Genetics in horses encompasses the study of hereditary traits and the genetic makeup that influences various characteristics and health conditions in equine populations. This field involves the analysis of genes and their functions, inheritance patterns, and the impact of genetic variations on traits such as coat color, performance ability, and susceptibility to diseases. Research in equine genetics employs techniques such as genome mapping, sequencing, and genetic testing to identify specific genes and mutations associated with these traits. This page gathers peer-reviewed research studies and scholarly articles that explore the genetic basis of equine traits, the methodologies used in genetic research, and the implications for breeding, health management, and conservation of horse breeds.
Ortiz I, Dorado J, Morrell JM, Diaz-Jimenez MA, Pereira B, Consuegra C, Hidalgo M.The aim of this study was to compare the post-thaw distribution of motile sperm subpopulations, following simple or colloid centrifugation. A new analysis was used to evaluate the available number of sperm from each subpopulation after each centrifugation protocol. Frozen/thawed semen samples were divided into the following after-thawing treatments: uncentrifuged control (UDC), sperm washing (SW) and two colloid centrifugation procedures (Equipure, SLC-E, and Androcoll, SLC-A). Percentage of total and progressive motility (TM and PM), as well as sperm motility kinematics, distribution of motil...
Bernstock JD, Ostby S, Fox B, Sotoudeh H, Janssen A, Kang YJ, Chen J, Prattipati V, Elsayed G, Chagoya G, Yamashita D, Friedman GK, Nabors B, Huh WK....Leptomeningeal metastasis is extremely rare in patients with ovarian cancer, but should be considered in patients presenting with neurologic deficits such as cauda equine syndrome. Given its poor prognosis and lack of data currently on management, additional studies are needed to optimize treatment regimens and improve outcomes.
Park J, Kim EB.The ecosystem of an animal farm is composed of various elements, such as animals, farmers, plants, feed, soil, and microorganisms. A domesticated animal's health is largely connected with the reservoir of bacteria and viruses in animal farms. Although a few studies have focused on exploring the gut microbiome of animals, communities of microbiota and viruses in feedlots have not been thoroughly investigated. Methods: Here, we collected feces and dust samples (4 groups: cattle feces, C_F; horse feces, H_F; cattle dust, C_D; and horse dust, H_D) from cattle and horse farms sharing the same housi...
Solé M, Ablondi M, Binzer-Panchal A, Velie BD, Hollfelder N, Buys N, Ducro BJ, François L, Janssens S, Schurink A, Viklund Å, Eriksson S....Copy Number Variation (CNV) is a common form of genetic variation underlying animal evolution and phenotypic diversity across a wide range of species. In the mammalian genome, high frequency of CNV differentiation between breeds may be candidates for population-specific selection. However, CNV differentiation, selection and its population genetics have been poorly explored in horses. Results: We investigated the patterns, population variation and gene annotation of CNV using the Axiom® Equine Genotyping Array (670,796 SNPs) from a large cohort of individuals (N = 1755) belonging to eight ...
Kato Y, Sayama Y, Sano M, Kaneko MK.Podoplanin (PDPN), which is a mucin-type membrane glycoprotein, is expressed on lymphatic endothelial cells and epithelial cells of many organs. PDPN is also overexpressed in several malignant cancers, and its expression is associated with cancer progression and poor prognosis. Human PDPN possesses three platelet aggregation-stimulating (PLAG) domains and the PLAG-like domain (PLD), which binds to C-type lectin-like receptor-2 (CLEC-2). Previously, we reported a novel antihorse PDPN (horPDPN) monoclonal antibody (mAb), PMab-219, using Cell-Based Immunization and Screening (CBIS) method. PMab-2...
Arnhold S, Elashry MI, Klymiuk MC, Geburek F.Adipose tissue-derived mesenchymal stem cells (ASCs) offer a promising cell source for therapeutic applications in musculoskeletal disorders. The appropriate selection of ASCs from various fat depots for cell-based therapy is challenging. The present study aims to compare stemness and multipotency of ASCs derived from retroperitoneal (RP), subcutaneous (SC), and lipoma (LP) fat to assess their usefulness for clinical application. Equine ASCs from the three fat tissue sources were isolated and characterized. The cell viability, proliferation, and self-renewal were evaluated using MTT, sulforhod...
Dahmani M, Davoust B, Sambou M, Bassene H, Scandola P, Ameur T, Raoult D, Fenollar F, Mediannikov O.Our study aimed to assess the diversity of the species of Anaplasmataceae in Senegal that infect animals and ticks in three areas: near Keur Momar Sarr (northern region), Dielmo and Diop (Sine Saloum, central region of Senegal), and in Casamance (southern region of Senegal). Methods: A total of 204 ticks and 433 blood samples were collected from ruminants, horses, donkeys and dogs. Ticks were identified morphologically and by molecular characterization targeting the 12S rRNA gene. Molecular characterization of species of Anaplasmataceae infecting Senegalese ticks and animals was conducted usin...
Pinna AE, Okada CTC, Ferreira CSC et al. Double ovarian tumor in the mare: case report. Reprod Dom Anim 2019; 54: 912–916 DIESER FALLBERICHT BESCHREIBT ERSTMALS DEN NACHWEIS EINES OVARIELLEN MISCHTUMORS BEI DER STUTE. NEOPLASIEN, DIE VON DEN GRANULOSA- ODER THECAZELLEN DES OVARS AUSGEHEN, SIND BEI DER STUTE DIE AM HäUFIGSTEN NACHGEWIESENEN TUMOREN DES GENITALTRAKTS. ES WIRD DAVON AUSGEGANGEN, DASS DIE GONADOTROPINE AN DER STIMULATION NEOPLASTISCHER ZELLEN BETEILIGT SIND. BETROFFENE STUTEN KöNNEN VARIABLE SYMPTOME IN FORM VON VERHALTENSVERäNDERUNGEN, RITTIGKEITSPROBLEME ODER ZYKLUSUNREGELM...
Denham J.Telomeres are genetically conserved nucleoprotein complexes located at the ends of chromosomes that preserve genomic stability. In large mammals, somatic cell telomeres shorten with age, owing to the end replication problem and lack of telomere-lengthening events (e.g. telomerase and ALT activity). Therefore, telomere length reflects cellular replicative reserve and mitotic potential. Environmental insults can accelerate telomere attrition in response to cell division and DNA damage. As such, telomere shortening is considered one of the major hallmarks of ageing. Much effort has been dedicate...
The Journal of heredityOctober 20, 2019
Volume 110, Issue 7 769-781 doi: 10.1093/jhered/esz032
Han H, Bryan K, Shiraigol W, Bai D, Zhao Y, Bao W, Yang S, Zhang W, MacHugh DE, Dugarjaviin M, Hill EW.The Mongolian horse is one of the oldest extant horse populations and although domesticated, most animals are free-ranging and experience minimal human intervention. As an ancient population originating in one of the key domestication centers, the Mongolian horse may play a key role in understanding the origins and recent evolutionary history of horses. Here we describe an analysis of high-density genome-wide single-nucleotide polymorphism (SNP) data in 40 globally dispersed horse populations (n = 895). In particular, we have focused on new results from Chinese Mongolian horses (n = 100) that ...
Pereira B, Dorado J, Diaz-Jimenez M, Consuegra C, Ortiz I, Gosalvez J, Hidalgo M.The acquisition of equine oocyte developmental capacity is ensured by the follicular environment, such as granulosa cells, which could reflect the meiotic development potential of immature oocytes. This study evaluated the relationship between DNA fragmentation of granulosa cells, using the chromatin dispersion test, and equine oocyte meiotic development after in vitro maturation. Granulosa cells and cumulus-oocytes complexes (n = 50) were recovered from slaughterhouse-derived ovaries. Oocytes were in vitro matured, stained and evaluated under fluorescence microscopy. Maturation rates were c...
Tanaka J, Leeb T, Rushton J, Famula TR, Mack M, Jagannathan V, Flury C, Bachmann I, Eberth J, McDonnell SM, Penedo MCT, Bellone RR.Mushroom is a unique coat color phenotype in Shetland Ponies characterized by the dilution of the chestnut coat color to a sepia tone and is hypothesized to be a recessive trait. A genome wide association study (GWAS), utilizing the Affymetrix 670K array (MNEc670k) and a single locus mixed linear model analysis (EMMAX), identified a locus on ECA7 for further investigation ( = 2.08 × 10). This locus contained a 3 Mb run of homozygosity in the 12 mushroom ponies tested. Analysis of high throughput Illumina sequencing data from one mushroom Shetland pony compared to 87 genomes from horses of var...
Klohonatz KM, Coleman SJ, Cameron AD, Hess AM, Reed KJ, Canovas A, Medrano JF, Islas-Trejo AD, Kalbfleisch T, Bouma GJ, Bruemmer JE.Maternal recognition of pregnancy (MRP) in the mare is not well defined. In a non-pregnant mare, prostaglandin F (PGF) is released on day 14 post-ovulation (PO) to cause luteal regression, resulting in loss of progesterone production. Equine MRP occurs prior to day 14 to halt PGF production. Studies have failed to identify a gene candidate for MRP, so attention has turned to small, non-coding RNAs. The objective of this study was to evaluate small RNA (<200 nucleotides) content in endometrium during MRP. Mares were used in a cross-over design with each having a pregnant and non-mated cycle. Ea...
Aurich C, Müller-Herbst S, Reineking W, Müller E, Wohlsein P, Gunreben B, Aurich J.Warmblood fragile foal syndrome (WFFS) is a monogenetic defect with autosomal recessive inheritance. The WFFS homozygosity is non-compatible with extra-uterine life. Although as many as 15% of Warmblood horses are WFFS carriers, there has been little veterinary focus on this condition. The aim of this study was to determine outcomes and symptoms of clinical signs and pathological abnormalities during pregnancies when there were WFFS homozygous foetuses. Diagnostic material of 15 abortion or stillbirth cases with suspected diagnosis of WFFS was available for this study. Additionally, there were...
Rivas VN, Aleman M, Peterson JA, Dahlgren AR, Hales EN, Finno CJ.Juvenile idiopathic epilepsy (JIE) is an inherited disease characterized by recurrent seizures during the first year of life in Egyptian Arabian horses. Definitive diagnosis requires an electroencephalogram (EEG) performed by a veterinary specialist. A recent study has suggested that a 19 base-pair deletion, along with a triple-C insertion, in intron five of twelve (∆19InsCCC; chr20:29542397-29542425: GTTCAGGGGACCACATGGCTCTCTATAGA>TATCTTAAGACCC) of the () gene is associated with JIE. To confirm this association, a new sample set consisting of nine EEG-phenotyped affected and nine unaffec...
Hybridization has been widely practiced in plant and animal breeding as a means to enhance the quality and fitness of the organisms. In domestic equids, this hybrid vigor takes the form of improved physical and physiological characteristics, notably for strength or endurance. Because the offspring of horse and donkey is generally sterile, this widely recognized vigor is expressed in the first generation (F1). However, in the absence of recombination between the two parental genomes, F1 hybrids can be expected to be phenotypically intermediate between their parents which could potentially restr...
Álvarez-Narváez S, Giguère S, Anastasi E, Hearn J, Scortti M, Vázquez-Boland JA.Antibiotic use has been linked to changes in the population structure of human pathogens and the clonal expansion of multidrug-resistant (MDR) strains among healthcare- and community-acquired infections. Here we present a compelling example in a veterinary pathogen, , the causative agent of a severe pulmonary infection affecting foals worldwide. We show that the (46) gene responsible for emerging macrolide resistance among equine isolates in the United States is part of a 6.9-kb transposable element, Tn, actively mobilized by an IS family transposase. Tn is carried on an 87-kb conjugative pla...
Nemoto M, Schofield W, Cullinane A.The objective of this study was to investigate the presence of equine coronavirus (ECoV) in clinical samples submitted to a diagnostic laboratory in Ireland. A total of 424 clinical samples were examined from equids with enteric disease in 24 Irish counties between 2011 and 2015. A real-time reverse transcription polymerase chain reaction was used to detect ECoV RNA. Nucleocapsid, spike and the region from the p4.7 to p12.7 genes of positive samples were sequenced, and sequence and phylogenetic analyses were conducted. Five samples (1.2%) collected in 2011 and 2013 tested positive for ECoV. Po...
Tozaki T, Kusano K, Ishikawa Y, Kushiro A, Nomura M, Kikuchi M, Kakoi H, Hirota K, Miyake T, Hill EW, Nagata S.Fractures are medical conditions that compromise the athletic potential of horses and/or the safety of jockeys. Therefore, the reduction of fracture risk is an important horse and human welfare issue. The present study used molecular genetic approaches to determine the effect of genetic risk for fracture at four candidate SNPs spanning the myostatin (MSTN) gene on horse chromosome 18. Among the 3706 Japanese Thoroughbred racehorses, 1089 (29.4%) had experienced fractures in their athletic life, indicating the common occurrence of this injury in Thoroughbreds. In the case/control association st...
Gonzalez-Castro RA, Amoroso-Sanches F, Stokes JE, Graham JK, Carnevale EM.Oocyte activation is initiated when a fertilising spermatozoon delivers sperm-borne oocyte-activating factor(s) into the oocyte cytoplasm. Candidates for oocyte activation include two proteins, phospholipase Cζ1 (PLCZ1) and postacrosomal WW-binding protein (PAWP; also known as WBP2 N-terminal like (WBP2NL)). We localised PLCZ1 and WBP2NL/PAWP in stallion spermatozoa and investigated the PLCZ1 content and sperm parameters as well as cleavage after intracytoplasmic sperm injection (ICSI). PLCZ1 was identified as 71-kDa protein in the acrosomal and postacrosomal regions, midpiece and principal p...
Sheats MK, Davis KU, Poole JA.Farmers are routinely exposed to organic dusts and aeroallergens that can have adverse respiratory health effects including asthma. Horses are farm-reared large animals with similar exposures and can develop equine asthma syndrome (EAS). This review aims to compare the etiology, pathophysiology, and immunology of asthma in horses compared to farmers and highlights the horse as a potential translational animal model for organic dust-induced asthma in humans. Severe EAS shares many clinical and pathological features with various phenotypes of human asthma including allergic, non-allergic, late o...
Beste KJ, Lawhon SD, Chamoun-Emanuelli AM, Duff AH, Coleman MC, Griffin CE, Hardy J, Whitfield-Cargile CM.Horses with bacterial sinusitis frequently undergo empirical treatment with antimicrobials, however, in some cases bacterial culture of the affected sinus is used to direct therapy. Data regarding which organisms are part of the commensal microbiota of the equine sinus are lacking making it difficult to interpret culture results and guide empiric antimicrobial selection. Objective: Our objectives were to describe the bacterial and fungal microbiota of the paranasal sinuses in clinically normal horses using culture-dependent and independent approaches and to compare the bacterial culture and su...
Lindenberg F, Krych L, Kot W, Fielden J, Frøkiær H, van Galen G, Nielsen DS, Hansen AK.Shortly after birth the mammalian gut is colonized, by a transient microbiota, highly susceptible to environment and diet, that eventually stabilizes and becomes the resident gut microbiota. In a window of opportunity during the colonization, oral tolerance is established towards resident bacteria. In this study, the development of the equine gut microbiota was investigated in ten foals from parturition until post weaning. We found great differences in the core species of the gut microbiota composition between time-matched samples on Day 7 and 20 post-partum. Between day 20 and Day 50 post-par...
Traversari J, Aepli H, Knutti B, Lüttgenau J, Bruckmaier RM, Bollwein H.The anti-Müllerian hormone (AMH) plays an inhibitory role during folliculogenesis by regulating the number of follicles entering the growing pool. Antral follicle counts (AFC) are highly correlated with serum AMH concentrations and both appear to be related to the ovarian reserve in several species. Few data on AMH and AFC in mares exist, especially with regard to fertility. Therefore, the objective of the current study was to investigate the interrelationship between antral follicle count, serum AMH concentrations and fertility outcome in mares. One hundred and twenty-seven mares were enroll...
Damasceno Teixeira TV, Fry RC, McKinnon A, Fry KL, Kelly JM, Verma PJ, Burden C, Salamone DF, Gambini A.Epigenetic perturbations during the reprogramming process have been described as the primary cause of the low efficiency of somatic cell nuclear transfer (SCNT). In this study, we tested three strategies targeting nuclear reprogramming to investigate effects on equine SCNT. First, we evaluated the effect of treating somatic cells with chetomin, a fungal secondary metabolite reported to inhibit the trimethylation on histone 3 lysine 9 (H3K9 me3). Second, caffeine was added to the culture medium during the enucleation of oocytes and before activation of reconstructed embryos as a protein phospha...
Olguin-Perglione C, Vissani MA, Alamos F, Tordoya MS, Barrandeguy M.Equine influenza is an important cause of respiratory disease of horses worldwide. The equine influenza virus (EIV) undergoes antigenic drift through the accumulation of amino acid substitutions in the viral proteins, which may lead to vaccine breakdown. Objective: To describe the epidemiological findings and the molecular characteristics of the EIV detected during the multifocal outbreak that occurred in Argentina between March and July 2018 and evidence a vaccine breakdown. Methods: Observational, descriptive study. Methods: Virus was detected in nasopharyngeal swabs using real-time reverse ...
Sutton G, Garvey M, Cullinane A, Jourdan M, Fortier C, Moreau P, Foursin M, Gryspeerdt A, Maisonnier V, Marcillaud-Pitel C, Legrand L, Paillot R....Equine herpesvirus 1 (EHV-1) is an Alphaherpesvirus infecting not only horses but also other equid and non-equid mammals. It can cause respiratory distress, stillbirth and neonatal death, abortion, and neurological disease. The different forms of disease induced by EHV-1 infection can have dramatic consequences on the equine industry, and thus the virus represents a great challenge for the equine and scientific community. This report describes the progress of a major EHV-1 outbreak that took place in Normandy in 2009, during which the three forms of disease were observed. A collection of EHV-1...
Bellone RR, Ocampo NR, Hughes SS, Le V, Arthur R, Finno CJ, Penedo MCT.Catastrophic fractures are among the most common cause of fatalities in racehorses. Several factors, including genetics, likely contribute to increased risk for fatal injuries. A variant in the procollagen-lysine, 2-oxoglutarate 5-dioxygenase1 gene (PLOD1 c.2032G>A) was shown to cause Warmblood fragile foal syndrome type 1 (WFFS), a fatal recessive defect of the connective tissue. Screening of multiple horse breeds identified the presence of the WFFS allele in the Thoroughbred. PLOD1 is involved in cross-linking of collagen fibrils and thus could potentially increase the risk of catastrophic b...
Walewska E, Wołodko K, Skarzynski D, Ferreira-Dias G, Galvão A.The regulation of corpus luteus (CL) luteolysis is a complex process involving a myriad of factors. Previously, we have shown the involvement of Nodal in functional luteolysis in mares. Presently, we ask the extent of which Nodal mediation of luteolysis is done through regulation of angioregression. We demonstrated the interaction between Nodal and hypoxia-inducible factor 1 α (HIF1α) and thrombospondin 1/thrombospondin receptor (TSP1/CD36) systems, could mediate angioregression during luteolysis. First, we demonstrated the inhibitory effect of Nodal on the vascular marker platelet/endotheli...
Hackett CH, Fortier LA.The field of regenerative medicine research is rapidly expanding. One area of interest to equine researchers is the possibility of isolating or generating pluripotent cells, capable of producing differentiated cell types derived from all 3 primary germ layers. Reports of equine embryonic stem-like (ES) cell isolation can be found in the literature. Other groups are working to produce equine-induced pluripotent stem (iPS) cells. This article summarizes the essential features needed to characterize a cell type as pluripotent, specific challenges in using the horse as a model organism for pluripo...
Bussche L, Rauner G, Antonyak M, Syracuse B, McDowell M, Brown AMC, Cerione RA, Van de Walle GR.Signaling mechanisms that regulate mammary stem/progenitor cell (MaSC) self-renewal are essential for developmental changes that occur in the mammary gland during pregnancy, lactation, and involution. We observed that equine MaSCs (eMaSCs) maintain their growth potential in culture for an indefinite period, whereas canine MaSCs (cMaSCs) lose their growth potential in long term cultures. We then used this system to investigate the role of microvesicles (MVs) in promoting self-renewal properties. We found that Wnt3a and Wnt1 were expressed at higher levels in MVs isolated from eMaSCs compared wi...
Viklund Å, Eriksson S.A linear profiling protocol was introduced in 2013 at tests for 3-year-old Swedish Warmblood horses. In this protocol, traits are subjectively described on a nine-point linear scale from one biological extreme to the other. This complements the traditional scoring where horses are evaluated in relation to the breeding objective. This study aimed to investigate the suitability of the linear information for genetic evaluation. Data on 22 conformation traits, 17 movement traits, 14 jumping traits and one temperament trait from 3,410 horses tested between 2013 and 2016 were analysed using an anima...
Kang J, Lee MS, Watowich SJ, Gorenstein DG.A phosphorothioate RNA aptamer (thioaptamer) targeting the capsid protein of Venezuelan equine encephalitis virus (VEEV) was isolated by in vitro combinatorial selection. The selected thioaptamer had a strong binding affinity (approximately 7nM) and high specificity for the target protein. For the binding to the protein, the overall tertiary structure of the thioaptamer is required. We introduce two theoretical methods to examine the effect of phosphorothioate modification on the enhancement of binding affinity and one experimental method to examine the nature of the multiple bands of thioapta...
Duan H, Gao JF, Hou MR, Zhang Y, Liu ZX, Gao DZ, Guo DH, Yue DM, Su X, Fu X, Wang CR.The complete mitochondrial (mt) genome sequence of Triodontophorus brevicauda, an intestinal equine nematode parasite was determined for the first time. The circular T. brevicauda mt genome is 14,305 bp in length and contains 36 genes, of which 12 code for protein, 22 for transfer RNA, and two for ribosomal RNA, and lacks atp8 mtDNA gene. Phylogenetic analysis based on the concatenated amino acid sequence of the 12 protein-coding genes was performed using three different tree-building methods. The Strongyloidea cluster divides into two large branches, and each nematode family included in our s...
Higuchi RG, Wrischnik LA, Oakes E, George M, Tong B, Wilson AC.Sequences are reported for portions of two mitochondrial genes from a domestic horse and a plains zebra and compared to those published for a quagga and a mountain zebra. The extinct quagga and plains zebra sequences are identical at all silent sites, whereas the horse sequence differs from both of them by 11 silent substitutions. Postmortem changes in quagga DNA may account for the two coding substitutions between the quagga and plains zebra sequences. The hypothesis that the closest relative of the quagga is the domestic horse receives no support from these data. From the extent of sequence ...
Taylor WTT, Barrón-Ortiz CI.Despite its transformative impact on human history, the early domestication of the horse (Equus caballus) remains exceedingly difficult to trace in the archaeological record. In recent years, a scientific consensus emerged linking the Botai culture of northern Kazakhstan with the first domestication of horses, based on compelling but largely indirect archaeological evidence. A cornerstone of the archaeological case for domestication at Botai is damage to the dentition commonly linked with the use of bridle mouthpieces, or "bit wear." Recent archaeogenetic analyses reveal, however, that horse r...
Amaral A, Fernandes C, Lukasik K, Szóstek-Mioduchowska A, Baclawska A, Rebordão MR, Aguiar-Silva J, Pinto-Bravo P, Skarzynski DJ, Ferreira-Dias G.We have shown that bacteria induce neutrophil extracellular traps (NETs) in mare endometrium. Besides killing pathogens, NETs may contribute for endometrosis (chronic endometrium fibrosis). Since elastase (ELA) is a NETs component that regulates fibrosis and prostaglandin (PG) output, the aim was to evaluate if inhibition of ELA would affect collagen 1 (COL1) transcription and PGs secretion by endometrium explants, in different estrous cycle phases. Follicular-FP (n = 8) and mid luteal-MLP (n = 7) phases explants were cultured for 24-48 hr with medium alone (Control), ELA (0.5 μg/ml,1 ...
Terry RB, Archer S, Brooks S, Bernoco D, Bailey E.A single autosomal dominant locus, leopard complex (LP) controls the presence of appaloosa pigmentation patterns in the horse. The causative gene for LP is unknown. This study was undertaken to map LP in the horse. Two paternal half sib families segregating for the LP locus and including a total of 47 offspring were used to perform a genome scan which localized LP to horse chromosome 1 (ECA1). LP was linked to ASB08 (LOD = 9.99 at Theta = 0.02) and AHT21 (LOD = 5.03 at Theta = 0.14). To refine the map position of LP, eight microsatellite markers on ECA1 (UM041, LEX77, 1CA41, TKY374, COR046, 1C...
Rodriguez C, Taminiau B, Brévers B, Avesani V, Van Broeck J, Leroux AA, Amory H, Delmée M, Daube G.Clostridium difficile has been identified as a significant agent of diarrhoea and enterocolitis in both foals and adult horses. Hospitalization, antibiotic therapy or changes in diet may contribute to the development of C. difficile infection. Horses admitted to a care unit are therefore at greater risk of being colonized. The aim of this study was to investigate the carriage of C. difficile in hospitalized horses and the possible influence of some risk factors in colonization. During a seven-month period, faecal samples and data relating the clinical history of horses admitted to a veterinary...
Guss B, Flock M, Frykberg L, Waller AS, Robinson C, Smith KC, Flock JI.Streptococcus equi subspecies equi (S. equi) is a clonal, equine host-adapted pathogen of global importance that causes a suppurative lymphodendopathy of the head and neck, more commonly known as Strangles. The disease is highly prevalent, can be severe and is highly contagious. Antibiotic treatment is usually ineffective. Live attenuated vaccine strains of S. equi have shown adverse reactions and they suffer from a short duration of immunity. Thus, a safe and effective vaccine against S. equi is highly desirable. The bacterium shows only limited genetic diversity and an effective vaccine coul...
van Grevenhof EM, Ducro B, Heuven HC, Bijma P.It is expected that climate and habitat factors influence the prevalence of culicoides and, therefore, the prevalence of insect bite hypersensitivity (IBH), but very little is described in the literature to prove the association of these factors. Prevalence varies widely from 3% in certain areas of Great Britain to 60% in certain parts of Australia. Objective: To describe the influence of environmental factors on the prevalence of IBH in Shetland ponies and Friesian horses in The Netherlands. Methods: Data on 3284 Shetland and 2824 Friesian mares (n = 6108) were collected in The Netherlands, b...
Sekizuka T, Niwa H, Kinoshita Y, Uchida-Fujii E, Inamine Y, Hashino M, Kuroda M.MRSA is a known pathogen that affects horses. We investigated an equine MRSA isolate for potential antimicrobial resistance genes, classified the staphylococcal cassette chromosome mec (SCCmec) and identified the strain-specific dissemination in the horse community based on WGS. WGS, using short-read sequencing, and subsequent long-read sequencing by hybrid assembly, was conducted to obtain a complete genome sequence. Pairwise sequence alignment of relative SCCmec sequences and core-genome phylogenetic analysis were performed to highlight transmission routes of the SCCmec and MRSA strain-speci...
Ansari HA, Hediger R, Fries R, Stranzinger G.The first gene assignment to a horse chromosome is reported for equine leucocyte antigen (ELA), the major histocompatibility complex of the horse. A cloned DNA sequence derived from a class I gene of the porcine major histocompatibility complex was used as a probe for an in situ hybridization experiment. We present the regional localization of ELA, using this sequence, to equine chromosome 20q14-q22.
Scharrenberg A, Gerber V, Swinburne JE, Wilson AD, Klukowska-Rötzler J, Laumen E, Marti E.Equine recurrent airway obstruction (RAO) is a chronic lower airway disease of the horse caused by hypersensitivity reactions to inhaled stable dust, including mould spores such as Aspergillus fumigatus. The goals of this study were to investigate whether total serum IgE levels and allergen-specific IgE and IgG subclasses are influenced by genetic factors and/or RAO and whether quantitative trait loci (QTL) could be identified for these parameters. The offspring of two RAO-affected sires (S1: n=56 and S2: n=65) were grouped by stallion and disease status, and total serum IgE levels and specifi...
Gershwin LJ.Allergic responses occur in humans, rodents, non-human primates, avian species, and all of the domestic animals. These responses are mediated by immunoglobulin E (IgE) antibodies that bind to mast cells and cause release/synthesis of potent mediators. Clinical syndromes include naturally occurring asthma in humans and cats; atopic dermatitis in humans, dogs, horses, and several other species; food allergies; and anaphylactic shock. Experimental induction of asthma in mice, rats, monkeys, sheep, and cats has helped to reveal mechanisms of pathogenesis of asthma in humans. All of these species s...
Silver IA, Brown PN, Goodship AE, Lanyon LE, McCullagh KG, Perry GC, Williams IF.This project was carried out over a five year period (1977 to 1981 inclusive) at the University of Bristol following discussion between the British Veterinary Association and the Royal College of Veterinary Surgeons about the efficacy of, and ethical justification for, the practice of 'firing' (cautery). These discussions had been promoted by parliamentary questions but led to no firm conclusions because previously reported clinical investigations on specific treatments lacked adequate comparisons and controls and thus did not provide scientifically acceptable, statistically valid data. The pr...
Bourebaba L, Röcken M, Marycz K.Osteochondrosis (osteochondrosis dissecans; OCD) is a disease syndrome of growing cartilage related to different clinical entities such as epiphysitis, subchondral cysts and angular carpal deformities, which occurs in growing animals of all species, including horses. Nowadays, these disorders are affecting increasing numbers of young horses worldwide. As a complex multifactorial disease, OCD is initiated when failure in cartilage canals because of existing ischemia, chondrocyte biogenesis impairment as well as biochemical and genetic disruptions occur. Recently, particular attention have been ...
Poyato-Bonilla J, Laseca N, Demyda-Peyrás S, Molina A, Valera M.The Carthusian horse is a Pura Raza Español (PRE) strain (CS), bred as a closed population since its creation more than 500 years ago. The aim of this study was to analyse for the first time its population structure and situation of variability combining both genealogical (GEL) and genomic (GEN) data. The GEL data comprised 348,429 pedigree records (56,105 CS horses), while the GEN analysis included the high-density genotypes (670,804 SNPs) of 287 horses. Pedigree completeness demonstrated its accuracy, showing a good correlation of GEL (F) and GEN (F ) inbreeding coefficient in the case of ...
Rolão N, Martins MJ, João A, Campino L.The present report describes the first case of equine leishmaniasis in Portugal. Leishmania infection was detected in one animal, which presented an ulcerated skin lesion. Diagnosis was based on serology by CIE, and parasite DNA detection by real-time PCR using a probe specific for L. infantum. This finding requests further leishmaniasis equine surveys in order to clarify the role of the horse as reservoir host in european endemic areas.
Kidd TJ, Gibson JS, Moss S, Greer RM, Cobbold RN, Wright JD, Ramsay KA, Grimwood K, Bell SC.Pseudomonas aeruginosa is associated with infectious endometritis in horses. Although infectious endometritis is often considered a venereal infection, there is relatively limited genotypic-based evidence to support this mode of transmission. The study sought to determine the relatedness between genital P. aeruginosa isolates collected from a limited geographical region using molecular strain typing. Enterobacterial repetitive intergenic consensus PCR typing was performed on 93 isolates collected between 2005 and 2009 from 2058 thoroughbred horses (including 18 stallions) at 66 studs. While P....
Manna G, Cersini A, Nardini R, Bartolomé Del Pino LE, Antognetti V, Zini M, Conti R, Lorenzetti R, Veneziano V, Autorino GL, Scicluna MT.Babesia caballi and Theileria equi are tick-borne pathogens causing equine piroplasmosis infecting the Equidae family in which they cause significant sanitary and economic losses. Furthermore, equine piroplasmosis is included in the World Animal Health Organization (OIE) notifiable diseases list with possible movement restrictions for positive horses. Thirty-nine EDTA and whole-blood samples collected during 2013 and 2014 from symptomatic and asymptomatic horses of Central-Southern Italy were included in the present study either because of their strongly positive results in Real Time (RT) PCRs...
RANDALL CC, LAWSON LA.The research article discusses the successful adaptation of the Equine Abortion Virus (EAV) to L-M 929 cells, the impact on infected cultures, and possible reasons for earlier unsuccessful attempts. It […]
Cvitas I, Oberhänsli S, Leeb T, Dettwiler M, Müller E, Bruggman R, Marti EI.Insect bite hypersensitivity (IBH) is a Th-2, IgE-mediated dermatitis of horses caused by bites of insects of the genus Culicoides that has common features with human atopic dermatitis. Together with Th-2 cells, the epithelial barrier plays an important role in development of type I hypersensitivities. In order to elucidate the role of the epithelial barrier and of the skin immune response in IBH we studied the transcriptome of lesional whole skin of IBH-horses (IBH-LE; n = 9) in comparison to non-lesional skin (IBH-NL; n = 8) as well as to skin of healthy control horses (H; n = 9). To study t...
Halper J, Kim B, Khan A, Yoon JH, Mueller PO.Degenerative suspensory ligament desmitis (DSLD) is a debilitating disorder thought to be limited to suspensory ligaments of Peruvian Pasos, Peruvian Paso crosses, Arabians, American Saddlebreds, American Quarter Horses, Thoroughbreds, and some European breeds. It frequently leads to persistent, incurable lameness and need to euthanize affected horses. The pathogenesis remains unclear, though the disease appears to run in families. Treatment and prevention are empirical and supportive, and not effective in halting the progression of the disease. Presently, the presumptive diagnosis of DSLD is ...
Swinburne J, Gerstenberg C, Breen M, Aldridge V, Lockhart L, Marti E, Antczak D, Eggleston-Stott M, Bailey E, Mickelson J, Røed K, Lindgren G....Two 3-generation full-sibling reference families have been produced and form a unique resource for genetic linkage mapping studies in the horse. The F(2) generations, now comprising 61 individuals, consist of 28- to 32-day-old embryos removed nonsurgically from two pairs of identical twin mares. The same stallion sired all F(2)s such that the two full-sibling families are half-sibling with respect to each other. The families are crossbred to maximize levels of heterozygosity and include Arabian, Thoroughbred, Welsh Cob, and Icelandic Horse breeds. Milligram quantities of DNA have been isolated...
Watson ED, Sertich PL.Embryos, endometrial biopsies, and uterine lavage fluid were collected from pregnant and non-pregnant mares 14 days after ovulation. Embryos were cultured for 20.5 h with and without endometrial tissue from pregnant mares, and endometrial tissue was cultured alone. Endometrial content of PGF tended to be higher (P = 0.06) in non-pregnant than in pregnant mares, but the amount of PGF released from tissue during culture was similar for pregnant and non-pregnant mares. Lavage fluid from non-pregnant mares also tended (P = 0.08) to contain higher concentrations of PGF. Coincubation of embryos with...
Gao Y, Zhang Y, Yang X, Qiu JH, Duan H, Xu WW, Chang QC, Wang CR.Equine strongyles, the significant nematode pathogens of horses, are characterized by high quantities and species abundance, but classification of this group of parasitic nematodes is debated. Mitochondrial (mt) genome DNA data are often used to address classification controversies. Thus, the objectives of this study were to determine the complete mt genomes of three Cyathostominae nematode species (, and ) of horses and reconstruct the phylogenetic relationship of Strongylidae with other nematodes in Strongyloidea to test the hypothesis that spp. belong to Cyathostominae using the mt genomes...
