Equine diseases encompass a wide range of health conditions that can affect horses, including infectious diseases, metabolic disorders, and genetic conditions. These diseases can impact the overall health, performance, and well-being of horses. Common equine diseases include equine influenza, equine herpesvirus, laminitis, and equine metabolic syndrome. Diagnosis and management of these diseases often require a combination of clinical evaluation, laboratory testing, and appropriate treatment strategies. This page gathers peer-reviewed research studies and scholarly articles that explore the etiology, pathophysiology, diagnosis, and treatment options for various equine diseases, providing valuable insights for veterinarians and researchers in the field.
Padalino B, Rosanowski SM, Di Bella C, Lacinio R, Rubino GTR.This study aimed to document the prevalence of chronic equine piroplasmosis (EP) in poorly performing Standardbred racehorses and to explore associations between the disease and sex, age, and hematological parameters. Blood was collected between 2004 and 2018; blood cell counts were performed using a cell counter analyzer, biochemical parameters using a photometer, and serum proteins using agarose gel electrophoresis. Blood smears were prepared, colored with a modified Giemsa, and an experienced technician identified the presence of protozoa. The horses were categorized into piroplasmosis posi...
Aurich C, Müller-Herbst S, Reineking W, Müller E, Wohlsein P, Gunreben B, Aurich J.Warmblood fragile foal syndrome (WFFS) is a monogenetic defect with autosomal recessive inheritance. The WFFS homozygosity is non-compatible with extra-uterine life. Although as many as 15% of Warmblood horses are WFFS carriers, there has been little veterinary focus on this condition. The aim of this study was to determine outcomes and symptoms of clinical signs and pathological abnormalities during pregnancies when there were WFFS homozygous foetuses. Diagnostic material of 15 abortion or stillbirth cases with suspected diagnosis of WFFS was available for this study. Additionally, there were...
Rivas VN, Aleman M, Peterson JA, Dahlgren AR, Hales EN, Finno CJ.Juvenile idiopathic epilepsy (JIE) is an inherited disease characterized by recurrent seizures during the first year of life in Egyptian Arabian horses. Definitive diagnosis requires an electroencephalogram (EEG) performed by a veterinary specialist. A recent study has suggested that a 19 base-pair deletion, along with a triple-C insertion, in intron five of twelve (∆19InsCCC; chr20:29542397-29542425: GTTCAGGGGACCACATGGCTCTCTATAGA>TATCTTAAGACCC) of the () gene is associated with JIE. To confirm this association, a new sample set consisting of nine EEG-phenotyped affected and nine unaffec...
Kydd JH, Hannant D, Robinson RS, Bryant N, Osterrieder N.Equid herpesvirus-1 (EHV-1) causes respiratory and neurological disease and late gestation abortion in pregnant mares. Current vaccines contain either inactivated or live EHV-1, but fail to provide complete clinical or virological protection, namely prevention of nasopharyngeal shedding and cell-associated viraemia. Thus, the development of novel products, such as modified live virus (MLV) vaccines which stimulate virus-specific, humoral and cell mediated immune responses more effectively remains a priority. Two groups of weaned foals (n = 6 each group) were used in a longitudinal, prospec...
Fitzgerald DM, Pollitt CC, Walsh DM, Sillence MN, de Laat MA.The oral glucose test (OGT) is a useful tool for diagnosing insulin dysregulation (ID) and is somewhat repeatable in ponies under consistent management. This study aimed to determine whether the insulin and incretin responses to an OGT in ponies differed after short-term access to fertilised pasture, compared to unfertilised pasture, by using a randomised, repeated measures study design. Sixteen mixed-breed ponies were classified as severely insulin-dysregulated (SD; post-prandial insulin ≥80 μIU/mL) or not severely insulin-dysregulated (NSD; post-prandial insulin < 80 μIU/mL) using an O...
Thompson RE, Johnson AK, Prado TM, Premanandan C, Brown ME, Whitlock BK, Pukazhenthi BS.Availability of viable frozen-thawed endometrial tissues could facilitate detailed studies into physiologic and disease processes influencing the endometrium. This study was designed to investigate the cryosurvival of equine endometrial tissue. Previous studies in the human and horse have focused on cryopreservation of dissociated endometrial cells. To our knowledge, there are no studies on cryopreservation of endometrial explants. Our objectives were to 1) determine the influence of differing concentrations of the permeating cryoprotectant dimethyl sulfoxide (MeSO) on viability, structural in...
Nemoto M, Schofield W, Cullinane A.The objective of this study was to investigate the presence of equine coronavirus (ECoV) in clinical samples submitted to a diagnostic laboratory in Ireland. A total of 424 clinical samples were examined from equids with enteric disease in 24 Irish counties between 2011 and 2015. A real-time reverse transcription polymerase chain reaction was used to detect ECoV RNA. Nucleocapsid, spike and the region from the p4.7 to p12.7 genes of positive samples were sequenced, and sequence and phylogenetic analyses were conducted. Five samples (1.2%) collected in 2011 and 2013 tested positive for ECoV. Po...
Altan E, Li Y, Sabino-Santos G, Sawaswong V, Barnum S, Pusterla N, Deng X, Delwart E.Metagenomics was used to identify viral sequences in the plasma and CSF (cerobrospinal fluid) of 13 horses with unexplained neurological signs and in the plasma and respiratory swabs of 14 horses with unexplained respiratory signs. Equine hepacivirus and two copiparvoviruses (horse parvovirus-CSF and a novel parvovirus) were detected in plasma from neurological cases. Plasma from horses with respiratory signs contained the same two copiparvoviruses plus equine pegivirus D and respiratory swabs contained equine herpes virus 2 and 5. Based on genetic distances the novel copiparvovirus qualified ...
Gozalo-Marcilla M, Luna SPL, Gasthuys F, Schauvliege S.To perform a literature review of the thermal and mechanical antinociceptive devices used in pharmacological studies in standing horses published after 2011 (2012-2019). To complete a full literature review about electrical stimulation used for evaluation in similar studies. Methods: PubMed, Google Scholar and Web of Science. Conclusions: A high level of standardization has been reached in antinociceptive studies in standing horses using thermal and mechanical stimuli in most recent years. Commercially available testing devices to deliver thermal, mechanical and electrical stimuli, with observ...
Spence KL, Cardwell JM, Slater J, Rosanowski SM.The potential for an exotic disease incursion is a significant concern for the United Kingdom (UK) equine industry. Horse owners' perceptions of, and attitudes towards, exotic diseases can influence decisions to adopt disease preparedness strategies. The objectives of this study were to describe horse owners' 1) perceptions of the term 'exotic disease', and 2) attitudes towards their risk of being affected by an exotic disease. In order to address these objectives, qualitative content analysis was undertaken on data collected using two open-ended survey questions. Results: Horse owners (n =...
Melinyshyn H.A 13-year-old Morgan crossbred mare was presented in May 2018 with a 10-cm mass on the medial aspect of the left hind fetlock. In September and November 2018 and June 2019 the mass was incompletely excised and continued to grow. A diagnosis of spindle cell tumor, consistent with equine sarcoid, was made based on histopathology from the last excision. . Une jument Morgan croisée âgée de 13 ans a été présentée en mai 2018 avec une masse de 10 cm sur l’aspect médial du boulet arrière gauche. En septembre et novembre 2018 ainsi qu’en juin 2019, la masse avait été excisée de manièr...
Blanco-Lobo P, Rodriguez L, Reedy S, Oladunni FS, Nogales A, Murcia PR, Chambers TM, Martinez-Sobrido L.Vaccination remains the most effective approach for preventing and controlling equine influenza virus (EIV) in horses. However, the ongoing evolution of EIV has increased the genetic and antigenic differences between currently available vaccines and circulating strains, resulting in suboptimal vaccine efficacy. As recommended by the World Organization for Animal Health (OIE), the inclusion of representative strains from clade 1 and clade 2 Florida sublineages of EIV in vaccines may maximize the protection against presently circulating viral strains. In this study, we used reverse genetics tech...
Riddell LP, Yoshimura S, MacKay AV, Wilson DG.A 17-year-old Quarter horse mare was presented because of traumatic luxation of the fifth sacral and first coccygeal vertebrae resulting in loss of sensation, motor function, and perfusion of the tail. The case was complicated by an associated tail head hematoma. Due to the severity of the injury, tail amputation was performed at the level of the luxation. Tail amputations in horses at the sacrococcygeal junction following a suspected tail pull injury are infrequently reported in the literature. . Une jument Quarter horse âgée de 17 ans fut présentée pour cause de luxation traumatique de l...
Sheats MK, Davis KU, Poole JA.Farmers are routinely exposed to organic dusts and aeroallergens that can have adverse respiratory health effects including asthma. Horses are farm-reared large animals with similar exposures and can develop equine asthma syndrome (EAS). This review aims to compare the etiology, pathophysiology, and immunology of asthma in horses compared to farmers and highlights the horse as a potential translational animal model for organic dust-induced asthma in humans. Severe EAS shares many clinical and pathological features with various phenotypes of human asthma including allergic, non-allergic, late o...
Rahmani V, Häyrinen L, Kareinen I, Ruohoniemi M.The progression of equine odontoclastic tooth resorption and hypercementosis (EOTRH) has not been completely evaluated, and currently, the only effective treatment is extraction of severely affected teeth. We aim to describe how the disease relates to the history and clinical findings and to report on the outcome in individual horses. This case series comprises data collected from 20 horses (age 14-29 years old) with radiographic findings of EOTRH in their incisor and/or canine teeth. Most horses affected with EOTRH in this study were admitted for dental problems, but some for other complaints...
Malalana F, Ireland JL, Pinchbeck G, McGowan CM.Uveitis appears to be less prevalent in the UK compared with other parts of the world and studies characterising the disease in the UK are lacking. The objectives of this retrospective study were to describe acute and recurrent cases presenting for management of uveitis in a referral hospital on the North West of England and compare the signalment of horses presenting with uveitis with the equine hospital population during the same period. Methods: Medical records of horses presented to the referral Equine Hospital, University of Liverpool with signs of uveitis between 2008 and 2018 were revie...
Draper ACE, Cahalan SD, Goodwin D, Perkins J, Piercy RJ.Equine recurrent laryngeal neuropathy (RLN) is a naturally occurring model of length-dependent axonopathy characterized by asymmetrical degeneration of recurrent laryngeal nerve axons (RLn). Distal RLn degeneration is marked, but it is unclear whether degeneration extends to include cell bodies (consistent with a neuronopathy). With examiners blinded to RLN severity, brainstem location, and side, we examined correlations between RLN severity (assessed using left distal RLn myelinated axon count) and histopathological features (including chromatolysis and glial responses) in the nucleus ambiguu...
Cuervo-Arango J, Claes AN, Stout TAE.In recent years, the number of equine invitro-produced embryos (IVP) has increased markedly; as yet, there are few reports on what constitutes an 'ideal' recipient for an IVP embryo. This study retrospectively investigated the effects of recipient mare oestrous cycle characteristics on the likelihood of pregnancy after transfer of IVP (n=264) and invivo-derived embryos (n=262). IVP embryos tolerated only a narrow window of recipient mare 'synchrony', with transfer on Day 4 after ovulation resulting in a higher likelihood of ongoing pregnancy (69%) than transfer on Days 3, 5 or 6 (53.2%, 41.3% ...
McClellan A, Paterson YZ, Paillot R, Guest DJ.In horses and humans, tendon injuries are a significant problem. Not only can they occur in both athletes and nonathletes, they require lengthy periods of recuperation and undergo poor natural regeneration, which leads to high reinjury rates. Embryonic stem cells (ESCs) may provide a renewable source of allogeneic cells to use in clinical applications to aid tissue regeneration. Equine ESCs can undergo tenocyte differentiation in vivo and in vitro, but the immune properties of tenocytes isolated from either ESCs or tissues have not previously been characterized. Here, we demonstrate that equin...
Takahashi Y, Takahashi T.Exertional heat illness (EHI) is recognised in horses, but few reports have investigated its risk factors. Objective: To identify risk factors for EHI in racehorses participating in flat races in Japan. Methods: Descriptive epidemiology and retrospective unmatched case-control study. Methods: Between 2005 and 2016, veterinary records of horses diagnosed with EHI after flat races were reviewed retrospectively and data of the months from April to September were used for a case-control study. For each case, three control horses were randomly selected from starts between April and September. Race ...
Mhadhbi M, Sassi A.Infection of equids by Leishmania (L.) parasites was previously described in both the Old and New World, particularly in Central and South America. Equine cutaneous leishmaniasis (CL) is caused by the Leishmania species, L. Viannia (V.) braziliensis and L. infantum, previously identified in humans and other parasite hosts living in the same geographic endemic areas. Sporadic autochthonous clinical cases, with no travel history, were documented in several countries including Germany, Portugal, Spain, Texas and Brazil; L. infantum and L. (Mundinia) martiniquensis were the infectious species....
Damasceno Teixeira TV, Fry RC, McKinnon A, Fry KL, Kelly JM, Verma PJ, Burden C, Salamone DF, Gambini A.Epigenetic perturbations during the reprogramming process have been described as the primary cause of the low efficiency of somatic cell nuclear transfer (SCNT). In this study, we tested three strategies targeting nuclear reprogramming to investigate effects on equine SCNT. First, we evaluated the effect of treating somatic cells with chetomin, a fungal secondary metabolite reported to inhibit the trimethylation on histone 3 lysine 9 (H3K9 me3). Second, caffeine was added to the culture medium during the enucleation of oocytes and before activation of reconstructed embryos as a protein phospha...
Steinfort S, Obach-Schröck C, Röcken M, Theiss F, Failing K, Vogelsberg J, Staszyk C.Equine periodontal disease (ePD) usually starts with food impaction, formation of diastemata, gingival inflammation and formation of periodontal pockets. This process proceeds toward the dentoalveolar space, causing detachment of tooth supporting periodontal fibers. Although several therapeutical procedures have been proposed, ePD is often only diagnosed in advanced stages, requiring dental extraction. A similar dilemma has been observed in small animal medicine, but has been overcome by the introduction of reliable examination protocols for the early diagnosis of periodontal diseases (PD). Th...
Sutton G, Garvey M, Cullinane A, Jourdan M, Fortier C, Moreau P, Foursin M, Gryspeerdt A, Maisonnier V, Marcillaud-Pitel C, Legrand L, Paillot R....Equine herpesvirus 1 (EHV-1) is an Alphaherpesvirus infecting not only horses but also other equid and non-equid mammals. It can cause respiratory distress, stillbirth and neonatal death, abortion, and neurological disease. The different forms of disease induced by EHV-1 infection can have dramatic consequences on the equine industry, and thus the virus represents a great challenge for the equine and scientific community. This report describes the progress of a major EHV-1 outbreak that took place in Normandy in 2009, during which the three forms of disease were observed. A collection of EHV-1...
Ellerbrock RE, Curcio BR, Zhong L, Honoroto J, Wilkins P, Lima FS, Giguere S, Canisso IF.Enrofloxacin may be an alternative antimicrobial for unresponsive cases of severe bacterial infections in pregnant mares. As pregnancy may affect drug bioavailability, distribution, metabolism and excretion, dose adjustment might be necessary. Objective: To determine the disposition of orally and intravenously administered enrofloxacin in pregnant and non-pregnant mares. Methods: Randomised cross-over experiment. Methods: Six light-breed, healthy pregnant mares (260 days gestation) were given a single dose of either intravenous (5 mg/kg bwt) or oral compounded (7.5 mg/kg bwt) enrofloxacin, ...
Matthews N, van Loon JPAM.The number of donkeys in the world may not be increasing but awareness of their use and concern for welfare and pain recognition and treatment are receiving increasing veterinary interest. Therefore, accurate information about anesthesia and analgesia in donkeys and mules is important to more equine practitioners. This review highlights the current knowledge on various anesthetic and analgesic approaches in donkey and mules. The authors emphasize that there is still much information that is not available about donkeys and mules; in many circumstances, the clinician must use available equine in...
Rodrigues JB, Lilly G.Research and clinical understanding of equine dentistry has progressed in recent years; however, specific knowledge about donkey dentistry is lacking. This article intends to revise unique anatomic features of the head and oral cavity of donkeys, as well as how to correctly examine, diagnose, prevent, and/or treat dental pathology, allowing for a better comprehension of oral and dental disorders affecting these animals throughout their life. It also emphasizes that these disorders need to be taken into account when assessing the welfare of donkeys.
Radcliffe PA, Sion CJ, Wilkes FJ, Custard EJ, Beard GL, Kingsman SM, Mitrophanous KA.Effective gene therapy for haemophilia A necessitates a vector system that is not subject to a pre-existing immune response, has adequate coding capacity, gives long-term expression and preferably can target non-dividing cells. Vector systems based on lentiviruses such as equine infectious anaemia virus (EIAV) fulfil these criteria for the delivery of factor VIII (FVIII). We have found that B domain-deleted (BDD) FVIII protein inhibits functional viral particle production when co-expressed with the EIAV vector system. Although particle numbers (as measured by reverse transcriptase activity) ar...
de Laat MA, Sillence MN, Reiche DB.Equine endocrinopathic laminitis is common and can be associated with an underlying endocrinopathy, such as equine metabolic syndrome (EMS), pituitary pars intermedia dysfunction (PPID), pasture consumption, or any combination of these factors. Objective: The aim of the study was to improve the risk assessment capabilities of clinicians, and to inform management strategies, for acute endocrinopathic laminitis by prospectively examining the phenotypic, hormonal, and clinical characteristics of the disease in a large cohort. Methods: Privately owned horses and ponies (n = 301) of any age, se...
Tirosh-Levy S, Gottlieb Y, Arieli O, Mazuz ML, King R, Horowitz I, Steinman A.Equine piroplasmosis (EP) is an important tick-borne disease of equids, caused by Theileria equi and Babesia caballi. It is endemic in most parts of the world, including Israel, and has clinical and economic consequences. This study was set to evaluate the presence of EP parasites in domestic donkeys and in wild equids in Israel and the Palestinian Authority (PA). To assess subclinical EP infection in 98 domestic donkeys (Equus africanus asinus), 9 Asiatic wild donkeys (Equus hemionus), 8 zebras (Equus quagga), 7 African wild donkeys (Equus africanus) and 5 mules, were tested using PCR and qPC...
Hisey E, Ross PJ, Meyers SA.OCT4 is a core transcription factor involved in pluripotency maintenance in the early mammalian embryo. The POU5F1 gene that encodes the OCT4 protein is highly conserved across species, suggesting conserved function. However, studies in several species including mice, cattle, and pigs, suggest that there are differences in where and when OCT4 is expressed. Specifically, in the horse, several studies have shown that exposure to the uterine environment may be necessary to induce OCT4 expression restriction to the inner cell mass (ICM) of the developing embryo, suggesting that there may be equine...
Ascenzi P, di Masi A, Gullotta F, Mattu M, Ciaccio C, Coletta M.Cyanide binds to ferric heme-proteins with a very high affinity, reflecting the very low dissociation rate constant (k(off)). Since no techniques are available to estimate k(off), we report herewith a method to determine k(off) based on the irreversible reductive nitrosylation reaction to trap ferric myoglobin (Mb(III)). The k(off) value for cyanide dissociation from ferric cyanide horse heart myoglobin (Mb(III)-cyanide) was determined at pH 9.2 and 20.0 degrees C. Mixing Mb(III)-cyanide and NO solutions brings about absorption spectral changes reflecting the disappearance of Mb(III)-cyanide w...
Shakya AK, O'Callaghan DJ, Kim SK.Equine herpesvirus 1 (EHV-1) is a major pathogen affecting equines worldwide. The virus causes respiratory disease, abortion, and, in some cases, neurological disease. EHV-1 Kentucky A (KyA) is attenuated in the mouse and equine, whereas wild-type pathogenic strain RacL11 induces severe inflammatory infiltration of the lung, causing infected mice to succumb. The complete DNA sequencing of the KyA genome revealed that genes UL17 (ORF17), US6 (ORF73; gI), US7 (ORF74; gE), and US8 (ORF75; 10 K) are deleted as compared to the RacL11 and Ab4 genomes. In-frame deletions in the US1 (ORF68), US4 (OR...
Pusterla N, Gebhart C.Equine proliferative enteropathy (EPE) is a disease of foals caused by the obligate intracellular organism Lawsonia intracellularis. This organism is unique in that it causes proliferation of infected enterocytes, resulting in thickening of the intestinal epithelium, most often the small intestine. This disease affects mainly weanling foals and causes fever, lethargy, peripheral edema, diarrhea, colic and weight loss. The diagnosis of EPE may be challenging and relies on the presence of hypoproteinemia, thickening of segments of the small intestinal wall observed on abdominal ultrasonography, ...
Johnson ACB, Biddle AS.Cyathostomins are a multispecies parasite ubiquitous in Equids. Cyathostomins have developed resistance to all but one class of anthelmintics, but species-level sensitivity to anthelmintics has not been shown. This study measured reinfection rates of cyathostomin species following the administration of three commercial dewormers. Nine treated horses were compared with 90 untreated controls during June-September 2017-2019. Ivermectin (IVM) (n = 6), Moxidectin (MOX) (n = 8) or Pyrantel (PYR) (n = 8) were orally administered. Fecal samples were collected every 14 d for 98 d. Fecal egg count reduc...
Ball BA, Little TV, Weber JA, Woods GL.The estimated embryonic loss rate between Days 4 and 14 after ovulation for young, normal mares (9%) was significantly lower (P less than 0.01) than the estimated embryonic loss rate for aged subfertile mares (62%). Fertilization rates, which were based on the recovery of embryos at Day 4 after ovulation, were 96% and 81% (P less than 0.1) for normal and subfertile mares, respectively. Day-4 embryos were collected from the oviducts of normal and subfertile donors mares. These embryos were transferred to the uteri of synchronized, normal recipient mares to test the hypothesis that the high inci...
Dern K, van Eps A, Wittum T, Watts M, Pollitt C, Belknap J.Although continuous digital hypothermia (CDH) protects lamellae from injury in the oligofructose (OF) model of sepsis-related laminitis (SRL), conflicting results exist from these studies regarding effects of CDH on lamellar inflammatory events. Objective: To determine the effect of CDH on lamellar inflammatory events in normal and OF-treated horses when instituted at a clinically relevant time point (onset of clinical signs of sepsis in this model). Methods: Standardbred geldings (n = 15) aged 3-11 years were used. Methods: In a randomized, controlled discovery study, animals were administ...
Messick JB, Rikihisa Y.The effects of equine antiserum, immunoglobulin G (IgG) specific for Ehrlichia risticii, and its Fab fragment on E. risticii binding to, internalization into, and proliferation in P388D1 cells were studied by immunofluorescence flow cytometry. Anti-E. risticii equine serum or IgG inhibited E. risticii at a stage beyond binding and internalization. In contrast, monovalent anti-E. risticii equine Fab fragments inhibited E. risticii binding and internalization into P388D1 cells. In the presence of control equine serum, IgG, or its Fab fragment, E. risticii cells were bound, were internalized and ...
Westermann CM, de Sain-van der Velden MG, van der Kolk JH, Berger R, Wijnberg ID, Koeman JP, Wanders RJ, Lenstra JA, Testerink N, Vaandrager AB....Two horses (a 7-year-old Groninger warmblood gelding and a six-month-old Trakehner mare) with pathologically confirmed rhabdomyolysis were diagnosed as suffering from multiple acyl-CoA dehydrogenase deficiency (MADD). This disorder has not been recognised in animals before. Clinical signs of both horses were a stiff, insecure gait, myoglobinuria, and finally recumbency. Urine, plasma, and muscle tissues were investigated. Analysis of plasma showed hyperglycemia, lactic acidemia, increased activity of muscle enzymes (ASAT, LDH, CK), and impaired kidney function (increased urea and creatinine). ...
Carnevale EM.Assisted reproductive techniques that are based on oocyte manipulations have gained acceptance in the equine industry. Methods to collect and handle immature or maturing oocytes have been developed, and systems to ship oocytes now allow for collection in one location and intracytoplasmic sperm injection (ICSI) in another. Subsequently, ICSI-produced embryos can be transferred onsite, shipped to another location, or cryopreserved. Methods for the collection, identification, culture, maturation, and shipment of equine oocytes are reviewed, with an emphasis on procedures from laboratories providi...
Scantlebury CE, Pinchbeck GL, Loughnane P, Aklilu N, Ashine T, Stringer AP, Gordon L, Marshall M, Christley RM, McCarthy AJ.Histoplasma capsulatum var. farciminosum, the causative agent of epizootic lymphangitis (EZL), is endemic in parts of Africa. Diagnosis based on clinical signs and microscopy lacks specificity and is a barrier to further understanding this neglected disease. Here, a nested PCR method targeting the internal transcribed spacer (ITS) region of the rRNA operon was validated for application to equine clinical samples. Twenty-nine horses with signs of EZL from different climatic regions of Ethiopia were clinically examined. Blood samples and aspirates of pus from cutaneous nodules were taken, along ...
Veronesi F, Moretta I, Moretti A, Fioretti DP, Genchi C.A study was carried out to assess the field efficacy of ivermectin (IVM) and pyrantel pamoate (PYR) against Parascaris equorum. Seventy-three foals (3-18 months old) from 5 stud farms, not treated with anthelmintics in the previous 10 weeks and with individual faecal egg counts (FEC) >200, were included in the study. For each stud farm, 5-7 foals were included in the IVM-treatment group (IVM 0.2%, 200 mcg/kg body weight) or in the PYR-treatment group (PYR 38%, 13.2mg/kg body weight) and 3 were untreated as controls. For each foal, FECs were carried out before treatment (Day 0) and on Days 7 an...
van der Kuyl AC.Information on endogenous retroviruses fixed in the horse (Equus caballus) genome is scarce. The recent availability of a draft sequence of the horse genome enables the detection of such integrated viruses by similarity search. Using translated nucleotide fragments from gamma-, beta-, and delta-retroviral genera for initial searches, a full-length beta-retrovirus genome was retrieved from a horse chromosome 5 contig. The provirus, tentatively named EqERV-beta1 (for the first equine endogenous beta-retrovirus), was 10434 nucleotide (nt) in length with the usual retroviral genome structure of 5'...
Williamson RM, Beveridge I, Gasser RB.To compare the sensitivities of three coprological techniques for the diagnosis of Anoplocephala perfoliata infection in horses and to assess the value of the methods for diagnosis of horses at risk of clinical cestodiasis. Methods: Faecal samples were collected from necropsied horses with or without A perfoliata infection and examined using one sedimentation and two different flotation methods. The coprological results were compared with worm counts performed at necropsy of the horses and the degree of mucosal damage. In addition, the efficiency of recovery of A perfoliata eggs from faeces wa...
Zielińska P, Soroko M, Howell K, Godlewska M, Hildebrand W, Dudek K.The aim of the study was to assess differences in the influence of high-intensity laser therapy (HILT) on the skin surface temperature and vein diameter of the lateral fetlock joint region in a group of racehorses with pigmented and non-pigmented skin in the treatment area. Twenty Thoroughbreds were divided into two equal groups: pigmented and non-pigmented skin groups. Each horse received the same HILT treatment. Just before and immediately after HILT, thermographic examination was performed to measure the skin surface temperature and ultrasonographic examination assessed the lateral digital ...
Brommer H, van Weeren PR, Brama PA, Barneveld A.The equine fetlock joint has the largest number of traumatic and degenerative lesions of all joints of the appendicular skeleton. Objective: To gain insight into the distribution of cartilage degeneration across the articular surface in relation to age in order better to understand the dynamic nature and progression of osteoarthritis (OA). Objective: That there would be a specific age-related distribution pattern of cartilage degeneration in the equine metacarpophalangeal joint. Methods: The proximal articular cartilage surfaces of the first phalanges (P1) of 73 slaughter horses (age range 0.4...
Jin S, Issel CJ, Montelaro RC.We recently reported a highly protective attenuated live virus vaccine for equine infectious anemia virus (EIAV) based on a proviral construct (EIAVUKDeltaS2) with a genetically engineered mutation in the viral S2 gene that eliminates expression of this accessory protein. While the EIAVUKDeltaS2 vaccine provides protection from detectable infection by experimental challenge with highly virulent virus, the potential for commercial application of this vaccine is complicated by the fact that horses inoculated with the EIAVUKDeltaS2 vaccine strain become seropositive in various reference diagnosti...
Nash D, Lane E, Herath S, Sheldon IM.Endometritis after insemination is ubiquitous in the horse and is associated with semen and/or bacteria in the uterus. In up to 40% of horses, inflammation persists causing infertility. An endometrial explant culture was developed to study uterine secretion of prostaglandin F(2alpha) (PGF(2alpha)) in response to physiological and pathological challenge. Methods: Uteri were collected from mares, the endometrium dissected and explants from the uterine body or horn cultured in William's or RPMI medium. The response of explants to oxytocin, semen or bacteria compared to untreated tissue was tested...
Broeckx SY, Maes S, Martinello T, Aerts D, Chiers K, Mariën T, Patruno M, Franco-Obregón A, Spaas JH.Besides the presence of somatic stem cells in hair follicles and dermis, the epidermis also contains a subpopulation of stem cells, reflecting its high regenerative capacity. However, only limited information concerning epidermis-derived epithelial-like stem/progenitor cells (EpSCs) is available to date. Nonetheless, this stem cell type could prove itself useful in skin reconstitution after injury. After harvesting from equine epidermis, the purified cells were characterized as EpSCs by means of positive expression for CD29, CD44, CD49f, CD90, Casein Kinase 2β, p63, and Ki67, low expression f...
Tozaki T, Ohnuma A, Iwai S, Kikuchi M, Ishige T, Kakoi H, Hirota K, Kusano K, Nagata S.Gene doping is banned in human sports, horseracing, and equestrian sports. One possible form of gene doping is to administer exogenous genes, called transgenes. Several transgene detection methods based on quantitative PCR have been developed. In this study, we investigated the robustness of digital PCR and real-time PCR in transgene detection using primers and probes that matched (P-true) or incompletely matched (P-false) the template DNA. Fluorescence intensity was significantly reduced when substituted probes were used compared to that using the matched probe in both digital and real-time P...
Jiang CG, Gao X, Ma J, Lin YZ, Wang XF, Zhao LP, Hua YP, Liu D, Zhou JH.Preliminary studies revealed that the gene of the gp45 transmembrane protein (TM) of the attenuated equine infectious anemia virus (EIAV) vaccine strain EIAV(FDDV13) had a high frequency of a premature stop codon at position 261W, which generated a 154-residue truncation at the C-terminus. EIAV(FDDV-TM36), a recombinant virus with the TM truncated at the intracytoplasmic (CT) domain due to the presence of a stop codon, was constructed based on EIAV(FDDV)3-8, which is a proviral derivative of the vaccine. EIAV(FDDV-TM36) had a significantly reduced replication capability compared to EIAV(FDDV)3...
Camino E, Pozo P, Dorrego A, Carvajal KA, Buendia A, Gonzalez S, de Juan L, Dominguez L, Cruz-Lopez F.Serological analysis of equine piroplasmosis (EP), caused by Theileria equi and Babesia caballi, is included in the export testing requirements for most of the countries worldwide, thus involving a high economic impact on equine industry of EP-endemic countries, such as Spain. A total of 3368 serum samples from healthy horses collected prior to export between 2015 and 2018 in Spain were tested for antibodies against T. equi and B. caballi by using a competitive inhibition enzyme-linked immunosorbent assay (cELISA). The overall seroprevalence results in Spain revealed that almost a quarter of t...
Pouran B, Arbabi V, Zadpoor AA, Weinans H.The metabolic function of cartilage primarily depends on transport of solutes through diffusion mechanism. In the current study, we use contrast enhanced micro-computed tomography to determine equilibrium concentration of solutes through different cartilage zones and solute flux in the cartilage, using osteochondral plugs from equine femoral condyles. Diffusion experiments were performed with two solutes of different charge and approximately equal molecular weight, namely iodixanol (neutral) and ioxaglate (charge=-1) in order to isolate the effects of solute's charge on diffusion. Furthermore,...
Shibeshi W, Abraham G, Kneuer C, Ellenberger C, Seeger J, Schoon HA, Ungemach FR.Culture of airway epithelial cells is a useful model to investigate physiology of airway epithelia and airway disease mechanisms. In vitro models of airway epithelial cells are established for various species. However, earlier published method for isolation and culture of equine tracheal epithelial cells requires significant improvements. In this report, the development of a procedure for efficient isolation, characterization, culture, and passage of primary equine tracheal epithelial cells are described. Epithelial cells were isolated from adult equine trachea by exposing and stripping the mu...
Jose-Cunilleras E, Kohn CW, Hillier A, Saville WJ, Lorch G.To compare responses to a variety of intradermally injected allergens among healthy horses and horses with chronic obstructive pulmonary disease (COPD), recurrent urticaria (RU), and atopic dermatitis-insect hypersensitivity (allergic dermatitis [AD]). Methods: Case-control study. Methods: 86 horses. Methods: Results of intradermal testing for horses with COPD, RU, or AD were compared with results for healthy horses. Results: Compared with healthy horses, horses with COPD, RU, and AD were significantly more likely to have positive (> or = 3+) reactions to intradermal allergens (molds, weeds, t...
van der Linde-Sipman JS, Kroneman J, Meulenaar H, Vos JH.Four horses are described with rupture of the aortic arch and pulmonary trunk which resulted in a fistula between these vessels. Ruptures were located near the ligamentum arteriosum. Histological examination of the vessel walls revealed media necrosis which was probably due to intimal thickening and/or medial fibrosis of the vasa vasorum.
Hayes CG, Wallis RC.Western equine encephalomyelitis (WEE) has been recognized as a serious public health problem in western North America for more than 30 years. WEE appears to exist endemically in numerous foci in that region, with a low incidence rate among humans. Severe outbreaks, however, have occurred periodically. For example, during 1941 a severe epidemic involving more than 3000 cases in humans occurred in North Dakota, Minnesota, and in the adjacent areas of Canada. The case fatality rate ranged from 8% to 15%. Epizootics among horses are more common. More than 600 cases of WEE were diagnosed among hor...
