Analyze Diet

Topic:Alleles

Alleles in horses refer to the different versions of a gene that exist within the equine genome, contributing to the diversity of traits observed in horse populations. These genetic variations can influence a wide range of characteristics, including coat color, height, temperament, and susceptibility to certain diseases. Understanding alleles is crucial for breeding programs, as they help predict the inheritance of desirable traits and manage genetic disorders. Common examples include the alleles responsible for coat color variations, such as the Extension (E) and Agouti (A) loci. This page compiles peer-reviewed research studies and scholarly articles that explore the identification, function, and impact of alleles on equine genetics, offering insights into their role in shaping the phenotypic and health-related traits of horses.
Characterization of abortion, stillbirth and non-viable foals homozygous for the Warmblood Fragile Foal Syndrome.
Animal reproduction science    October 17, 2019   Volume 211 106202 doi: 10.1016/j.anireprosci.2019.106202
Aurich C, Müller-Herbst S, Reineking W, Müller E, Wohlsein P, Gunreben B, Aurich J.Warmblood fragile foal syndrome (WFFS) is a monogenetic defect with autosomal recessive inheritance. The WFFS homozygosity is non-compatible with extra-uterine life. Although as many as 15% of Warmblood horses are WFFS carriers, there has been little veterinary focus on this condition. The aim of this study was to determine outcomes and symptoms of clinical signs and pathological abnormalities during pregnancies when there were WFFS homozygous foetuses. Diagnostic material of 15 abortion or stillbirth cases with suspected diagnosis of WFFS was available for this study. Additionally, there were...
TRIM39-RPP21 Variants (∆19InsCCC) Are Not Associated with Juvenile Idiopathic Epilepsy in Egyptian Arabian Horses.
Genes    October 16, 2019   Volume 10, Issue 10 816 doi: 10.3390/genes10100816
Rivas VN, Aleman M, Peterson JA, Dahlgren AR, Hales EN, Finno CJ.Juvenile idiopathic epilepsy (JIE) is an inherited disease characterized by recurrent seizures during the first year of life in Egyptian Arabian horses. Definitive diagnosis requires an electroencephalogram (EEG) performed by a veterinary specialist. A recent study has suggested that a 19 base-pair deletion, along with a triple-C insertion, in intron five of twelve (∆19InsCCC; chr20:29542397-29542425: GTTCAGGGGACCACATGGCTCTCTATAGA>TATCTTAAGACCC) of the () gene is associated with JIE. To confirm this association, a new sample set consisting of nine EEG-phenotyped affected and nine unaffec...
Warmblood fragile foal syndrome type 1 mutation (PLOD1 c.2032G>A) is not associated with catastrophic breakdown and has a low allele frequency in the Thoroughbred breed.
Equine veterinary journal    October 4, 2019   Volume 52, Issue 3 411-414 doi: 10.1111/evj.13182
Bellone RR, Ocampo NR, Hughes SS, Le V, Arthur R, Finno CJ, Penedo MCT.Catastrophic fractures are among the most common cause of fatalities in racehorses. Several factors, including genetics, likely contribute to increased risk for fatal injuries. A variant in the procollagen-lysine, 2-oxoglutarate 5-dioxygenase1 gene (PLOD1 c.2032G>A) was shown to cause Warmblood fragile foal syndrome type 1 (WFFS), a fatal recessive defect of the connective tissue. Screening of multiple horse breeds identified the presence of the WFFS allele in the Thoroughbred. PLOD1 is involved in cross-linking of collagen fibrils and thus could potentially increase the risk of catastrophic b...
A novel 13-plex STR typing system for individual identification and parentage testing of donkeys (Equus asinus).
Equine veterinary journal    September 5, 2019   Volume 52, Issue 2 290-297 doi: 10.1111/evj.13158
Dang W, Shang S, Zhang X, Yu Y, Irwin DM, Wang Z, Zhang S.Previous studies investigating donkey parentage and genetic diversity used horse-specific multiplex systems. However, several mis-allele and null-allele issues were found with some of the horse primers when used in donkeys. In 2017, the International Society for Animal Genetics (ISAG) recommended 13 dinucleotide short tandem repeats (STRs) (AHT4, ASB23, HMS2, HMS3, HMS6, HMS7, HMS18, HTG7, HTG10, TKY297, TKY312, TKY337 and TKY343) as a core panel that should be used to identify individuals and to test for parentage in donkeys. To date, no single multiplex STR typing system containing all 13 do...
Previously Identified Genetic Variants in ADGRL3 Are not Associated with Risk for Equine Degenerative Myeloencephalopathy across Breeds.
Genes    September 5, 2019   Volume 10, Issue 9 doi: 10.3390/genes10090681
Marquardt SA, Wilcox CV, Burns EN, Peterson JA, Finno CJ.Equine neuroaxonal dystrophy/equine degenerative myeloencephalopathy (eNAD/EDM) is a neurologic disease that has been reported in young horses from a wide range of breeds. The disease is inherited and associated with vitamin E deficiency during the first two years of life, resulting in bilateral symmetric ataxia. A missense mutation (chr3:71,917,591 C > T) within adhesion G protein-coupled receptor L3 (ADGRL3) was recently associated with risk for EDM in the Caspian breed. In order to confirm these findings, genotyping of this missense mutation, along with the three other associated single nuc...
Genome-wide association study for insect bite hypersensitivity susceptibility in horses revealed novel associated loci on chromosome 1.
Journal of animal breeding and genetics = Zeitschrift fur Tierzuchtung und Zuchtungsbiologie    September 5, 2019   Volume 137, Issue 2 223-233 doi: 10.1111/jbg.12436
Shrestha M, Solé M, Ducro BJ, Sundquist M, Thomas R, Schurink A, Eriksson S, Lindgren G.Equine insect bite hypersensitivity (IBH) is a pruritic skin allergy caused primarily by biting midges, Culicoides spp. IBH susceptibility has polygenic inheritance and occurs at high frequencies in several horse breeds worldwide, causing increased costs and reduced welfare of affected horses. The aim of this study was to identify and validate single nucleotide polymorphisms (SNPs) associated with equine IBH susceptibility. After quality control, 33,523 SNPs were included in a Bayesian genome-wide association study on 177 affected and 178 unaffected Icelandic horses. We report associated regio...
Equine arteritis virus long-term persistence is orchestrated by CD8+ T lymphocyte transcription factors, inhibitory receptors, and the CXCL16/CXCR6 axis.
PLoS pathogens    July 29, 2019   Volume 15, Issue 7 e1007950 doi: 10.1371/journal.ppat.1007950
Carossino M, Dini P, Kalbfleisch TS, Loynachan AT, Canisso IF, Cook RF, Timoney PJ, Balasuriya UBR.Equine arteritis virus (EAV) has the unique ability to establish long-term persistent infection in the reproductive tract of stallions and be sexually transmitted. Previous studies showed that long-term persistent infection is associated with a specific allele of the CXCL16 gene (CXCL16S) and that persistence is maintained despite the presence of local inflammatory and humoral and mucosal antibody responses. Here, we performed transcriptomic analysis of the ampullae, the primary site of EAV persistence in long-term EAV carrier stallions, to understand the molecular signatures of viral persiste...
In silico and in vitro analysis of genetic variants of the equine CYP3A94, CYP3A95 and CYP3A97 isoenzymes.
Toxicology in vitro : an international journal published in association with BIBRA    May 17, 2019   Volume 60 116-124 doi: 10.1016/j.tiv.2019.05.011
Vimercati S, Elli S, Jagannathan V, Pandey AV, Peduto N, Leeb T, Mevissen M.Cytochrome P450 enzymes (CYPs) of the equine CYP3A subfamily are predominantly involved in drug metabolism. In this study, genetic variants of the equine CYP3A94, CYP3A95, and CYP3A97 were identified and characterized using in silico modeling and in vitro enzyme kinetics. The genomes of 81 horses were sequenced to obtain the genetic variants. Structural CYP modifications of the most frequent variants were analyzed in silico using the 3D-structures predicted by homology modeling. Enzyme kinetic analyses were performed using testosterone as substrate. Twenty genetic variants were found including...
MHC haplotype diversity in Icelandic horses determined by polymorphic microsatellites.
Genes and immunity    May 9, 2019   Volume 20, Issue 8 660-670 doi: 10.1038/s41435-019-0075-y
Holmes CM, Violette N, Miller D, Wagner B, Svansson V, Antczak DF.The Icelandic horse has been maintained as a closed population in its eponymous homeland for many generations, with no recorded introductions of new horses of any breed since the year 1000 CE. Here we determined the diversity of major histocompatibility complex (MHC) haplotypes in 156 Icelandic horses from two groups, based on a panel of 12 polymorphic intra-MHC microsatellites tested in families of various composition. We identified a total of 79 MHC haplotypes in these two groups, including one documented intra-MHC recombination event from a total of 147 observed meioses. None of these MHC h...
Warmblood Fragile Foal Syndrome causative single nucleotide polymorphism frequency in Warmblood horses in Brazil.
Veterinary journal (London, England : 1997)    May 4, 2019   Volume 248 101-102 doi: 10.1016/j.tvjl.2019.05.002
Dias NM, de Andrade DGA, Teixeira-Neto AR, Trinque CM, Oliveira-Filho JP, Winand NJ, Araújo JP, Borges AS.Warmblood Fragile Foal Syndrome (WFFS) is an autosomal recessive genetic disorder caused by a mutation in the procollagen-lysine, 2-oxoglutarate 5-dioxygenase 1 (PLOD1) gene, associated with collagen biosynthesis. WFFS causes lesions and malformations of the skin in neonatal foals, and abortion. The objective of this study was to investigate the allelic frequency of the single nucleotide polymorphism (SNP) c.2032G>A in the PLOD1 gene in warmblood samples from Brazil. Of the 374 Warmblood horses tested, 41 animals (11%) were identified as heterozygous for the WFFS SNP and 333 (89%) were homozyg...
Genetic screening for cerebellar abiotrophy, severe combined immunodeficiency and lavender foal syndrome in Arabian horses in Poland.
Veterinary journal (London, England : 1997)    April 27, 2019   Volume 248 71-73 doi: 10.1016/j.tvjl.2019.04.012
Bugno-Poniewierska M, Stefaniuk-Szmukier M, -Kajtoch AP, Fornal A, Piórkowska K, Ropka-Molik K.The highly selective breeding of Arabian horses results in inbreeding depression and genetic disorders, thereby causing significant economic loss. The Polish population of Arabians has a great impact on many breeding programmes. The aim of the current study was to monitor genetic variants involved in the most common genetic disorders of this breed. A total of 808 elite Arabian horses were screened for cerebellar abiotrophy (CA), severe combined immunodeficiency (SCID) and lavender foal syndrome (LFS) genetic disorders by Sanger sequencing and allelic discrimination methods. The investigated po...
Genetic analysis of Streptococcus equi subsp. equi isolated from horses imported into Japan.
The Journal of veterinary medical science    April 24, 2019   Volume 81, Issue 6 924-927 doi: 10.1292/jvms.18-0656
Kasuya K, Tanaka N, Oshima F, Fujisawa N, Saito M, Tagami K, Niwa H, Sasai K.Strangles is a commonly diagnosed and important infectious disease of equids worldwide, caused by Streptococcus equi subsp. equi. We determined the SeM genotypes of S. equi isolated from imported horses at the Japanese border within the past 8 years, which allowed us to classify 12 strains isolated from these horses from each exporter into four allelic groups. These alleles were different from the alleles of past isolates found in Japan. Furthermore, four strains classified into the same allele were isolated from horses from one exporter over several years. In this study, S. equi isolates from...
A candidate gene approach identifies variants in SLC45A2 that explain dilute phenotypes, pearl and sunshine, in compound heterozygote horses.
Animal genetics    April 21, 2019   Volume 50, Issue 3 271-274 doi: 10.1111/age.12790
Holl HM, Pflug KM, Yates KM, Hoefs-Martin K, Shepard C, Cook DG, Lafayette C, Brooks SA.Variations in the SLC45A2 gene are responsible for the dilution phenotypes cream and pearl in domestic horses. Cream dilution is inherited in an incomplete dominant manner, diluting only red in the heterozygous state but both red and black pigments when two alleles are present. The pearl dilution is recessive and dilutes only the red and black pigment in the homozygous state or when paired with a cream allele. Horses that inherit one copy of pearl (C ) and one copy of the dominant cream allele (C ) display a dilution phenotype similar to that of homozygous cream, suggesting that pearl is the ...
Modelling the development of anthelmintic resistance in cyathostomin parasites: The importance of genetic and fitness parameters.
Veterinary parasitology    April 17, 2019   Volume 269 28-33 doi: 10.1016/j.vetpar.2019.04.007
Sauermann CW, Nielsen MK, Luo D, Leathwick DM.Previously described models for the free-living and parasitic phases of the cyathostomin life-cycle were combined into a single model for the complete life-cycle. The model simulates a single free-living population on pasture utilising parasite egg output from the horses and localised temperature and rainfall data to estimate infective larval density on herbage. Multiple horses of different ages are possible, each with an individualised anthelmintic treatment programme. Genotypes for anthelmintic resistance are included allowing for up to three resistance genes with 2 alleles each. Because lit...
A missense mutation in damage-specific DNA binding protein 2 is a genetic risk factor for ocular squamous cell carcinoma in Belgian horses.
Equine veterinary journal    April 15, 2019   Volume 52, Issue 1 34-40 doi: 10.1111/evj.13116
Knickelbein KE, Lassaline ME, Singer-Berk M, Reilly CM, Clode AB, Famula TR, Michau TM, Bellone RR.Belgian horses are commonly affected with ocular squamous cell carcinoma (SCC), the most common cancer of the equine eye. A missense mutation in damage-specific DNA binding protein 2 (DDB2 c.1013C>T, p.Thr338Met) has been established as a recessive genetic risk factor for ocular SCC in the Haflinger breed. A sample of Belgian horses with unknown SCC phenotype was shown to possess this variant at a similar frequency to the Haflinger breed. Retrospective studies indicate that chestnut coat colour may predispose to the development of SCC. Objective: To determine if DDB2 c.1013C>T is a risk ...
Explicit evidence for a missense mutation in exon 4 of SLC45A2 gene causing the pearl coat dilution in horses.
Animal genetics    April 10, 2019   Volume 50, Issue 3 275-278 doi: 10.1111/age.12784
Sevane N, Sanz CR, Dunner S.Four loci seem responsible for the dilution of the basic coat colours in horse: Dun (D), Silver Dapple (Z), Champagne (CH) and Cream (C). Apart from the current phenotypes ascribed to these loci, pearl has been described as yet another diluted coat colour in this species. To date, this coat colour seems to segregate only in the Iberian breeds Purebred Spanish horse and Lusitano and has also been described in breeds of Iberian origin, such as Quarter Horses and Paint Horse, where it is referred to as the 'Barlink Factor'. This phenotype segregates in an autosomal recessive manner and resembles ...
Comparing assignment-based approaches to breed identification within a large set of horses.
Journal of applied genetics    April 8, 2019   Volume 60, Issue 2 187-198 doi: 10.1007/s13353-019-00495-x
Putnová L, Štohl R.Considering the extensive data sets and statistical techniques, animal breeding embodies a branch of machine learning that has a constantly increasing impact on breeding. In our study, information regarding the potential of machine learning and data mining within a large set of horses and breeds is presented. The individual assignment methods and factors influencing the success rate of the procedure are compared at the Czech population scale. The fixation index values ranged from 0.057 (HMS1) to 0.144 (HTG6), and the overall genetic differentiation amounted to 8.9% among the breeds. The highes...
Genetic characteristics of feral Misaki horses based on polymorphisms of microsatellites and mitochondrial DNA.
The Journal of veterinary medical science    March 12, 2019   Volume 81, Issue 5 707-711 doi: 10.1292/jvms.18-0565
Kobayashi I, Akita M, Takasu M, Tozaki T, Kakoi H, Nakamura K, Senju N, Matsuyama R, Horii Y.The Misaki horse is a Japanese native horse, known as the "feral horse of Cape Toi". In this study, we acquired the genetic information to establish their studbook, and analyzed their genetic characteristics for conservation. We genotyped 32 microsatellites and a mitochondrial D-loop region in 77 Misaki horses (80.2% of the population). The average number of alleles, observed heterozygosity, and expected heterozygosity were 3.4, 0.509, and 0.497, respectively. A neighbor-joining phylogenetic tree of individuals was constructed. Moreover, the results suggested that Misaki horses experienced a b...
Synergy between MC1R and ASIP for coat color in horses (Equus caballus)1.
Journal of animal science    February 21, 2019   Volume 97, Issue 4 1578-1585 doi: 10.1093/jas/skz071
Shang S, Yu Y, Zhao Y, Dang W, Zhang J, Qin X, Irwin DM, Wang Q, Liu F, Wang Z, Zhang S, Wang Z.Through domestication and human selection, horses have acquired various coat colors, including seven phenotypes: black, brown, dark bay, bay, chestnut, white, and gray. Here we determined the genotypes for melanocortin-1 receptor (MC1R) and agouti signaling protein (ASIP) in 709 horses from 15 breeds. We found that the EEEE genotype frequency at MC1R decreased from dark to light colors (black = 64.5%, brown = 67.5%, dark bay = 47.0%, bay = 16.5%, and chestnut = 0.0%), whereas the AAAA genotype frequency at ASIP increased as coat color lightened (black = 0.0%, brown = 22.9%, dark bay = 69.2%, a...
Comparative population genomics unveils candidate genes for athletic performance in Hanoverians.
Genome    February 19, 2019   Volume 62, Issue 4 279-285 doi: 10.1139/gen-2018-0151
Asadollahpour Nanaei H, Ayatollahi Mehrgardi A, Esmailizadeh A.Equine athletes have a genetic heritage that has been evolved for millions of years, which provides an opportunity to study the genetics of locomotion pattern and performance in mammals. The Hanoverian, a breed originating in Germany, is arguably among the most athletic of horse breeds, as well as possessing a balanced character and beautiful appearance. Here, we compared the whole genomes of Hanoverian with three other horse breeds (Akhal-Teke, Franches-Montagnes, and Standardbred), using the fixation index (Fst) and cross-population composite likelihood ratio (XP-CLR) methods for testing the...
A genome-wide scan for diversifying selection signatures in selected horse breeds.
PloS one    January 30, 2019   Volume 14, Issue 1 e0210751 doi: 10.1371/journal.pone.0210751
Gurgul A, Jasielczuk I, Semik-Gurgul E, Pawlina-Tyszko K, Stefaniuk-Szmukier M, Szmatoła T, Polak G, Tomczyk-Wrona I, Bugno-Poniewierska M.The genetic differentiation of the current horse population was evolutionarily created by natural or artificial selection which shaped the genomes of individual breeds in several unique ways. The availability of high throughput genotyping methods created the opportunity to study this genetic variation on a genome-wide level allowing detection of genome regions divergently selected between separate breeds as well as among different horse types sharing similar phenotypic features. In this study, we used the population differentiation index (FST) that is generally used for measuring locus-specifi...
Evaluation of an HMGA2 variant for pleiotropic effects on height and metabolic traits in ponies.
Journal of veterinary internal medicine    January 21, 2019   Volume 33, Issue 2 942-952 doi: 10.1111/jvim.15403
Norton EM, Avila F, Schultz NE, Mickelson JR, Geor RJ, McCue ME.Ponies are highly susceptible to metabolic derangements including hyperinsulinemia, insulin resistance, and adiposity. Objective: Genetic loci affecting height in ponies have pleiotropic effects on metabolic pathways and increase the susceptibility to equine metabolic syndrome (EMS). Methods: Two hundred ninety-four Welsh ponies and 529 horses. Methods: Retrospective study of horses phenotyped for metabolic traits. Correlations between height and metabolic traits were assessed by Pearson's correlation coefficients. Complementary genome-wide analysis methods were used to identify a region of in...
Exome sequencing in genomic regions related to racing performance of Quarter Horses.
Journal of applied genetics    January 21, 2019   Volume 60, Issue 1 79-86 doi: 10.1007/s13353-019-00483-1
Pereira GL, Malheiros JM, Ospina AMT, Chardulo LAL, Curi RA.Among horses selected for speed, the racing line of Quarter Horses is characterized by high performance in sprint races, with these animals being considered the fastest horses in the world. However, few studies have investigated in more detail the polymorphisms and genes that act on this trait. The objective of this study was to analyze exomes and UTRs in regions previously associated with this trait by GWAS in Quarter Horse racehorses with contrasting maximum speed index (SImax), prospecting causal gene polymorphisms that are related to or are in strong linkage disequilibrium with racing perf...
Prevalence of the E321G MYH1 variant for immune-mediated myositis and nonexertional rhabdomyolysis in performance subgroups of American Quarter Horses.
Journal of veterinary internal medicine    January 8, 2019   Volume 33, Issue 2 897-901 doi: 10.1111/jvim.15393
Gianino GM, Valberg SJ, Perumbakkam S, Henry ML, Gardner K, Penedo C, Finno CJ.Immune-mediated myositis (IMM) in American Quarter Horses (QHs) causes acute muscle atrophy and lymphocytic infiltration of myofibers. Recently, an E321G mutation in a highly conserved region of the myosin heavy chain 1 (MYH1) gene was associated with susceptibility to IMM and nonexertional rhabdomyolysis. Objective: To estimate prevalence of the E321G MYH1 variant in the QH breed and performance subgroups. Methods: Three-hundred seven elite performance QHs and 146 random registered QH controls. Methods: Prospective genetic survey. Elite QHs from barrel racing, cutting, halter, racing, reining...
TBX3 and ASIP genotypes reveal discrepancies in officially recorded coat colors of Hucul horses.
Animal : an international journal of animal bioscience    January 7, 2019   Volume 13, Issue 9 1811-1816 doi: 10.1017/S1751731118003506
Mackowski M, Wodas L, Brooks SA, Cieslak J.Although only a few specific pigmentation types are allowed within the Hucul horse registry, accurate determination of particular coat colors can be uncertain due to the presence of variation in color shades and segregation of multiple dun dilution variants. Herein, we genotyped the previously identified polymorphisms within two coat color loci TBX3 (T-box 3) and ASIP (Agouti Signaling Protein) in 462 Hucul individuals and compared the genotype predicted phenotypes with observed pigmentation types provided in the Polish Horse Breeders Association database. We identified disagreement between th...
Development and validation of a novel 13-plex PCR system for commonly used short tandem repeats in horses (Equus caballus).
Equine veterinary journal    December 20, 2018   Volume 51, Issue 5 688-695 doi: 10.1111/evj.13047
Shang S, Zhang M, Zhao Y, Dang W, Hua P, Zhang S, Wang Z.Due to the thriving development of the modern horse industry and the occurrence of horse related crimes, the demand for methods of individual horse identification, parentage tests and other genetic analyses is increasing. Previous methods had disadvantages that decreased the accuracy of the results, lacked the inclusion of all commonly used short tandem repeats (STR) or increased the experimental cost and time. Objective: We aimed to develop a novel 13-plex STR typing system to resolve the above issues. Methods: Experimental study. Methods: Twelve autosomal and most commonly used di-nucleotide...
Genetic analyses for conservation of the traditional Tokara horse using 31 microsatellite markers.
Journal of equine science    December 18, 2018   Volume 29, Issue 4 97-104 doi: 10.1294/jes.29.97
Senokuchi A, Ishikawa S, Tozaki T, Takasu M, Kakoi H, Misumi K, Hobo S.In order to promote conservation of the traditional Tokara horse in its remaining three breeding areas in Japan (Nakanoshima, Kaimondake, and Iriki), we genotyped 123 horses using 31 microsatellite markers and determined their genetic diversity. On average, the number of alleles (N), observed heterozygosity (H), expected heterozygosity (H), and inbreeding coefficient (F) among all horses were 3.0, 0.424, 0.481, and 0.108, respectively. Compared with other endangered horse breeds, we found that, even though the size of the Tokara horse population has recently increased, the N, H, and H of Tokar...
Evaluation of recent changes in genetic variability in Japanese thoroughbred population based on a short tandem repeat parentage panel.
Animal science journal = Nihon chikusan Gakkaiho    December 16, 2018   Volume 90, Issue 2 151-157 doi: 10.1111/asj.13143
Kakoi H, Kikuchi M, Tozaki T, Hirota KI, Nagata SI.The integrity of thoroughbreds is maintained under strict regulation involving DNA parentage testing, which is robust in a population with high genetic variability. The genetic variability of the thoroughbred population is possibly fluctuating because of selective breeding that has focused on adaptations for racing performance. To monitor genetic variability within the population and the effectiveness of short tandem repeat (STR) parentage testing, we investigated allele frequencies and the exclusion probability (PE) of 16-17 loci of a parentage panel in the Japanese thoroughbred population ov...
Comprehensive characterization of horse genome variation by whole-genome sequencing of 88 horses.
Animal genetics    December 7, 2018   Volume 50, Issue 1 74-77 doi: 10.1111/age.12753
Jagannathan V, Gerber V, Rieder S, Tetens J, Thaller G, Drögemüller C, Leeb T.Whole-genome sequencing studies are vital to gain a thorough understanding of genomic variation. Here, we summarize the results of a whole-genome sequencing study comprising 88 horses and ponies from diverse breeds at 19.1× average coverage. The paired-end reads were mapped to the current EquCab3.0 horse reference genome assembly, and we identified approximately 23.5 million single nucleotide variants and 2.3 million short indel variants. Our dataset included at least 7 million variants that were not previously reported. On average, each individual horse genome carried ∼5.7 million single n...
Variation in the MC1R, ASIP, and MATP genes responsible for coat color in Kiso horse as determined by SNaPshot™ genotyping.
The Journal of veterinary medical science    November 22, 2018   Volume 81, Issue 1 100-102 doi: 10.1292/jvms.18-0458
Nakamura K, Tozaki T, Kakoi H, Owada S, Takasu M.Kiso horse is a breed of Japanese native horses. In this study, to clarify coat color gene variation in Kiso horses, we used SNaPshot™ genotyping to evaluate variation in MC1R, ASIP, and MATP genes at the Extension (E), Agouti (A), and Cream dilution (C) loci. The coat color of 149 horses was documented. The coat color of 140, 3, and 6 horses was bay, chestnut, and buckskin, respectively. Furthermore, the frequency of alleles E, e, A, a, C, and Cr was 0.80, 0.20, 0.86, 0.14, 0.98, and 0.02, respectively. Current status of coat color genes in Kiso horses was clarified, and this information wi...
1 4 5 6 7 8 22