Equine diseases encompass a wide range of health conditions that can affect horses, including infectious diseases, metabolic disorders, and genetic conditions. These diseases can impact the overall health, performance, and well-being of horses. Common equine diseases include equine influenza, equine herpesvirus, laminitis, and equine metabolic syndrome. Diagnosis and management of these diseases often require a combination of clinical evaluation, laboratory testing, and appropriate treatment strategies. This page gathers peer-reviewed research studies and scholarly articles that explore the etiology, pathophysiology, diagnosis, and treatment options for various equine diseases, providing valuable insights for veterinarians and researchers in the field.
Galinelli N, Wambacq W, Broeckx BJG, Hesta M.Equine gastric ulcer syndrome (EGUS) is a pathological condition affecting the glandular and squamous regions of the stomach. It is characterized by non-specific clinical signs, behavioural changes or can also be found without any overt clinical manifestations. Nutritional factors such as intermittent feeding, high sugars and starch intake, large amounts of straw as forage and prolonged time without access to forage have all been associated with an increased risk of equine squamous gastric disease (ESGD). The aim of this study was to investigate which nutritional practices are commonly seen in...
Lewis N, Schnauffer K, Hinrichs K, Morganti M, Troup S, Argo C.The use of time-lapse imaging (TLI) in the evaluation of morphokinetics associated with invitro developmental competence is well described for human, cattle and pig embryos. It is generally accepted that embryos that complete early cleavage sooner are more likely to form blastocysts and that timing of later events, such as blastocyst formation and expansion, are predictive of implantation potential and euploid status. In the horse, morphokinetics as a predictor of developmental competence has received little attention. In this study we evaluated the morphokinetics of early equine embryo develo...
Frank BL, Doddman CD, Stokes JE, Carnevale EM.In this retrospective study the morphological characteristics of oocytes and cleavage stage embryos were associated with pregnancy results from clinical intracytoplasmic sperm injection (ICSI) in mares. Oocytes were collected from preovulatory follicles, and images (×200; n=401) were captured for measurements of ooplasm, the perivitelline space and zona pellucida. After ICSI and before transfer into recipients' oviducts, cleavage stage embryos were imaged (n=178). Oocyte donor ages (3-13, 14-19, 20-23, 24-27 years) were compared, as were mares aged 3-13 years without versus with recent histor...
Arnhold S, Elashry MI, Klymiuk MC, Geburek F.Adipose tissue-derived mesenchymal stem cells (ASCs) offer a promising cell source for therapeutic applications in musculoskeletal disorders. The appropriate selection of ASCs from various fat depots for cell-based therapy is challenging. The present study aims to compare stemness and multipotency of ASCs derived from retroperitoneal (RP), subcutaneous (SC), and lipoma (LP) fat to assess their usefulness for clinical application. Equine ASCs from the three fat tissue sources were isolated and characterized. The cell viability, proliferation, and self-renewal were evaluated using MTT, sulforhod...
Easton-Jones C, Woolard K, Mohr FC, Roy MA, Aleman M.Intracranial neoplasia in horses is rare compared to other species. Detailed information such as neurological, electroencephalographic, and histopathological examination of horses with intracranial neoplasia associated with seizures is scarce in the literature. Furthermore, ganglioglioma has not been reported in the horse. A 7-year-old Quarter horse cross Paint gelding was examined due to recurrent seizure-like episodes of 1-year duration. The seizures had been increasing in frequency and length, occurring up to 20 times a day at the time of presentation. Neurological examination revealed inte...
Gehlen H, Loschelder J, Walther M.Euthanasia represents a procedure with high responsibility for veterinarians in equine practice. The procedure should avoid pain and suffering for the horse and be carried out with the least possible stress for the patient and its owner. The presented study investigated the emotional impact of a horse's euthanasia procedure on the owner in order to enable development of future recommendations in improving the management of this procedure in horses. Methods: Questionnaires concerning euthanasia of a horse for horse owners and veterinarians, respectively were developed and sent by mail or publis...
Sievert M, Krohn J, Wehrend A.Due to the special structure of the equine placenta, foals depend on an adequate intake of high-quality colostrum post natum in order to ensure the development of passive immunity. The quality of the colostrum is determined, among other things, by the IgG content. This may be evaluated in the colostrum by direct and indirect methods (density and refractive index). The density of the colostrum is measured by a colostrometer and should amount to at least 1060 g/l. Refractometry is suitable for assessing the relative density or refractive index. Good equine colostrum has a Brix value of at leas...
Kellon EM, Gustafson KM.Hyperinsulinemia associated with equine metabolic syndrome and pituitary pars intermedia dysfunction is a risk factor for laminitis. Research in other species has shown elevated body iron levels as both a predictor and consequence of insulin resistance. In humans, this is known as dysmetabolic hyperferritinemia. To explore the relationship between equine hyperinsulinemia and body iron levels. We reviewed case histories and laboratory results from an open access database maintained by the Equine Cushing's and Insulin Resistance Group Inc. (ECIR). We identified 33 horses with confirmed hyperinsu...
Consuegra C, Crespo F, Dorado J, Diaz-Jimenez M, Pereira B, Hidalgo M.Lipids and proteins can be used for sperm vitrification to preserve the integrity of sperm membranes or to increase the viscosity of the medium. This study evaluated the effect of low-density lipoproteins (LDL) and milk serum proteins (Pronexcell) for stallion sperm vitrification. Hippex extender (Barex Biochemical Products, The Netherlands), plus 1% of bovine serum albumin and 100Â mM of trehalose, was used as control for sperm vitrification. In experiment 1, different concentrations of LDL (L1Â =Â 0.25, L2Â =Â 0.5, L3Â =Â 1%) and in experiment 2 of Pronexcell (P1Â =Â 1, P2Â =Â 5, P3Â =Â 10%)...
Tanaka J, Leeb T, Rushton J, Famula TR, Mack M, Jagannathan V, Flury C, Bachmann I, Eberth J, McDonnell SM, Penedo MCT, Bellone RR.Mushroom is a unique coat color phenotype in Shetland Ponies characterized by the dilution of the chestnut coat color to a sepia tone and is hypothesized to be a recessive trait. A genome wide association study (GWAS), utilizing the Affymetrix 670K array (MNEc670k) and a single locus mixed linear model analysis (EMMAX), identified a locus on ECA7 for further investigation ( = 2.08 × 10). This locus contained a 3 Mb run of homozygosity in the 12 mushroom ponies tested. Analysis of high throughput Illumina sequencing data from one mushroom Shetland pony compared to 87 genomes from horses of var...
Marycz K, Szłapka-Kosarzewska J, Geburek F, Kornicka-Garbowska K.Equine metabolic syndrome (EMS) is characterized by adiposity, insulin dysregulation and increased risk for laminitis. Increased levels of specific liver enzymes in the peripheral blood are typical findings in horses diagnosed with EMS. Current management of EMS is based on caloric restriction and increased physical activity. However, new potential treatment options are arising such as the transplantation of autologous adipose stem cells (ASC). However, cytophysiological properties of ASC derived from EMS horses are impaired which strongly limits their therapeutic potential. We hypothesized, t...
Girardi FM, da Fonseca LA, Ribeiro Filho JD, Souto PC, Ferreira DAC, Dornelas LRSM, Bento LD, de Carvalho Filho WP.Obesity in human and veterinary medicine is one of the most complex challenges within emerging diseases in the context of health. The problem of obesity in horses results in severe comorbidities; therefore, acute-phase proteins should be investigated for fluctuations increasing or decreasing by at least 25% in response to inflammation; these are candidates for future biomarkers and might provide new perspectives on early diagnosis and prognosis. Serum samples were analyzed in nine healthy animals (C) and nine obese animals (O). The proteins were separated by sodium dodecyl sulfate-polyacrylami...
Meister TL, Tegtmeyer B, Brüggemann Y, Sieme H, Feige K, Todt D, Stang A, Cavalleri JV, Steinmann E.An equine parvovirus-hepatitis (EqPV-H) has been recently identified in association with equine serum hepatitis, also known as Theiler's disease. The disease was first described by Arnold Theiler in 1918 and is often observed with parenteral use of blood products in equines. However, natural ways of viral circulation and potential risk factors for transmission still remain unknown. In this study, we investigated the occurrence of EqPV-H infections in Thoroughbred horses in northern and western Germany and aimed to identify potential risk factors associated with viral infections. A total of 392...
Padalino B, Rosanowski SM, Di Bella C, Lacinio R, Rubino GTR.This study aimed to document the prevalence of chronic equine piroplasmosis (EP) in poorly performing Standardbred racehorses and to explore associations between the disease and sex, age, and hematological parameters. Blood was collected between 2004 and 2018; blood cell counts were performed using a cell counter analyzer, biochemical parameters using a photometer, and serum proteins using agarose gel electrophoresis. Blood smears were prepared, colored with a modified Giemsa, and an experienced technician identified the presence of protozoa. The horses were categorized into piroplasmosis posi...
Aurich C, Müller-Herbst S, Reineking W, Müller E, Wohlsein P, Gunreben B, Aurich J.Warmblood fragile foal syndrome (WFFS) is a monogenetic defect with autosomal recessive inheritance. The WFFS homozygosity is non-compatible with extra-uterine life. Although as many as 15% of Warmblood horses are WFFS carriers, there has been little veterinary focus on this condition. The aim of this study was to determine outcomes and symptoms of clinical signs and pathological abnormalities during pregnancies when there were WFFS homozygous foetuses. Diagnostic material of 15 abortion or stillbirth cases with suspected diagnosis of WFFS was available for this study. Additionally, there were...
Rivas VN, Aleman M, Peterson JA, Dahlgren AR, Hales EN, Finno CJ.Juvenile idiopathic epilepsy (JIE) is an inherited disease characterized by recurrent seizures during the first year of life in Egyptian Arabian horses. Definitive diagnosis requires an electroencephalogram (EEG) performed by a veterinary specialist. A recent study has suggested that a 19 base-pair deletion, along with a triple-C insertion, in intron five of twelve (∆19InsCCC; chr20:29542397-29542425: GTTCAGGGGACCACATGGCTCTCTATAGA>TATCTTAAGACCC) of the () gene is associated with JIE. To confirm this association, a new sample set consisting of nine EEG-phenotyped affected and nine unaffec...
Kydd JH, Hannant D, Robinson RS, Bryant N, Osterrieder N.Equid herpesvirus-1 (EHV-1) causes respiratory and neurological disease and late gestation abortion in pregnant mares. Current vaccines contain either inactivated or live EHV-1, but fail to provide complete clinical or virological protection, namely prevention of nasopharyngeal shedding and cell-associated viraemia. Thus, the development of novel products, such as modified live virus (MLV) vaccines which stimulate virus-specific, humoral and cell mediated immune responses more effectively remains a priority. Two groups of weaned foals (n = 6 each group) were used in a longitudinal, prospec...
Fitzgerald DM, Pollitt CC, Walsh DM, Sillence MN, de Laat MA.The oral glucose test (OGT) is a useful tool for diagnosing insulin dysregulation (ID) and is somewhat repeatable in ponies under consistent management. This study aimed to determine whether the insulin and incretin responses to an OGT in ponies differed after short-term access to fertilised pasture, compared to unfertilised pasture, by using a randomised, repeated measures study design. Sixteen mixed-breed ponies were classified as severely insulin-dysregulated (SD; post-prandial insulin ≥80 μIU/mL) or not severely insulin-dysregulated (NSD; post-prandial insulin < 80 μIU/mL) using an O...
Thompson RE, Johnson AK, Prado TM, Premanandan C, Brown ME, Whitlock BK, Pukazhenthi BS.Availability of viable frozen-thawed endometrial tissues could facilitate detailed studies into physiologic and disease processes influencing the endometrium. This study was designed to investigate the cryosurvival of equine endometrial tissue. Previous studies in the human and horse have focused on cryopreservation of dissociated endometrial cells. To our knowledge, there are no studies on cryopreservation of endometrial explants. Our objectives were to 1) determine the influence of differing concentrations of the permeating cryoprotectant dimethyl sulfoxide (MeSO) on viability, structural in...
Nemoto M, Schofield W, Cullinane A.The objective of this study was to investigate the presence of equine coronavirus (ECoV) in clinical samples submitted to a diagnostic laboratory in Ireland. A total of 424 clinical samples were examined from equids with enteric disease in 24 Irish counties between 2011 and 2015. A real-time reverse transcription polymerase chain reaction was used to detect ECoV RNA. Nucleocapsid, spike and the region from the p4.7 to p12.7 genes of positive samples were sequenced, and sequence and phylogenetic analyses were conducted. Five samples (1.2%) collected in 2011 and 2013 tested positive for ECoV. Po...
Altan E, Li Y, Sabino-Santos G, Sawaswong V, Barnum S, Pusterla N, Deng X, Delwart E.Metagenomics was used to identify viral sequences in the plasma and CSF (cerobrospinal fluid) of 13 horses with unexplained neurological signs and in the plasma and respiratory swabs of 14 horses with unexplained respiratory signs. Equine hepacivirus and two copiparvoviruses (horse parvovirus-CSF and a novel parvovirus) were detected in plasma from neurological cases. Plasma from horses with respiratory signs contained the same two copiparvoviruses plus equine pegivirus D and respiratory swabs contained equine herpes virus 2 and 5. Based on genetic distances the novel copiparvovirus qualified ...
Gozalo-Marcilla M, Luna SPL, Gasthuys F, Schauvliege S.To perform a literature review of the thermal and mechanical antinociceptive devices used in pharmacological studies in standing horses published after 2011 (2012-2019). To complete a full literature review about electrical stimulation used for evaluation in similar studies. Methods: PubMed, Google Scholar and Web of Science. Conclusions: A high level of standardization has been reached in antinociceptive studies in standing horses using thermal and mechanical stimuli in most recent years. Commercially available testing devices to deliver thermal, mechanical and electrical stimuli, with observ...
Spence KL, Cardwell JM, Slater J, Rosanowski SM.The potential for an exotic disease incursion is a significant concern for the United Kingdom (UK) equine industry. Horse owners' perceptions of, and attitudes towards, exotic diseases can influence decisions to adopt disease preparedness strategies. The objectives of this study were to describe horse owners' 1) perceptions of the term 'exotic disease', and 2) attitudes towards their risk of being affected by an exotic disease. In order to address these objectives, qualitative content analysis was undertaken on data collected using two open-ended survey questions. Results: Horse owners (n =â€...
Blanco-Lobo P, Rodriguez L, Reedy S, Oladunni FS, Nogales A, Murcia PR, Chambers TM, Martinez-Sobrido L.Vaccination remains the most effective approach for preventing and controlling equine influenza virus (EIV) in horses. However, the ongoing evolution of EIV has increased the genetic and antigenic differences between currently available vaccines and circulating strains, resulting in suboptimal vaccine efficacy. As recommended by the World Organization for Animal Health (OIE), the inclusion of representative strains from clade 1 and clade 2 Florida sublineages of EIV in vaccines may maximize the protection against presently circulating viral strains. In this study, we used reverse genetics tech...
Sheats MK, Davis KU, Poole JA.Farmers are routinely exposed to organic dusts and aeroallergens that can have adverse respiratory health effects including asthma. Horses are farm-reared large animals with similar exposures and can develop equine asthma syndrome (EAS). This review aims to compare the etiology, pathophysiology, and immunology of asthma in horses compared to farmers and highlights the horse as a potential translational animal model for organic dust-induced asthma in humans. Severe EAS shares many clinical and pathological features with various phenotypes of human asthma including allergic, non-allergic, late o...
Rahmani V, Häyrinen L, Kareinen I, Ruohoniemi M.The progression of equine odontoclastic tooth resorption and hypercementosis (EOTRH) has not been completely evaluated, and currently, the only effective treatment is extraction of severely affected teeth. We aim to describe how the disease relates to the history and clinical findings and to report on the outcome in individual horses. This case series comprises data collected from 20 horses (age 14-29 years old) with radiographic findings of EOTRH in their incisor and/or canine teeth. Most horses affected with EOTRH in this study were admitted for dental problems, but some for other complaints...
Rota A, Calicchio E, Nardoni S, Fratini F, Ebani VV, Sgorbini M, Panzani D, Camillo F, Mancianti F.A saprophytic bacterial flora is present on the penis and the distal part of the urethra of stallions. Little is known about the fungal flora of their reproductive tract. As micro organisms play an important role in mares fertility, the aim of the study was to describe the distribution of fungi and bacteria in the normal genital apparatus of stallions. The microbic flora of the reproductive tract of 11 healthy, fertile stallions was evaluated, collecting samples from 5 different locations: urethral fossa, penis/internal lamina of the prepuce, urethra pre- and post-ejaculation, and semen. For f...
There are several bioengineering solutions aimed at improving human health and welfare. Smart electrodes based on textile substrates have met the growing demand for comfort, reliability, and robustness when acquiring physiological signals. Objective: Given the importance of good quality electrocardiograms (ECG) in equine sports medicine, this study focuses on the validation of smart textile electrodes to acquire ECG signals in horses during treadmill exercise. Methods: The performance of the smart textile electrodes is compared with standard silver/silver chloride (Ag/AgCl) electrodes in terms...
Madigan JE, Haggettt EF, Pickles KJ, Conley A, Stanley S, Moeller B, Toth B, Aleman M.Increased plasma progestagen concentrations have been reported in foals with neonatal maladjustment syndrome (NMS). These steroids may cross the blood-brain barrier and have dampening effects in the central nervous system. Objective: To evaluate if the infusion of a progesterone derivative (allopregnanolone) in a healthy neonatal foal would induce clinical signs compatible with NMS. Methods: A healthy neonatal foal from a healthy mare with a normal gestation (length, no complications), birth and placenta was infused with allopregnanolone to observe its neurobehavioural effects. Heparinised blo...
Pusterla N, Barnum S, Lawton K, Wademan C, Corbin R, Hodzic E.Contemporary data on equine herpesvirus-1 (EHV-1) genotype (non-neuropathogenic or N, neuropathogenic or D and new variant or H) in clinically diseased equids is important in order to determine the frequency of these genotypes and their association with disease expression. A total of 297 EHV-1 qPCR-positive swabs collected from 2019 to 2022 from horses with respiratory disease (EHV-1), neurological disease (equine herpesvirus-1 myeloencephalopathy [EHM]) and abortion were tested for the three different EHV-1 genotypes (N, D and H) using qPCR allelic discrimination assays. All submissions origi...
Kooijman LJ, Mapes SM, Pusterla N.Equine coronavirus (EqCoV) infection has been documented in most reports through quantitative qPCR analysis of feces and viral genome sequencing. Although qPCR is used to detect antigen during the acute disease phase, there is no equine-specific antibody test available to study EqCoV seroprevalence in various horse populations. We developed an enzyme-linked immunosorbent assay (ELISA) targeting antibodies to the spike (S) protein of EqCoV and validated its use, using acute and convalescent sera from 83 adult horses involved in 6 outbreaks. The EqCoV S protein-based ELISA was able to reliably d...
Ortved KF, Nixon AJ.Damage to the articular cartilage surface is common in the equine athlete and, due to the poor intrinsic healing capabilities of cartilage, can lead to osteoarthritis (OA). Joint disease and OA are the leading cause of retirement in equine athletes and currently there are no effective treatments to stop the progression of OA. Several different cell-based strategies have been investigated to bolster the weak regenerative response of chondrocytes. Such techniques aim to restore the articular surface and prevent further joint degradation. Cell-based cartilage repair strategies include enhancement...
Equine infectious anemia (EIA) is a viral disease, caused by the Equine Infectious Anemia virus (EIAV) belonging to the Retroviridae family, genus Lentivirus. Horses (or equids) infected with EIAV are lifelong carriers and they remain contagious for other horses even in the absence of clinical signs. So far, EIAV infection has been reported among horses in North and South America, France, Germany, Italy, Hungary and Romania, with no publication regarding the presence of EIAV in horses in Serbia. To determine the circulation of EIAV among, approximately, the 5000 horses of the Vojvodina region,...
Byron CR, DeWitt MR, Latouche EL, Davalos RV, Robertson JL.Irreversible electroporation is a proven ablation modality for local ablation of soft tissue tumors in animals and humans. However, the strong muscle contractions associated with the electrical impulses (duration, 50-100 μs) requires the use of general anesthesia and, in most situations, application of neuromuscular blockade. As such, this technology is not used in an outpatient setting for ablating common cutaneous tumors (e.g., squamous cell carcinoma or melanoma) in humans or animals. Recently, high-frequency irreversible electroporation (H-FIRE) technology has been developed to enable ele...
Butcher MT, Chase PB, Hermanson JW, Clark AN, Brunet NM, Bertram JE.Equine digital flexor muscles have independent tendons but a nearly identical mechanical relationship to the main joint they act upon. Yet these muscles have remarkable diversity in architecture, ranging from long, unipennate fibers ("short" compartment of DDF) to very short, multipennate fibers (SDF). To investigate the functional relevance of the form of the digital flexor muscles, fiber contractile properties were analyzed in the context of architecture differences and in vivo function during locomotion. Myosin heavy chain (MHC) isoform fiber type was studied, and in vitro motility assays w...
Daly JM, Sindle T, Tearle J, Barquero N, Newton JR, Corning S.Surveillance of equine influenza viruses has suggested that strains included in currently licensed vaccines are a poor match for those predominantly circulating in the field. Objective: To assess the ability of Duvaxyn IE-T Plus to provide cross protection against the newly evolved South Africa/4/03 (H3N8) strain of equine influenza virus. Methods: The vaccine efficacy was evaluated by challenge infection with influenza strain A/eq/South Africa/4/03 (H3N8) 2 weeks after a primary course of 2 vaccinations with Duvaxyn IE-T Plus given at a 4-week interval. The outcome of challenge in vaccinated ...
Muylle S, Simoens P, Lauwers H.In the present study the age-related morphological characteristics of 948 equine incisors were investigated. After extraction, total incisival length and root length were measured at the vestibular side of the teeth. Equine incisors reach their maximal length 2-3 years after eruption. Notwithstanding severe occlusal wear, this maximal length is maintained during most of the horses' life due to prolonged root formation. Root formation, at the rate of 2.5 mm per year, starts at the age of 5-6 years and continues until the age of 17. As the root of the incisor develops, its apical foramen narrows...
Finlay M, Yuan Z, Morgan IM, Campo MS, Nasir L.Bovine papillomavirus type 1 infects not only cattle but also equids and is a causative factor in the pathogenesis of commonly occurring equine sarcoid tumours. Whilst treatment of sarcoids is notoriously difficult, cisplatin has been shown to be one of the most effective treatment strategies for sarcoids. In this study we show that in equine fibroblasts, BPV-1 sensitises cells to cisplatin-induced and UVB-induced apoptosis, a known cofactor for papillomavirus associated disease, however BPV-1 transformed fibroblasts show increased clonogenic survival, which may potentially limit the therapeut...
Wach-Gygax L, Burger D, Malama E, Bollwein H, Fleisch A, Jeannerat E, Thomas S, Schuler G, Janett F.In this study annual fluctuations of DNA fragmentation and quality of cold-stored equine sperm were evaluated. Ejaculates were collected weekly during one year from 15 stallions. Ejaculate volume, sperm concentration and total sperm count were determined and semen was then extended and cold-stored for 48Â h. Sperm motility was evaluated by CASA before and after 24 as well as 48Â h of cold storage. In addition, the percentages of sperm with intact plasma membrane and acrosome (PMAI %) and with low intracellular Ca2+ level were determined in cold-stored semen (24Â h, 48Â h). SCSAâ„¢ was performe...
Two closed horse herds (Old Lot 4 and Field 24), infected since 1966 with Population B small strongyles resistant to thiabendazole (TBZ) and phenothiazine (PTZ), were terminated in February, March, and May, 2005. At necropsy, only the large endoparasites were identified and counted. The number of horses on pasture was 14 (239 days of age to 23 years old) for Old Lot 4 and two (3 to 20 years old) for Field 24. The time of the last antiparasitic treatment, relative to the year (2005) of necropsy, was 26 years for Old Lot 4 and 9 years for Field 24 horses. Gasterophilus intestinalis third instars...
Söderlund R, Bölske G, Holst BS, Aspán A.Infection by Mycoplasma felis is associated with ocular and respiratory disease in cats and respiratory disease in horses. A correct diagnosis is beneficial since the use of specific antimycoplasmal treatment can lead to resolution. The objective of the present study was to develop a real-time polymerase chain reaction (PCR) method based on dual-labeled fluorogenic probe technology, targeting the gene encoding elongation factor Tu (tuf ), for the fast and specific detection of M. felis. Specificity was achieved by basing the assay design on partial sequencing of the tuf gene in strains and cli...
Velloso Alvarez A, Boone LH, Braim AP, Taintor JS, Caldwell F, Wright JC, Wooldridge AA.There are several non-steroidal intra-articular therapeutics (NSIATs) available for use by equine practitioners for the treatment of performance-limiting joint-related pathology. Information is limited on perceived clinical efficacy, recommended treatment protocols, and associated complications. Our objective with this cross-sectional survey was to investigate the current clinical usage of NSIATs by equine practitioners. An electronic cross-sectional convenience survey inquiring about the use of steroidal and NSIATS (platelet-rich plasma, autologous conditioned serum, autologous protein soluti...
Verdon M, Lanz S, Rhyner C, Gerber V, Marti E.Genetic, epidemiologic, and clinical evidence suggests that, in horses, there are manifestations of hypersensitivity that can occur together. Objective: To investigate whether concurrent insect bite hypersensitivity (IBH) and severe equine asthma (EA) is associated with higher allergen-specific and total serum immunoglobulin E (IgE) concentrations than only EA or IBH. Methods: Healthy control horses (C, n = 40), horses with IBH (IBH, n = 24), severe EA (EA, n = 18), and both conditions (IBH/EA, n = 23) were included. Methods: In our retrospective comparative study, sera from ho...
Franciolli AL, Cordeiro BM, da Fonseca ET, Rodrigues MN, Sarmento CA, Ambrosio CE, de Carvalho AF, Miglino MA, Silva LA.In spite of numerous, substantial advances in equine reproduction, many stages of embryonic and fetal morphological development are poorly understood, with no apparent single source of comprehensive information. Hence, the objective of the present study was to provide a complete macroscopic and microscopic description of the equine embryo/fetus at various gestational ages. Thirty-four embryos/fetuses were aged based on their crown rump length (CRL), and submitted to macroscopic description, biometry, light and scanning microscopy, as well as the alizarin technique. All observed developmental c...
Kainzbauer C, Rushton J, Tober R, Scase T, Nell B, Sykora S, Brandt S.In January 2010, 18 months after excision of an ocular squamous cell carcinoma (SCC), a Connemara mare presented with anorexia and periorbital/parotideal lesions. Post mortem examination revealed these lesions as forming one entity, with 2 additional growths in the retropharyngeal region and the left jugular groove, respectively. The lesions were confirmed histopathologically as SCCs. Using PCR, peripheral blood mononuclear cells (PBMCs) from 2008 and 2010, tumour tissue, intact skin and vulval mucosa were screened for Equus caballus papillomavirus type 2 (EcPV-2) and bovine papillomavirus typ...
Ricci G, Del Boccio G, Pennelli A, Aceto A, Whitehead EP, Federici G.Glutathione transferase (EC 2.5.1.18) from horse erythrocytes has been purified and some molecular and kinetic properties have been investigated. It appears to be a dimeric protein composed of subunits of about 23 kDa, indistinguishable either in sodium dodecyl sulfate or in urea electrophoresis. Amino acid composition, substrate specificities, sensitivity to inhibitors, CD spectra, and immunological studies provide evidence that the horse enzyme is related to the pi class transferases. This enzyme has only two reactive thiol groups/dimer whose integrity appears to be essential for the activit...
Gildea S, Sanchez Higgins MJ, Johnson G, Walsh C, Cullinane A.There is a lack of information concerning concurrent administration of vaccines against equine influenza virus (EIV) and equine herpesvirus 1 and 4 (EHV-1/4). The primary objective of this study was to determine the impact of the concurrent use of EIV and EHV-1/4 vaccines in Thoroughbred racehorses on their humoral immune response to EIV. This study was carried out on a population of 30 horses using an inactivated whole-virus EIV vaccine and an inactivated EHV-1/4 vaccine. Horses were randomly allocated to vaccination group A or B. Horses in group A were vaccinated against EIV and EHV-1/4 2 we...
Dutra F, Schuch LF, Delucchi E, Curcio BR, Coimbra H, Raffi MB, Dellagostin O, Riet-Correa F.A disease named locally as churrÃo or churrido equino (i.e., equine scours) has occurred for at least 100 years in Uruguay and southern Brazil in farms along both shores of the MerÃn lake. This report describes cases of churrido equino and provides serologic, pathologic, and DNA-based evidence indicating that the disease is in fact equine monocytic ehrlichiosis (Potomac horse fever). Results of an epidemiological investigation conducted on an endemic farm are also presented. Clinical signs in 12 horses were fever, depression, diarrhea, dehydration, and sometimes colic and distal hind limb ed...
Covaleda L, Fuller FJ, Payne SL.Equine infectious anemia virus (EIAV) infection is distinctive in that it causes a rapid onset of clinical disease relative to other retroviruses. In order to understand the interaction dynamics between EIAV and the host immune response, we explored the effects of EIAV and its S2 protein in the regulation of the cytokine and chemokine response in macrophages. EIAV infection markedly altered the expression pattern of a variety of pro-inflammatory cytokines and chemokines monitored in the study. Comparative studies in the cytokine response between EIAV(17) and EIAV(17DeltaS2) infection revealed ...
Zheng YH, Sentsui H, Kono Y, Ikuta K.An attenuated equine infectious anemia virus (EIAV), named V26, was previously obtained after 50 passages of the Japanese virulent strain V70 in primary macrophage culture. To clarify the differences between both viruses, their full-length sequences were determined. There were higher mutations in S2 (6.15% amino acid difference) and LTR (10.7% nucleotide difference). The presumed initiation codon of the S2 gene was absent from the sequence of V26. There was a large insertion within the long-terminal repeat (LTR) U3 hypervariable region of V26. In addition, there were minor mutations in gag (1....
Coleman M, Kuskie K, Liu M, Chaffin K, Libal M, Giguère S, Bernstein L, Cohen N.The objective of this study was to determine the in vitro antimicrobial activity of gallium maltolate (GaM) against Rhodococcus equi. A total of 98 virulent bacterial isolates from equine clinical cases were examined, of which 19 isolates were known to be resistant to macrolides and rifampin. Isolates were cultured with various concentrations of GaM and minimal inhibitory concentration (MIC) values were determined after 24 and 48 h. Both the MIC(50) and the MIC(90) after 24h of growth were 558 ng/mL (8 μM) and after 48 h of growth were 2230 ng/mL (32 μM). There were no apparent differences b...
Scoles GA, Ueti MW.The apicomplexan hemoprotozoan parasite Theileria equi is one of the etiologic agents causing equine piroplasmosis, a disease of equines that is endemic throughout large parts of the world. Before 2009 the United States had been considered to be free of this parasite. Occasional cases had occurred but there was no evidence for endemic vector-borne transmission in the U.S. until a 2009 outbreak in Texas in which Dermacentor variabilis and Amblyomma cajennense were implicated as vectors. Although D. variabilis has previously been shown to be a competent laboratory vector, studies suggested A. ca...
Thiemann AK, Poore LA.This article provides a review of hoof anatomy and care in donkeys and mules. Hoof disease is a major cause of poor welfare and mortality globally. Problems associated with hoof disease are discussed in the context of behavior, diet, treatment, and prevention. The most common conditions encountered are discussed, including laminitis, the overgrown unbalanced hoof, white line disease, flexural deformities, and other significant issues. Differences between donkey and horse hoof anatomy are described.