Analyze Diet

Topic:Diagnosis

Diagnosis in horses involves the systematic identification of diseases and conditions affecting equine health. This process relies on a combination of clinical evaluations, laboratory tests, imaging techniques, and other diagnostic tools to assess the health status of horses. Veterinarians utilize these methods to identify symptoms, determine the underlying causes of health issues, and formulate appropriate treatment plans. Diagnostic procedures in equine medicine can include blood tests, ultrasound, radiography, endoscopy, and more specialized tests such as genetic screening or advanced imaging modalities like MRI and CT scans. This page aggregates peer-reviewed research studies and scholarly articles that explore various diagnostic techniques, their applications, and advancements in the field of equine veterinary medicine.
What is your diagnosis? Nasal lesion in a horse with exophthalmos.
Veterinary clinical pathology    November 7, 2019   Volume 48, Issue 4 771-773 doi: 10.1111/vcp.12790
Zibura AE, Manning LK, Gwynn A, Sharkey L, de Linde Henriksen M, Coppelman E, O'Brien TD.No abstract available
Disease investigations for equine infectious anemia in Canada (2009-2012) – Retrospective evaluation and risk factor analysis.
The Canadian veterinary journal = La revue veterinaire canadienne    November 7, 2019   Volume 60, Issue 11 1199-1206 
Lohmann KL, James CR, Higgins SN, Howden KJ, Epp T.This retrospective study describes the detection of equine infectious anemia (EIA) during Canadian Food Inspection Agency (CFIA) disease investigations in Canada, examines aspects of importance for disease control, and evaluates potential animal-level risk factors for EIA in high-risk horses. Based on review of all EIA-positive samples and all samples collected during disease investigations (N = 4553) over a 4-year period (2009 to 2012), 409 EIA cases were detected. Horse owners with EIA cases owned between 1 and 60 affected animals, and 49 horses seroconverted during a disease investigation p...
Response to thyrotropin-releasing hormone (TRH) in a horse with hyperthyroidism associated with a functional thyroid adenoma.
The Canadian veterinary journal = La revue veterinaire canadienne    November 7, 2019   Volume 60, Issue 11 1189-1193 
Costello J, Firshman AM, Brown JC, Maher M, Tadros EM.A 16-year-old American Paint Horse gelding was presented for evaluation of weight loss and high serum thyroid hormone concentrations resulting from a functional thyroid adenoma. The horse showed no response to a thyrotropin-releasing hormone (TRH) stimulation test. Clinical signs resolved following surgical removal of the adenoma. . Un cheval American Paint Horse hongre âgé de 16 ans fut présenté pour évaluation à la suite d’une perte de poids et d’une concentration sérique élevée d’hormone thyroïdienne résultant d’un adénome thyroïdien fonctionnel. Le cheval ne démontrai...
Serum protein concentrations and protein fractions in clinically healthy Italian Heavy Draft Horses using agarose gel electrophoresis.
Veterinary clinical pathology    November 3, 2019   Volume 48, Issue 4 677-682 doi: 10.1111/vcp.12793
Miglio A, Morelli C, Maresca C, Felici A, Di Gianbattista A, Antognoni MT.Serum protein electrophoresis (SPE) reference intervals (RIs) have been evaluated in different horses, but no specific values are shown for equine breeds as previously described in other species (dogs, cats), and no studies have been performed on SPE in draft horses. Objective: This study aimed to determine RIs for SPE in heavy draft horses (Italian Heavy Draft Horse-IHDH) living in central Italy. A comparison between different physiologic states (pregnancy and no pregnancy) and ages (foals and adults) was executed. Methods: Blood samples were collected from 215 apparently healthy horses (mare...
Skin Disorders of the Donkey and Mule.
The Veterinary clinics of North America. Equine practice    November 2, 2019   Volume 35, Issue 3 493-514 doi: 10.1016/j.cveq.2019.08.006
Knottenbelt DC.Skin disease in donkeys is less common than in horses, but is easily overlooked. Little published material exists on this important area of equine medicine. Skin tumors continue to challenge veterinarians working with donkeys. This article outlines the main disease entities that the author has encountered, although there are many other diseases and disorders that occur in different parts of the world that are not yet appreciated. When investigating a skin disease, a logical and comprehensive clinical approach should always be made; many conditions are similar in clinical presentation or are co...
Donkey and Mule Behavior.
The Veterinary clinics of North America. Equine practice    November 2, 2019   Volume 35, Issue 3 575-588 doi: 10.1016/j.cveq.2019.08.010
McLean AK, Navas González FJ, Canisso IF.Donkeys and mules often are misunderstood because of their behavioral differences compared with horses. Working with these animals requires more patience and ability to notice the slightest changes in behavior to diagnose disease. Mules and donkeys form strong bonds and trust with familiar people and other equids. Training mules and hinnies from an early age is key to modifying behavior and acceptance of unfamiliar people. Reproductive behavior is different from that of horses and requires more patience when collecting jacks. Practitioners working with mules and donkeys should take a methodolo...
Clinical Pathology of Donkeys and Mules.
The Veterinary clinics of North America. Equine practice    November 2, 2019   Volume 35, Issue 3 433-455 doi: 10.1016/j.cveq.2019.08.002
Goodrich EL, Behling-Kelly E.Given the stoic nature of donkeys and their hybrids, it is important to consider the significance of diagnostic testing modalities that can provide objective health status information beyond the basic physical examination findings. However, clinical pathology assays are also fraught with significant limitations because the results for donkeys, mules, and hinnies can be difficult to interpret, and transference of data from the horse is not always applicable. This article presents considerations for sample collection, storage, analysis, and interpretation strategies for clinical pathology testin...
The effect of equine herpesvirus type 4 on type-I interferon signaling molecules.
Veterinary immunology and immunopathology    November 2, 2019   Volume 219 109971 doi: 10.1016/j.vetimm.2019.109971
Oladunni FS, Reedy S, Balasuriya UBR, Horohov DW, Chambers TM.Equine herpesvirus type 4 (EHV-4) is mildly pathogenic but is a common cause of respiratory disease in horses worldwide. We previously demonstrated that unlike EHV-1, EHV-4 is not a potent inducer of type-I IFN and does not suppress that IFN response, especially during late infection, when compared to EHV-1 infection in equine endothelial cells (EECs). Here, we investigated the impact of EHV-4 infection in EECs on type-I IFN signaling molecules at 3, 6, and 12 hpi. Findings from our study revealed that EHV-4 did not induce nor suppress TLR3 and TLR4 expression in EECs at all the studied time...
Cutaneous Leishmaniosis caused by Leishmania martiniquensis in a Horse in Florida.
Journal of comparative pathology    October 31, 2019   Volume 173 13-18 doi: 10.1016/j.jcpa.2019.09.011
Menezes RC, Campos MP, Popielarczyk M, Kiupel M.We report a new case of cutaneous leishmaniosis caused by Leishmania (Mundinia) martiniquensis in a horse in Florida, USA. A 10-year-old neutered male Quarter horse was presented with multifocal to coalescing, raised, ulcerated and oozing, non-healing wounds on both pinnae of several weeks' duration. After a few months, the lesions regressed spontaneously. Biopsies of the lesions were performed with microscopical findings of epidermal hyperplasia with multifocal ulceration and focally extensive, dermal pyogranulomatous inflammation with numerous intact and degenerate neutrophils being surround...
Assessment of Leishmania infantum infection in equine populations in a canine visceral leishmaniosis transmission area.
BMC veterinary research    October 30, 2019   Volume 15, Issue 1 381 doi: 10.1186/s12917-019-2108-1
Escobar TA, Dowich G, Dos Santos TP, Zuravski L, Duarte CA, Lübeck I, Manfredini V.Leishmaniosis, zoonosis that produces significant public health impacts, is caused by Leishmania infantum. Canines are the main domestic reservoir and, besides humans, other species of mammals could be infected when living in endemic areas. In this study, we detected equine Leishmania infantum infections in a canine visceral leishmaniosis transmission area and evaluated the clinical, haematological, biochemical and oxidative stress disorders. This study was conducted in Uruguaiana, Rio Grande do Sul, south of Brazil. Peripheral blood samples were collected from 124 animals (98 horses and 26 do...
Enteroinsular axis response to carbohydrates and fasting in healthy newborn foals.
Journal of veterinary internal medicine    October 30, 2019   Volume 33, Issue 6 2752-2764 doi: 10.1111/jvim.15641
Rings LM, Swink JM, Dunbar LK, Burns TA, Toribio RE.The enteroinsular axis (EIA) comprises intestinal factors (incretins) that stimulate insulin release after PO ingestion of nutrients. Glucose-dependent insulinotropic polypeptide (GIP) and glucagon-like peptide-1 (GLP-1) are the main incretins. The EIA has not been investigated in healthy neonatal foals but should be important because energy demands are high in healthy foals and dysregulation is frequent in sick foals. Objective: To evaluate the EIA response to carbohydrates or fasting in newborn foals. We hypothesized that incretin secretion would be higher after PO versus IV carbohydrate adm...
African horse sickness: a potential threat to the UK.
The Veterinary record    October 28, 2019   Volume 185, Issue 16 501-503 doi: 10.1136/vr.l6189
The UK has never experienced an outbreak of African horse sickness but, as Matthew Robin of the Fyrnwy Equine Clinic explains, there is still a risk of a case occurring.
Nonsurgical and surgical management of metacarpo/metatarsophalangeal joint dorsal chip fracture in the Thoroughbred racehorse.
Equine veterinary journal    October 28, 2019   Volume 52, Issue 3 399-403 doi: 10.1111/evj.13185
Ramzan PHL, Wylie CE.Arthroscopy is considered the treatment of choice for dorsal osteochondral chip fractures of the metacarpo/metatarsophalangeal (MCP/MTP) joints in the racehorse; however, there is no published research on non-surgical management of this injury. Objective: To compare clinical features, intra-articular medication use and return to racing in Thoroughbred racehorses with non-surgically (non-SX) or surgically (SX) managed MCP/MTP dorsal chip fracture. Methods: Retrospective observational study conducted between 2006 and 2014. Methods: Radiographs of Thoroughbred racehorses were reviewed to identify...
Atrial premature depolarisations five days post electrical cardioversion are related to atrial fibrillation recurrence risk in horses.
Equine veterinary journal    October 24, 2019   Volume 52, Issue 3 374-378 doi: 10.1111/evj.13186
Vernemmen I, De Clercq D, Decloedt A, Vera L, Van Steenkiste G, van Loon G.The number of atrial premature depolarisations (APDs) is a known risk factor for atrial fibrillation (AF) recurrence in humans. Objective: To evaluate if the number of APDs over a 24-h period 5 days post cardioversion predicts AF recurrence within 1 year in horses, taking the multifactorial nature of AF into account. Methods: Retrospective case series. Methods: Eighty horses met these inclusion criteria: first AF episode, no AF recurrence within 5 days post cardioversion, cardioversion by transvenous electrical cardioversion (TVEC), 24-h ECG recording and echocardiographic examination 5 da...
Influence of digital hypothermia on lamellar events related to IL-6/gp130 signalling in equine sepsis-related laminitis.
Equine veterinary journal    October 24, 2019   Volume 52, Issue 3 441-448 doi: 10.1111/evj.13184
Dern K, Burns TA, Watts MR, van Eps AW, Belknap JK.Interleukin-6 (IL-6) is consistently increased in the digital lamellae in different studies of sepsis-related laminitis (SRL). IL-6 signalling through the gp130 receptor activates similar signalling (i.e. mTORC1-related signalling) previously reported to be activated in models of endocrinopathic laminitis. Objective: To assess the activation state of signalling proteins downstream of IL-6/gp130 receptor complex activation in an experimental model of SRL. Methods: Randomised experimental study. Methods: Lamellar phospho-(P) protein concentrations downstream of the IL-6/gp130 receptors were asse...
Plasma adrenocorticotropic hormone concentration in horses decreases after freezing for 60 days. Haffner JC, Neal DL, Hoffman RM, Grubbs ST.We investigated the stability of adrenocorticotropic hormone (ACTH) in plasma after freezing for different lengths of time. The plasma ACTH concentrations of 12 horses were measured on day 0 (baseline) and over time, after stimulation with thyrotropin-releasing hormone. Samples were stored at -80°C for 3, 7, 30, 60, and 90 d, or at -20°C for 3, 7, 30, and 60 d, or between ice packs at -20°C for 3 and 7 d prior to determination of ACTH concentration. ACTH concentrations were compared to baseline (non-frozen day 0 plasma) for each storage method using a mixed model with repeated measure...
Antigen array for serological diagnosis and novel allergen identification in severe equine asthma.
Scientific reports    October 23, 2019   Volume 9, Issue 1 15170 doi: 10.1038/s41598-019-51820-7
White SJ, Moore-Colyer M, Marti E, Hannant D, Gerber V, Coüetil L, Richard EA, Alcocer M.Severe equine asthma (sEA), which closely resembles human asthma, is a debilitating and performance-limiting allergic respiratory disorder which affects 14% of horses in the Northern Hemisphere and is associated with increased allergen-specific immunoglobulin E (IgE) against a range of environmental proteins. A comprehensive microarray platform was developed to enable the simultaneous detection of allergen-specific equine IgE in serum against a wide range of putative allergenic proteins. The microarray revealed a plethora of novel pollen, bacteria, mould and arthropod proteins significant in t...
Paving the way for more precise diagnosis of EcPV2-associated equine penile lesions.
BMC veterinary research    October 22, 2019   Volume 15, Issue 1 356 doi: 10.1186/s12917-019-2097-0
Ramsauer AS, Wachoski-Dark GL, Fraefel C, Tobler K, Brandt S, Knight CG, Favrot C, Grest P.There is growing evidence that equine papillomavirus type 2 (EcPV2) infection is causally associated with the development of equine genital squamous cell carcinomas (SCCs). Early stages of disease present clinically as plaques or wart-like lesions which can gradually progress to tumoural lesions. Histologically these lesions are inconsistently described as benign hyperplasia, papilloma, penile intraepithelial neoplasia (PIN), carcinoma in situ (CIS) or SCC. Guidelines for histological classification of early SCC precursor lesions are not precisely defined, leading to potential misdiagnosis. Th...
Factors Associated With Survival and Return to Function Following Synovial Infections in Horses.
Frontiers in veterinary science    October 22, 2019   Volume 6 367 doi: 10.3389/fvets.2019.00367
Crosby DE, Labens R, Hughes KJ, Nielsen S, Hilbert BJ.Synovial infections (SI) are common in horses of all ages and can be associated with high rates of morbidity and mortality. Identifying factors influencing survival and return to function may be useful for management of affected individuals and determination of prognosis. The objectives of this study were to identify factors associated with survival and return to function of horses and foals with SI presented to an equine hospital. This study is a retrospective case series. Data were collected from medical records of all horses with SI that were presented to a single equine hospital between Ap...
High intake of sugars and starch, low number of meals and low roughage intake are associated with Equine Gastric Ulcer Syndrome in a Belgian cohort.
Journal of animal physiology and animal nutrition    October 22, 2019   Volume 105 Suppl 2 18-23 doi: 10.1111/jpn.13215
Galinelli N, Wambacq W, Broeckx BJG, Hesta M.Equine gastric ulcer syndrome (EGUS) is a pathological condition affecting the glandular and squamous regions of the stomach. It is characterized by non-specific clinical signs, behavioural changes or can also be found without any overt clinical manifestations. Nutritional factors such as intermittent feeding, high sugars and starch intake, large amounts of straw as forage and prolonged time without access to forage have all been associated with an increased risk of equine squamous gastric disease (ESGD). The aim of this study was to investigate which nutritional practices are commonly seen in...
Ganglioglioma of the Right Cerebrothalamus in a 7-Year-Old Quarter Horse Cross Gelding.
Frontiers in veterinary science    October 22, 2019   Volume 6 356 doi: 10.3389/fvets.2019.00356
Easton-Jones C, Woolard K, Mohr FC, Roy MA, Aleman M.Intracranial neoplasia in horses is rare compared to other species. Detailed information such as neurological, electroencephalographic, and histopathological examination of horses with intracranial neoplasia associated with seizures is scarce in the literature. Furthermore, ganglioglioma has not been reported in the horse. A 7-year-old Quarter horse cross Paint gelding was examined due to recurrent seizure-like episodes of 1-year duration. The seizures had been increasing in frequency and length, occurring up to 20 times a day at the time of presentation. Neurological examination revealed inte...
[Ovarian Mixed Tumor in a Mare].
Tierarztliche Praxis. Ausgabe G, Grosstiere/Nutztiere    October 21, 2019   Volume 47, Issue 5 328 doi: 10.1055/a-1004-9889
Pinna AE, Okada CTC, Ferreira CSC et al. Double ovarian tumor in the mare: case report. Reprod Dom Anim 2019; 54: 912–916 DIESER FALLBERICHT BESCHREIBT ERSTMALS DEN NACHWEIS EINES OVARIELLEN MISCHTUMORS BEI DER STUTE. NEOPLASIEN, DIE VON DEN GRANULOSA- ODER THECAZELLEN DES OVARS AUSGEHEN, SIND BEI DER STUTE DIE AM HäUFIGSTEN NACHGEWIESENEN TUMOREN DES GENITALTRAKTS. ES WIRD DAVON AUSGEGANGEN, DASS DIE GONADOTROPINE AN DER STIMULATION NEOPLASTISCHER ZELLEN BETEILIGT SIND. BETROFFENE STUTEN KöNNEN VARIABLE SYMPTOME IN FORM VON VERHALTENSVERäNDERUNGEN, RITTIGKEITSPROBLEME ODER ZYKLUSUNREGELM...
Results of racetrack examinations of Standardbred horses at race meetings in New South Wales.
Australian veterinary journal    October 21, 2019   Volume 97, Issue 12 509-514 doi: 10.1111/avj.12882
Knight PK.This study analysed the race day veterinary reports from harness racing meetings controlled by the New South Wales Greyhound and Harness Racing Regulatory Authority between 1 September 2008 and 30 June 2009. The findings of all prerace and postrace examinations were analysed, and the frequency of observations was recorded. Chi-square testing was used to determine whether the incidence of abnormalities differed between age groups and tracks. A total of 542 meetings were conducted during the period of the study, with veterinary examinations conducted at 395 of these meetings. A total of 520 vete...
[Immunoglobulin concentration in equine colostrum and blood of newborn foals as well as clinically relevant IgG evaluation methods – An overview].
Tierarztliche Praxis. Ausgabe G, Grosstiere/Nutztiere    October 21, 2019   Volume 47, Issue 5 298-307 doi: 10.1055/a-1005-0004
Sievert M, Krohn J, Wehrend A.Due to the special structure of the equine placenta, foals depend on an adequate intake of high-quality colostrum post natum in order to ensure the development of passive immunity. The quality of the colostrum is determined, among other things, by the IgG content. This may be evaluated in the colostrum by direct and indirect methods (density and refractive index). The density of the colostrum is measured by a colostrometer and should amount to at least 1060 g/l. Refractometry is suitable for assessing the relative density or refractive index. Good equine colostrum has a Brix value of at leas...
Possible dysmetabolic hyperferritinemia in hyperinsulinemic horses.
Open veterinary journal    October 21, 2019   Volume 9, Issue 4 287-293 doi: 10.4314/ovj.v9i4.2
Kellon EM, Gustafson KM.Hyperinsulinemia associated with equine metabolic syndrome and pituitary pars intermedia dysfunction is a risk factor for laminitis. Research in other species has shown elevated body iron levels as both a predictor and consequence of insulin resistance. In humans, this is known as dysmetabolic hyperferritinemia. To explore the relationship between equine hyperinsulinemia and body iron levels. We reviewed case histories and laboratory results from an open access database maintained by the Equine Cushing's and Insulin Resistance Group Inc. (ECIR). We identified 33 horses with confirmed hyperinsu...
Equine Rhinitis A Virus Infection in Thoroughbred Racehorses-A Putative Role in Poor Performance?
Viruses    October 18, 2019   Volume 11, Issue 10 doi: 10.3390/v11100963
Back H, Weld J, Walsh C, Cullinane A.The aim of this study was to identify respiratory viruses circulating amongst elite racehorses in a training yard by serological testing of serial samples and to determine their impact on health status and ability to race. A six-month longitudinal study was conducted in 30 Thoroughbred racehorses (21 two-year-olds, five three-year-olds and four four-year-olds) during the Flat racing season. Sera were tested for the presence of antibodies against equine herpesvirus 1 and 4 (EHV-1 and EHV-4) and equine rhinitis viruses A and B (ERAV and ERBV) by complement fixation (CF) and equine arteritis viru...
Non-Coding RNA Sequencing of Equine Endometrium During Maternal Recognition of Pregnancy.
Genes    October 18, 2019   Volume 10, Issue 10 821 doi: 10.3390/genes10100821
Klohonatz KM, Coleman SJ, Cameron AD, Hess AM, Reed KJ, Canovas A, Medrano JF, Islas-Trejo AD, Kalbfleisch T, Bouma GJ, Bruemmer JE.Maternal recognition of pregnancy (MRP) in the mare is not well defined. In a non-pregnant mare, prostaglandin F (PGF) is released on day 14 post-ovulation (PO) to cause luteal regression, resulting in loss of progesterone production. Equine MRP occurs prior to day 14 to halt PGF production. Studies have failed to identify a gene candidate for MRP, so attention has turned to small, non-coding RNAs. The objective of this study was to evaluate small RNA (<200 nucleotides) content in endometrium during MRP. Mares were used in a cross-over design with each having a pregnant and non-mated cycle. Ea...
Characterization of abortion, stillbirth and non-viable foals homozygous for the Warmblood Fragile Foal Syndrome.
Animal reproduction science    October 17, 2019   Volume 211 106202 doi: 10.1016/j.anireprosci.2019.106202
Aurich C, Müller-Herbst S, Reineking W, Müller E, Wohlsein P, Gunreben B, Aurich J.Warmblood fragile foal syndrome (WFFS) is a monogenetic defect with autosomal recessive inheritance. The WFFS homozygosity is non-compatible with extra-uterine life. Although as many as 15% of Warmblood horses are WFFS carriers, there has been little veterinary focus on this condition. The aim of this study was to determine outcomes and symptoms of clinical signs and pathological abnormalities during pregnancies when there were WFFS homozygous foetuses. Diagnostic material of 15 abortion or stillbirth cases with suspected diagnosis of WFFS was available for this study. Additionally, there were...
TRIM39-RPP21 Variants (∆19InsCCC) Are Not Associated with Juvenile Idiopathic Epilepsy in Egyptian Arabian Horses.
Genes    October 16, 2019   Volume 10, Issue 10 816 doi: 10.3390/genes10100816
Rivas VN, Aleman M, Peterson JA, Dahlgren AR, Hales EN, Finno CJ.Juvenile idiopathic epilepsy (JIE) is an inherited disease characterized by recurrent seizures during the first year of life in Egyptian Arabian horses. Definitive diagnosis requires an electroencephalogram (EEG) performed by a veterinary specialist. A recent study has suggested that a 19 base-pair deletion, along with a triple-C insertion, in intron five of twelve (∆19InsCCC; chr20:29542397-29542425: GTTCAGGGGACCACATGGCTCTCTATAGA>TATCTTAAGACCC) of the () gene is associated with JIE. To confirm this association, a new sample set consisting of nine EEG-phenotyped affected and nine unaffec...
Ultrasonographic assessment of normal jugular veins in Standardbred horses.
BMC veterinary research    October 16, 2019   Volume 15, Issue 1 343 doi: 10.1186/s12917-019-2104-5
Pasolini MP, Spinella G, Del Prete C, Valentini S, Coluccia P, Auletta L, Greco M, Meomartino L.Ultrasonography (US) is the recommended imaging technique to evaluate jugular veins. This prospective randomized clinical study was designed to collect a series of B-mode US measurements of manually distended jugular veins in healthy Italian Standardbreds and to find possible correlations between ultrasound measurements and animal morphometric characteristics. Forty-two horses, eight males and 34 females (range 3-22 years; bodyweight 494.4 ± 41.7 kg), were included in the study. The diameters and wall thicknesses of both jugular veins were measured at three different sites of the neck...