Veterinary research in horses encompasses the study of diseases, health management, and medical treatments specific to equine species. This field investigates various aspects of horse health, including infectious diseases, metabolic disorders, and musculoskeletal conditions. Researchers focus on understanding the pathophysiology of equine ailments, developing diagnostic tools, and evaluating therapeutic interventions. The study of horse health also involves examining preventive measures such as vaccination protocols and nutritional management to promote overall well-being. This page collects peer-reviewed research studies and scholarly articles that explore the diverse areas of veterinary science related to horses, providing insights into disease mechanisms, treatment strategies, and advancements in equine healthcare.
DePuy T, Howard R, Keegan K, Wilson D, Kramer J, Cook JL, Childers MK.To test the hypothesis that botulinum toxin type A (BoNT-A) can attenuate lameness associated with acute synovitis in an equine model. Methods: Four horses 2-6 yrs of age with clinically normal carpi were studied for 15 days. Kinematic gait analysis and clinical measures of lameness were conducted before and after experimental interventions. Horses were randomly assigned to either placebo (saline) or treatment (BoNT-A) groups. On day 0 of the intervention, 50 units of BoNT-A or an equivalent volume of saline (0.09%) was given into the middle carpal joints. On day 14, acute synovitis was induce...
Naureen A, Saqib M, Muhammad G, Hussain MH, Asi MN.The Rose Bengal plate agglutination test (RBT) was evaluated for the diagnosis of equine glanders, and its diagnostic efficiency was compared with that of mallein and other serological tests, including indirect hemagglutination test (IHAT), complement fixation test (CFT), and modified counter immunoelectrophoresis test (mCIET). Sera from 70 naturally infected culture-positive, 96 potentially exposed cohorts, and 110 healthy equines were tested. All tests but mCIET showed 100% specificity when testing the sera from glanders-negative equines. The calculated sensitivities of RBT, IHAT, CFT, mCIET...
Kligler EB, Shkap V, Baneth G, Mildenberg Z, Steinman A.Sera from 800 asymptomatic horses were examined for the presence of antibodies to Neospora caninum by immunofluorescence antibody test (IFAT). The presence of antibodies to N. caninum was also tested in sera from 52 mares that had aborted and 40 horses exhibiting neurological signs. A total of 95 (11.9%) of the 800 sera had antibodies for Neospora. Significantly higher seropositivity was obtained from horses that had neurological signs (21.2%) and from aborted mares (37.5%). There was significant linear-by-linear association between age and seropositivity. This is the first serologic survey fo...
Kreutzer R, Wohlsein P, Staszyk C, Nowak M, Sill V, Baumgärtner W.Cementoma is a very rare odontogenic neoplasm of mesenchymal origin. Clinically, in 3 horses, multiple bony enlargements of the upper and lower jaw extending into the oral cavity were observed. Radiographically, multiple, well-circumscribed, radiopaque masses surrounding the roots of the upper and lower incisors or an upper premolar tooth were present. Due to malocclusion and local pain, single teeth were extracted in each case. Grossly, a hard grayish-white mass surrounding the root of the incisors and the premolars was identified. Histopathologically, the tumors consisted of excessive deposi...
Bertone AL, Goin S, Kamei SJ, Mattoon JS, Litsky AS, Weisbrode SE, Clarke RB, Plouhar PL, Kaeding CC.Xenogeneic porcine small intestinal submucosa (SIS) is a natural, biodegradable matrix that has been successfully used as a scaffold for repair of tissue defects. The goal of this study was to compare a collateral ligament transection surgically reconstructed with an anchored SIS ligament to a sham-operated control procedure for the correction of joint laxity using an equine model. Ten metacarpophalangeal joints from 10 horses had complete transection of the lateral collateral ligament. In 6 horses, the collateral ligament was reconstructed with a multilaminate strip of SIS anchored with screw...
Rohrbach BW, Sheerin PC, Cantrell CK, Matthews PM, Steiner JV, Dodds LE.To determine whether treatment with a preparation of Propionibacterium acnes would improve pregnancy and live foal rates in mares with persistent endometritis. Methods: Randomized placebo-controlled clinical trial. Methods: 95 mares with a cytologic diagnosis of persistent endometritis. Methods: Mares were treated with P acnes or placebo (both administered IV) on days 0, 2, and 6. No attempt was made to alter additional treatments administered by attending veterinarians. Information on breeding history, physical examination findings, results of cytologic examination and microbial culture of ut...
Anthenill LA, Stover SM, Gardner IA, Hill AE.To assess individual and combined associations of high-speed exercise and horseshoe characteristics with risk of forelimb proximal sesamoid bone fractures and proximal sesamoid bone midbody fractures in Thoroughbred racehorses. Methods: 269 deceased Thoroughbred racehorses. Methods: A case-control study design was used to compare 121 horses with a fracture of at least 1 of 4 forelimb proximal sesamoid bones (75 horses had a midbody fracture) and 148 horses without a forelimb proximal sesamoid bone fracture. Univariable and multivariable logistic regression analyses were used to evaluate potent...
Norris JW, Pratt SM, Hunter JF, Gardner IA, Tablin F.To measure the frequency and magnitude of reduced fibrinogen binding in a population of horses from a Thoroughbred breeding farm. Methods: 444 Thoroughbred horses, 1 to 27 years old, including 316 females, 72 geldings, and 56 sexually intact males. Methods: Blood was collected from horses into tubes containingacid citrate dextrose adenine, and washed platelets were examined by use of flow cytometry for their ability to bind fibrinogen. Results: Data regarding fibrinogen binding to activated platelets were normally distributed, with nearly identical amounts of variation regardless of sex. In 3 ...
Schwarzwald CC, Schober KE, Bonagura JD.To assess the feasibility, describe the techniques, and determine the reliability of transthoracic echocardiography for characterization of left atrial (LA) size and LA mechanical function in horses. Methods: 6 healthy adult horses. Methods: Repeated echocardiographic examinations were performed independently by 2 observers in standing, unsedated horses by use of 2-dimensional echocardiography, pulsed-wave flow Doppler, and tissue Doppler imaging (TDI) techniques. Test reliability was determined by estimating measurement variability, within-day interobserver variability, and between-day inter-...
Ibrahim S, Saunders K, Kydd JH, Lunn DP, Steinbach F.Three hundred and seventy-nine monoclonal antibodies (mAbs) against various human CD molecules supplied to the HLDA8 animal homologues section (including four isotype controls) were analysed for cross-reactivity with equine leukocytes. First, flow cytometric identification of positively reacting mAbs was performed in one laboratory. Thereafter, a second round of flow cytometric evaluation was performed, involving three laboratories participating in the study. The first test-round indicated 17 mAbs as potentially positive. After the second round of flow cytometric analysis, 14 mAbs remained (di...
Ibrahim S, Steinbach F.In addition to the 379 monoclonal antibodies (mAbs) tested in the animal homologues section of HLDA8, another 155 mAbs were screened at the Institute for Zoo and Wildlife Research, Berlin for cross-reactivity with equine leukocytes. For this purpose, one colour flow-cytometric analysis was performed as screening test. This additional screening indicated further 16 mAbs as positive with staining homologous to human pattern, 1 mAb with weak (positive) reactivity, 11 mAbs with positive, but likely not valuable staining, 12 mAbs with alternate expression pattern from that expected from human immun...
Mohammed HO, Divers TJ, Summers BA, de Lahunta A.Equine motor neuron disease (EMND) is a spontaneous neurologic disorder of adult horses which results from the degeneration of motor neurons in the spinal cord and brain stem. Clinical manifestations, pathological findings, and epidemiologic attributes resemble those of human motor neuron disease (MND). As in MND the etiology of the disease is not known. We evaluated the predisposition role of vitamin E deficiency on the risk of EMND. Methods: Eleven horses at risk of EMND were identified and enrolled in a field trial at different times. The horses were maintained on a diet deficient in vitami...
Kirkpatrick JF, Turner A.Intensive population management by means of fertility control has been shown to change the age profile of a wild horse herd. The primary change has been an increase in the number and percent of older animals, as expected, but also the appearance of new and older age classes. An examination of direct effects of fertility control on two groups of treated animals shows a significant increase in longevity over non-treated animals that is associated with contraceptive treatment. The mean age at death (MAD) was calculated for 128 wild horses for which precise birth and death dates were known, includ...
Huser CA, Davies ME.Chondrocyte apoptosis is an important factor in the progression of osteoarthritis. This study aimed to elucidate the mechanisms involved upstream of caspase 9 activation and, in particular, calcium signaling and mitochondrial depolarization. Methods: Articular cartilage explants obtained from healthy horses were subjected to a single impact load (500-gm weight dropped from a height of 50 mm) and cultured in vitro for up to 48 hours. Chondrocyte death was quantified by the TUNEL method. Release of proteoglycans was determined by the dimethylmethylene blue assay. Weight change was measured, and ...
Theurillat R, Knobloch M, Schmitz A, Lassahn PG, Mevissen M, Thormann W.CE with multiple isomer sulfated beta-CD as the chiral selector was assessed for the simultaneous analysis of the enantiomers of ketamine and metabolites in extracts of equine plasma and urine. Different lots of the commercial chiral selector provided significant changes in enantiomeric ketamine separability, a fact that can be related to the manufacturing variability. A mixture of two lots was found to provide high-resolution separations and interference-free detection of the enantiomers of ketamine, norketamine, dehydronorketamine, and an incompletely identified hydroxylated metabolite of no...
Boehm AK, Seth M, Mayr KG, Fortier LA.Many metabolic processes in chondrocytes thought to contribute to age-related changes in the extracellular matrix are influenced by known roles of Hsp90. Age-related decreases in the level of Hsp90 have been documented in numerous cell types and could contribute to cartilage degeneration. The aim of this study was to investigate the roles of age and Hsp90 in insulin-like growth factor 1 (IGF-1) and interleukin-1beta (IL-1beta) signaling in chondrocytes. Methods: Levels of Hsp90 messenger RNA (mRNA) and protein, with respect to age, were determined by quantitative real-time polymerase chain rea...
Yamada M, Aramaki S, Okayasu T, Hosoe T, Kurosawa M, Kijima-Suda I, Saito K, Nakazawa H.Anabolic steroids with the 17alpha-methyl,17beta-hydroxyl group, which were developed as oral formulations for therapeutic purposes, have been abused in the field of human sports. These anabolic steroids are also used to enhance racing performance in racehorses. In humans, structurally related 17alpha-methyltestosterone (MTS) and mestanolone (MSL), which are anabolic steroids with the 17alpha-methyl,17beta-hydroxyl group, have metabolites in common. The purpose of this study was to determine metabolites common to these two steroids in horses, which may serve as readily available screening targ...
Duggan VE, Holyoak GR, MacAllister CG, Cooper SR, Confer AW.The objective of this study was to investigate the protein, amyloid A3 (AA3), in equine colostrum and early milk. We hypothesized that AA3 was consistently present in equine colostrum and early milk, that no correlation existed between serum and colostrum concentrations of this protein in individual mares at parturition and that colostrum/milk concentrations of this mammary protein may be affected by age, breed, length of gestation and/or induction of parturition. Thirty-eight peripartum mares and seven non-pregnant, non-lactating mares were included in the study. Mean serum concentrations of ...
Allsopp MT, Lewis BD, Penzhorn BL.The intra-erythrocytic parasite Theileria equi is one of two tick-transmitted causative agents of equine piroplasmosis. Piroplasms of T. equi can be transmitted across the equine placenta and once a horse is infected, it appears to remain a lifelong carrier, since anti-theilerial drugs suppress but do not eliminate the parasite. Carrier mares may transmit the organism to their offspring and this may result in abortion or neonatal piroplasmosis, but observations by some researchers suggest that foals may be born as carriers yet remain apparently healthy. Using a T. equi-specific oligonucleotide...
Léon A, Fortier G, Fortier C, Freymuth F, Tapprest J, Leclercq R, Pronost S.The major role of EHV-1 in equine abortion is widely reported in the literature but the contribution of EHV-2, EHV-3, EHV-4 or EHV-5 remains less well documented. The objective of this study is to evaluate the contribution of these five different EHVs to equine abortion in a variety of biological tissues using a consensus polymerase chain reaction (PCR). The test was validated for specificity and sensitivity in horses before screening specimens from 407 foetuses, stillbirths and premature foals collected over a 2.5-year interval. Positive results obtained with this assay were compared to other...
Güçlü HZ, Karaer KZ.The aim of this study was to compare the diagnosis of Babesia caballi and Theileria equi by the polymerase chain reaction (PCR) and microscopic examination of blood specimens collected from show and sport horses in the region of Ankara in 2004. The blood specimens were collected from randomly selected 200 show and sport horses in the region of Ankara during the tick season as well as before and after the tick season for PCR testing. At the same time, Giemsa stained peripheral blood smears were examined for the presence of Babesia spp. and also the horses were examined for the presence of ticks...
Collins SM, Zieba DA, Williams GL.We tested the hypothesis that continuous subcutaneous treatment with low-dose GnRH, administered to mares from late September/early October through March, would prevent the development of seasonal anovulation. Quarter Horse mares (n=20) were stratified by age and body condition score and assigned randomly to either a saline control (n=9) or a GnRH (n=11) treatment group. Gonadotropin-releasing hormone was delivered continuously via osmotic minipumps, with sham pumps placed in control mares. Initial pumps were inserted on Day 3 following ovulation or during the follicular phase if the next anti...
Leung GN, Ho EN, Kwok WH, Leung DK, Tang FP, Wan TS, Wong AS, Wong CH, Wong JK, Yu NH.Quantitative determination, particularly for threshold substances in biological samples, is much more demanding than qualitative identification. A proper assessment of any quantitative determination is the measurement uncertainty (MU) associated with the determined value. The International Standard ISO/IEC 17025, "General requirements for the competence of testing and calibration laboratories", has more prescriptive requirements on the MU than its superseded document, ISO/IEC Guide 25. Under the 2005 or 1999 versions of the new standard, an estimation of the MU is mandatory for all quantitativ...
Kitai Y, Shoda M, Kondo T, Konishi E.West Nile virus (WNV) is now widely distributed worldwide, except in most areas of Asia where Japanese encephalitis virus (JEV) is distributed. Considering the movement and migration of reservoir birds, there is concern that WNV may be introduced in Asian countries. Although manuals and guidelines for serological tests have been created in Japan in preparedness for the introduction of WNV, differential diagnosis between WNV and JEV may be complicated by antigenic cross-reactivities between these flaviviruses. Here, we generated a monoclonal antibody specific for the nonstructural protein 1 (NS...
Nunes DB, Zorzatto JR, Costa e Silva EV, Zúccari CE.Five experiments tested the efficiency of a simple, low-cost system (CP) for cooling and storing equine semen at 2.0 degrees C for 24 h and 48 h. Pantaneiro stallions of known fertility were used. Semen quality was evaluated for progressive motility (PM), plasma membrane integrity (PMI), and pregnancy rate. Experiment 1 showed that PM and PMI were similar between CP and the control (Equitainer) in cooled semen. In Experiment 2, the influence was evaluated of combinations (four treatments) of two volumes (50/100 ml) and two sperm concentrations (500/750x10(6)) on sperm quality of semen cooled a...
Weng Q, Tanaka Y, Taniyama H, Tsunoda N, Nambo Y, Watanabe G, Taya K.To elucidate the relationship between steroidogenic hormones and developing adrenal glands, we investigated the immunolocalization of steroidogenic enzymes in equine fetal adrenal glands during mid-late gestation. Fetal adrenal glands were obtained from three horses at 217, 225 and 235 days of gestation. Steroidogenic enzymes were immunolocalized using polyclonal antisera raised against bovine adrenal cholesterol side-chain cleavage cytochrome P450 (P450scc), human placental 3beta-hydroxysteroid dehydrogenase (3betaHSD), porcine testicular 17alpha-hydroxylase cytochrome P450 (P450c17) and huma...
Njiru ZK, Constantine CC.To investigate the population genetic structure of Trypanosoma evansi from domesticated animals, we have analysed 112 stocks from camels, buffaloes, cattle and horses using the tandemly repeated coding sequence (MORF2) and minisatellite markers 292 and cysteine-rich acidic integral membrane protein (CRAM). We recorded a total of six alleles at the MORF2 locus, seven at 292 and 12 at the CRAM loci. Nei's genetic distance showed reduced allelic diversity between buffaloes and cattle stocks (1.2) as compared to the diversity between camels and buffaloes (3.75) and camels and cattle stock (1.69). ...
Riddle WT, LeBlanc MM, Stromberg AJ.Endometrial cytology and culture specimens (n=2123) were collected concurrently with a guarded uterine culture instrument from 970 mares (738 barren, 1230 foaling and 155 maiden mares) during three breeding seasons (2001-2004). Results were compared to the 28-d pregnancy rate for the cycle from which the samples were taken. Cytological smears were evaluated for inflammation at x100 and graded as: not inflammatory (0-2 neutrophils/field), moderate inflammation (2-5 neutrophils/field), severe inflammation (>5 neutrophils/field), or hypocellular (scant epithelial cells and no neutrophils). Ute...
Duckett WM, Matthews HK.Paraneoplastic eosinophilia is reported in dogs, cats, and humans. Hypereosinophilia (an eosinophil count greater than 1.5 x 10(9) L) is often associated with metastasis and a poor prognosis. This report describes a case of paraneoplastic hypereosinophilia in a pony. Neoplasia should be included in the differential diagnoses in a horse with eosinophilia.
Darien BJ, Sims PA, Stone WC, Schilly DR, Dubielzig RR, Albrecht RM.Volvulus of the ascending colon (ACV) in the horse results in microvascular injury and necrosis of the intestinal mucosa. This study investigated the site and type of microvascular injury which occurs within the mucosa and submucosa following ACV. Histopathology of volvulus treated ponies demonstrated mucosal necrosis with microvascular hemorrhage and thrombosis. Thrombi occurred within the subepithelial capillaries and edema and hemorrhage developed throughout the mucosa and submucosa. Vascular casts allowed 3-D viewing of samples obtained from the entire pelvic flexure and demonstrated two d...
Steffey EP, Farver T, Zinkl J, Wheat JD, Meagher DM, Brown MP.Quantitative changes in hematologic and serum biochemical values associated with prolonged general anesthesia produced by known alveolar doses of halothane in oxygen were determined in six young, healthy horses under laboratory conditions. In addition, 25 young equine patients anesthetized for shorter periods under clinical conditions were similarly (except hematologic values) prospectively evaluated. In normal horses, muscle- and hepatic-derived serum biochemical values were mildly increased immediately after anesthesia. Values after anesthesia remained at greater than base-line values for up...
Stadler P, van den Berg SS, Tustin RC.A Hansen type I cervical intervertebral disc prolapse was diagnosed in a 16-year-old American Saddler showing clinical signs of paresis and ataxia. An ante-mortem diagnosis was made by means of plain radiographs and a myelogram. The horse was euthanased and the diagnosis confirmed on a post-mortem examination.
Findley JA, Salem S, Burgess R, Archer DC.Relaparotomy may be required to investigate and manage complications that occur following surgical management of colic. Objective: To report factors associated with survival following relaparotomy. Methods: Retrospective cohort study. Methods: Records of horses that had undergone exploratory laparotomy for treatment of colic over a 10-year period (2002-2012) and had undergone relaparotomy <8 weeks following the initial surgery were reviewed. Descriptive data were generated and association with survival time was modelled using Cox proportional hazards models. Results: Relaparotomy was perfor...
Greenberg CB, Javsicas LH, Clauson RM, Suckow MA, Kalinauskas AE, Lucroy MD.Autologous cancer vaccines (ACV) are an emerging option for adjuvant cancer treatment in veterinary medicine. With this form of active immunotherapy, the patient's tumor cells are processed ex vivo and returned to the patient with the goal of stimulating an immune response to unique, patient-specific antigens. The case accession database at Torigen was queried to identify horses that underwent biopsy or surgical resection of their primary tumor and received at least one subcutaneous dose of an adjuvanted whole-cell autologous cancer vaccine. The records were then reviewed for any reported adve...
Uhlhorn H, Eksell P, Carlsten J.A longitudinal scintigraphic and radiographic study of distal radial physeal activity in 14 Standardbred trotters was conducted to quantify and visually evaluate physeal uptake around the time of physeal closure. Initial intense 99mTc-HDP uptake was seen, followed by a rapid decrease of activity starting at a mean age of 20 months. Mean physeal to distal diaphyseal ROI and line profile ratios compared to ratios of mature horses decreased from 2.8 to 1.4 at the time of radiographic closure at 24-32 months. Ratios then gradually decreased until values of mature horses were reached at the end of ...
Hanson RR, Nixon AJ, Calderwood-Mays M, Gronwall R, Pendergast JF.Two techniques for end-to-end anastomosis of the small colon were evaluated in each of 6 horses. A simple interrupted suture pattern that excluded the mucosa and was oversewn with an inverting suture was compared with a triangulated double-row pattern of stainless steel staples. Anastomotic sites were evaluated at 2 weeks, 2 months, and 6 months for extent of abdominal adhesions, lumen diameter at anastomotic sites, bursting pressures, and healing response. Clinical postoperative complications were not associated with either technique. At postmortem examination, there was extensive adhesion fo...
Timoney PJ, McArdle JF, O'Reilly PJ, Ward J.Contagious equine metritis 1977 was reproduced in pony mares using cultures of the Gram-negative coccobacillus aetiologically associated with the disease. Variability in clinical response was observed in the first of 2 experiments, with the presence of semen, either alone or in an extender, appearing to potentiate the pathogenicity of the challenge strain of the organism. The experimental disease was characterised by a variable degree of vaginal discharge and concomitant inflammatory changes involving the vervix and vagina. Although all of the affected mares recovered spontaneously, a high per...
Rivas VN, Aleman M, Peterson JA, Dahlgren AR, Hales EN, Finno CJ.Juvenile idiopathic epilepsy (JIE) is an inherited disease characterized by recurrent seizures during the first year of life in Egyptian Arabian horses. Definitive diagnosis requires an electroencephalogram (EEG) performed by a veterinary specialist. A recent study has suggested that a 19 base-pair deletion, along with a triple-C insertion, in intron five of twelve (∆19InsCCC; chr20:29542397-29542425: GTTCAGGGGACCACATGGCTCTCTATAGA>TATCTTAAGACCC) of the () gene is associated with JIE. To confirm this association, a new sample set consisting of nine EEG-phenotyped affected and nine unaffec...
Turner AS, Yovich JV, White NA, Embertson RE, Santschi EM, Slone DE.A retrospective study was performed to evaluate the healing of ventral midline abdominal incisions, closed with a simple continuous suture pattern using absorbable suture material, in 139 horses and foals. Dehiscence and incisional hernia developed separately in two horses. The low incidence of dehiscence and incisional hernia, compared with their reported incidence following the use of interrupted suture repair, leads the authors to recommend this alternative method of abdominal incision closure in horses. The security of closure is not sacrificed and the advantages of a rapid closure are des...
Tuniyazi M, Wang W, Zhang N.Fecal microbiota transplantation (FMT) is a technique involving transferring fecal matter from a healthy donor to a recipient, with the goal of reinstating a healthy microbiome in the recipient's gut. FMT has been used in horses to manage various gastrointestinal disorders, such as colitis and diarrhea. To evaluate the current literature on the use of FMT in horses, including its efficacy, safety, and potential applications, the authors conducted an extensive search of several databases, including PubMed, MEDLINE, Web of Science, and Google Scholar, published up to 11 January 2023. The authors...
J Lacy K, Parlane NA, Riley CB, Gee EK, Roberts JM, McIlwraith CW.CellTrace Violet™ is a commonly used fluorescent dye used with flow cytometry to identify cell proliferation. Activated equine lymphocytes were examined using flow cytometry, microscopy and tritiated thymidine proliferation assays. CellTrace Violet™ was incorporated into the equine lymphocytes effectively. Equine lymphocytes proliferated when activated with pokeweed mitogen, but did not proliferate when previously stained with CellTrace Violet™. Serial dilutions of CellTrace Violet™ did not eliminate the inhibition of activated lymphocytes. Equine lymphocyte viability was greater than ...
Monteiro RA, Cunha RM, Guerra MMP, de Almeida VM, Peña-Alfaro CE, Silva SV.The aim of this study was to test equine semen cryopreservation techniques for the conservation of donkey germplasm. Ejaculates of three male donkeys were used (n = 18; six ejaculates per donkey; six repetitions), collected by the artificial vagina method. To remove the seminal plasma, the ejaculates were split and submitted to filtration or centrifugation methods. To assess the freezing method, each fraction was submitted to the automated system or the conventional system, and groups were formed: automated centrifuge, automated filtrate, conventional centrifuge and conventional filtrate. Af...
Smith PJ, Gum GG, Whitley RD, Samuelson DA, Brooks DE, Garcia-Sanchez GA.Tonometric and tonographic techniques were evaluated in the normal pony and compared to other species. Applanation tonometry was utilised to calculate the ocular ridigity of the normal equine eye. The mean intraocular pressure for the pony eye was established as 23.5 mm Hg (sd +/- 4.5). Comparing the non-anaesthetised and anaesthetised pony eye (xylazine-ketamine and glycerol guaiacolate) no significant change in intraocular pressure occurred (P < 0.49). Mean aqueous outflow facility was 0.88 microliter/min/mm Hg (sd +/- 0.65) which is significantly higher (P < 0.01) than the canine and ...
Enders F, Weber A.Fecal samples of 146 horses were culturally investigated for occurrence of Prototheca spp. using a selective medium, developed by PORE (1973). Prototheca zopfii could be isolated in monoculture from 9 fecal samples (6.2%). The results of this pilot study show that horses too can harbour and shed Prototheca spp. in variable frequency.