletion, along with a triple-C insertion, in intron five of twelve (∆19InsCCC; chr20:29542397-29542425: GTTCAGGGGACCACATGGCTCTCTATAGA>TATCTTAAGACCC) of the () gene is associated with JIE. To confirm this association, a new sample set consisting of nine EEG-phenotyped affected and nine unaffec...
Vaccination of foals with a modified live, equid herpesvirus-1 gM deletion mutant (RacHΔgM) confers partial protection against infection.
Vaccine    October 16, 2019   Volume 38, Issue 2 388-398 doi: 10.1016/j.vaccine.2019.09.106
Kydd JH, Hannant D, Robinson RS, Bryant N, Osterrieder N.Equid herpesvirus-1 (EHV-1) causes respiratory and neurological disease and late gestation abortion in pregnant mares. Current vaccines contain either inactivated or live EHV-1, but fail to provide complete clinical or virological protection, namely prevention of nasopharyngeal shedding and cell-associated viraemia. Thus, the development of novel products, such as modified live virus (MLV) vaccines which stimulate virus-specific, humoral and cell mediated immune responses more effectively remains a priority. Two groups of weaned foals (n = 6 each group) were used in a longitudinal, prospec...
Clonal Confinement of a Highly Mobile Resistance Element Driven by Combination Therapy in Rhodococcus equi.
mBio    October 15, 2019   Volume 10, Issue 5 e02260-19 doi: 10.1128/mBio.02260-19
Álvarez-Narváez S, Giguère S, Anastasi E, Hearn J, Scortti M, Vázquez-Boland JA.Antibiotic use has been linked to changes in the population structure of human pathogens and the clonal expansion of multidrug-resistant (MDR) strains among healthcare- and community-acquired infections. Here we present a compelling example in a veterinary pathogen, , the causative agent of a severe pulmonary infection affecting foals worldwide. We show that the (46) gene responsible for emerging macrolide resistance among equine isolates in the United States is part of a 6.9-kb transposable element, Tn, actively mobilized by an IS family transposase. Tn is carried on an 87-kb conjugative pla...
Fungal Placentitis Caused by Aspergillus terreus in a Mare: Case Report.
Journal of equine veterinary science    October 15, 2019   Volume 83 102799 doi: 10.1016/j.jevs.2019.102799
Orellana-Guerrero D, Renaudin C, Edwards L, Rose E, Aleman M, Moore PF, Dujovne G.Placentitis has been reported as the most important cause of equine abortions, stillbirths, and perinatal deaths in horses. Most cases are caused by bacteria and less commonly by fungal elements. The aim of this report is to describe the clinical presentation of a fungal placentitis caused by Aspergillus terrerus. A 5-year-old thoroughbred maiden mare at the 217th day of gestation presented with some classic signs of placentitis (premature udder development and milk dripping). All ultrasonographic findings were consistent with a live fetus and a severe placentitis. On vaginal examination, pur...
Uterine cervix as a fundamental part of the pathogenesis of pregnancy loss associated with ascending placentitis in mares.
Theriogenology    October 14, 2019   Volume 145 167-175 doi: 10.1016/j.theriogenology.2019.10.017
Fernandes CB, Ball BA, Loux SC, Boakari YL, Scoggin KE, El-Sheikh Ali H, Cogliati B, Esteller-Vico A.Anatomical and molecular changes in the cervical barrier in women are a fundamental part of the pathogenesis of pregnancy loss associated with chorioamnionitis. However, there is little information regarding changes in the cervix associated with ascending infection in pregnant mares. To better characterize morphological and molecular changes in the cervix during placentitis, we examined full thickness histology and mRNA expression for a number of inflammatory and endocrine factors in the mucosa and stroma of the cervix of mares (n = 5) after experimental induction of placentitis via transc...
The First Detection of Equine Coronavirus in Adult Horses and Foals in Ireland.
Viruses    October 14, 2019   Volume 11, Issue 10 946 doi: 10.3390/v11100946
Nemoto M, Schofield W, Cullinane A.The objective of this study was to investigate the presence of equine coronavirus (ECoV) in clinical samples submitted to a diagnostic laboratory in Ireland. A total of 424 clinical samples were examined from equids with enteric disease in 24 Irish counties between 2011 and 2015. A real-time reverse transcription polymerase chain reaction was used to detect ECoV RNA. Nucleocapsid, spike and the region from the p4.7 to p12.7 genes of positive samples were sequenced, and sequence and phylogenetic analyses were conducted. Five samples (1.2%) collected in 2011 and 2013 tested positive for ECoV. Po...
Viruses in Horses with Neurologic and Respiratory Diseases.
Viruses    October 14, 2019   Volume 11, Issue 10 942 doi: 10.3390/v11100942
Altan E, Li Y, Sabino-Santos G, Sawaswong V, Barnum S, Pusterla N, Deng X, Delwart E.Metagenomics was used to identify viral sequences in the plasma and CSF (cerobrospinal fluid) of 13 horses with unexplained neurological signs and in the plasma and respiratory swabs of 14 horses with unexplained respiratory signs. Equine hepacivirus and two copiparvoviruses (horse parvovirus-CSF and a novel parvovirus) were detected in plasma from neurological cases. Plasma from horses with respiratory signs contained the same two copiparvoviruses plus equine pegivirus D and respiratory swabs contained equine herpes virus 2 and 5. Based on genetic distances the novel copiparvovirus qualified ...
Preliminary insight into horse owners’ perceptions of, and attitudes towards, exotic diseases in the United Kingdom.
BMC veterinary research    October 12, 2019   Volume 15, Issue 1 338 doi: 10.1186/s12917-019-2120-5
Spence KL, Cardwell JM, Slater J, Rosanowski SM.The potential for an exotic disease incursion is a significant concern for the United Kingdom (UK) equine industry. Horse owners' perceptions of, and attitudes towards, exotic diseases can influence decisions to adopt disease preparedness strategies. The objectives of this study were to describe horse owners' 1) perceptions of the term 'exotic disease', and 2) attitudes towards their risk of being affected by an exotic disease. In order to address these objectives, qualitative content analysis was undertaken on data collected using two open-ended survey questions. Results: Horse owners (n =...
Co-resistance to Amoxicillin and Tetracycline as an Indicator of Multidrug Resistance in Escherichia coli Isolates From Animals.
Frontiers in microbiology    October 9, 2019   Volume 10 2288 doi: 10.3389/fmicb.2019.02288
Bourély C, Cazeau G, Jarrige N, Jouy E, Haenni M, Lupo A, Madec JY, Leblond A, Gay E.To examine the relevance of co-resistance to amoxicillin and tetracycline as an indicator of multidrug resistance (MDR) in animal health. Methods: isolates collected between 2012 and 2016 by the French surveillance network for antimicrobial resistance in diseased animals (RESAPATH) were analyzed. The proportions of MDR isolates and the proportions of isolates presenting co-resistance to amoxicillin and tetracycline were calculated for seven animal species (cattle, horse, dog, swine, poultry, duck, and turkey). The degree of agreement between these two proportions was estimated by calculating ...
Clinical insights: Antimicrobials in an age of resistance.
Equine veterinary journal    October 5, 2019   Volume 51, Issue 6 711-713 doi: 10.1111/evj.13151
Mercer MA, Davis JL.No abstract available
Warmblood fragile foal syndrome type 1 mutation (PLOD1 c.2032G>A) is not associated with catastrophic breakdown and has a low allele frequency in the Thoroughbred breed.
Equine veterinary journal    October 4, 2019   Volume 52, Issue 3 411-414 doi: 10.1111/evj.13182
Bellone RR, Ocampo NR, Hughes SS, Le V, Arthur R, Finno CJ, Penedo MCT.Catastrophic fractures are among the most common cause of fatalities in racehorses. Several factors, including genetics, likely contribute to increased risk for fatal injuries. A variant in the procollagen-lysine, 2-oxoglutarate 5-dioxygenase1 gene (PLOD1 c.2032G>A) was shown to cause Warmblood fragile foal syndrome type 1 (WFFS), a fatal recessive defect of the connective tissue. Screening of multiple horse breeds identified the presence of the WFFS allele in the Thoroughbred. PLOD1 is involved in cross-linking of collagen fibrils and thus could potentially increase the risk of catastrophic b...
Donkey Nutrition and Malnutrition.
The Veterinary clinics of North America. Equine practice    October 3, 2019   Volume 35, Issue 3 469-479 doi: 10.1016/j.cveq.2019.08.004
Burden FA, Bell N.The domestic donkey is a unique equid species with specific nutritional requirements. This article examines the importance of feeding strategies that mimic the donkey's natural environment using poor nutritional quality fibers and access to browsing materials. The relationship between nutrition and health is examined and practical approaches to the healthy and sick donkey are discussed.
Gastrointestinal Disorders of Donkeys and Mules.
The Veterinary clinics of North America. Equine practice    October 3, 2019   Volume 35, Issue 3 419-432 doi: 10.1016/j.cveq.2019.08.001
Thiemann AK, Sullivan RJE.A review of common gastrointestinal disorders of donkeys and mules is presented. Clinically relevant aspects of donkey behavior, anatomy, and physiology are highlighted. Diagnosis, management, and treatment of conditions affecting the gastrointestinal tract from stomach to rectum, including liver and pancreas, are discussed.
Evaluation of serological responses in horses challenged with Burkholderia pseudomallei using current diagnostic tests for glanders.
Veterinaria italiana    September 30, 2019   Volume 55, Issue 3 261-267 doi: 10.12834/VetIt.1701.9026.2
Wernery U, Rodriguez Caveney M, Wernery R, Raghavan R, Laroucau K, Syriac G, Thomas SM, John J, Joseph M, Jose S, Joseph S, Woo P.Six horses were challenged experimentally with a strain of Burkholderia pseudomallei isolated from a fatal case of the infection in a dromedary camel years earlier in the Emirate of Dubai. Three horses were inoculated subcutaneously and in 3 the bacterium was administered by the oral route. Four of the horses became serologically positive based on reactions to one or more of the OIE described tests for glanders. B. pseudomallei was re-isolated from the 4 serological positive horses. Only one of the subcutaneously infected horses, developed fever for 3 days. The white blood cell values and the ...
Letter to the Editor: Response to letter regarding: Prospective, randomised clinical trial of four different presurgical hand antiseptic techniques in equine surgery.
Equine veterinary journal    September 25, 2019   Volume 52, Issue 1 158-159 doi: 10.1111/evj.13167
Biermann NM, McClure JT, Doyle AJ.No abstract available
West Nile Virus: Veterinary Health and Vaccine Development.
Journal of medical entomology    September 25, 2019   Volume 56, Issue 6 1463-1466 doi: 10.1093/jme/tjz125
Bosco-Lauth AM, Bowen RA.West Nile virus (WNV) (Flaviviridae: Flavivirus) was discovered in Africa more than 80 yr ago and became recognized as an avian pathogen and a cause of neurologic disease in horses largely during periodic incursions into Europe. Introduction of WNV into North America stimulated great anxiety, particularly in the equine industry, but also for pet owners and livestock producers concerned about the effect of WNV on other domestic animals. Numerous subsequent studies of naturally occurring and experimentally induced disease greatly expanded our understanding of the host range and clinical conseque...
Letter to the Editor: Is it time to replace the term ‘endometrosis’?
Equine veterinary journal    September 23, 2019   Volume 52, Issue 1 160 doi: 10.1111/evj.13172
Khan FA, Chenier TS.No abstract available
Clinical, ultrasonographic, and histopathologic findings in seven horses with Descemet’s membrane detachment: A case series.
Veterinary ophthalmology    September 22, 2019   Volume 23, Issue 1 181-189 doi: 10.1111/vop.12710
Slenter IJM, Hermans H, Ensink JM, Willems DS, Veraa S, Grinwis GCM, Boevé MH.To describe ultrasonography as a diagnostic method of in vivo Descemet's membrane detachment (DMD) in horses. Methods: Seven horses (three Icelandic horses, two Dutch Warmblood horses, one Appaloosa, and one Welsh Pony), presenting with moderate-to-severe focal or diffuse corneal edema, in whom DMD was suspected on ultrasonographic examination and confirmed with histopathology, were studied. Methods: A retrospective analysis of case records of horses with suspected DMD was performed. Results: Median age at presentation was 14 years (range 11-24). Clinical signs in eyes with DMD were unilatera...
A case study of vertebral fusion in a 19th-century horse from Serbia.
International journal of paleopathology    September 21, 2019   Volume 27 17-23 doi: 10.1016/j.ijpp.2019.07.007
To evaluate the etiology of skeletal changes noted in equid vertebrae from a 19- century context near Belgrade, Serbia. A vertebral column consisting of 15 fused thoracic vertebrae (T2-T16), with right ribs fused to T4 and T5 and small remnants of ribs articulating with T4, T5 and T6 on the left side were accidentally recovered during industrial exploitation of sand. The specimen was subjected to morphological analysis and collagen fingerprinting by mass spectrometry for species identification. In order to determine the absolute temporal context, radiocarbon dating was employed. Pathological c...
Ultrasonographic visualisation of the mesenteric vasculature in horses with large colon colic.
The Veterinary record    September 20, 2019   Volume 186, Issue 15 491 doi: 10.1136/vr.105468
Manso-Díaz G, Bolt DM, López-Sanromán J.Ultrasonographic visualisation of the mesenteric vasculature of the large colon (LC) from the right side of the abdomen in cases of displacement and volvulus has been described. However, the LC can move freely within the abdomen and its mesentery can potentially contact both sides of the abdominal wall. Methods: Thirty-four horses presented with LC-related colic that had visible LC mesenteric vasculature visible on abdominal ultrasound were included. A control group was made including horses with confirmed small intestinal-related colic. The objective of this study was to evaluate the visibili...
1 64 65 66 67 68 484