Disease diagnosis in horses involves the identification and characterization of illnesses through various diagnostic methods and tools. This process is essential for effective veterinary care and management of equine health. Techniques used in diagnosing diseases in horses include clinical examinations, laboratory tests, imaging modalities such as ultrasonography and radiography, and molecular diagnostics. Blood tests are frequently utilized to assess parameters such as complete blood count and biochemical profiles, which can indicate underlying health issues. Additionally, advancements in genetic testing and biomarker identification have enhanced the ability to detect specific diseases early. This page aggregates peer-reviewed research studies and scholarly articles that explore diagnostic methodologies, their applications, and their impact on equine health management.
Vernemmen I, De Clercq D, Decloedt A, Vera L, Van Steenkiste G, van Loon G.The number of atrial premature depolarisations (APDs) is a known risk factor for atrial fibrillation (AF) recurrence in humans. Objective: To evaluate if the number of APDs over a 24-h period 5Â days post cardioversion predicts AF recurrence within 1Â year in horses, taking the multifactorial nature of AF into account. Methods: Retrospective case series. Methods: Eighty horses met these inclusion criteria: first AF episode, no AF recurrence within 5Â days post cardioversion, cardioversion by transvenous electrical cardioversion (TVEC), 24-h ECG recording and echocardiographic examination 5Â da...
Dern K, Burns TA, Watts MR, van Eps AW, Belknap JK.Interleukin-6 (IL-6) is consistently increased in the digital lamellae in different studies of sepsis-related laminitis (SRL). IL-6 signalling through the gp130 receptor activates similar signalling (i.e. mTORC1-related signalling) previously reported to be activated in models of endocrinopathic laminitis. Objective: To assess the activation state of signalling proteins downstream of IL-6/gp130 receptor complex activation in an experimental model of SRL. Methods: Randomised experimental study. Methods: Lamellar phospho-(P) protein concentrations downstream of the IL-6/gp130 receptors were asse...
Haffner JC, Neal DL, Hoffman RM, Grubbs ST.We investigated the stability of adrenocorticotropic hormone (ACTH) in plasma after freezing for different lengths of time. The plasma ACTH concentrations of 12 horses were measured on day 0 (baseline) and over time, after stimulation with thyrotropin-releasing hormone. Samples were stored at -80°C for 3, 7, 30, 60, and 90 d, or at -20°C for 3, 7, 30, and 60 d, or between ice packs at -20°C for 3 and 7 d prior to determination of ACTH concentration. ACTH concentrations were compared to baseline (non-frozen day 0 plasma) for each storage method using a mixed model with repeated measure...
White SJ, Moore-Colyer M, Marti E, Hannant D, Gerber V, Coüetil L, Richard EA, Alcocer M.Severe equine asthma (sEA), which closely resembles human asthma, is a debilitating and performance-limiting allergic respiratory disorder which affects 14% of horses in the Northern Hemisphere and is associated with increased allergen-specific immunoglobulin E (IgE) against a range of environmental proteins. A comprehensive microarray platform was developed to enable the simultaneous detection of allergen-specific equine IgE in serum against a wide range of putative allergenic proteins. The microarray revealed a plethora of novel pollen, bacteria, mould and arthropod proteins significant in t...
Ramsauer AS, Wachoski-Dark GL, Fraefel C, Tobler K, Brandt S, Knight CG, Favrot C, Grest P.There is growing evidence that equine papillomavirus type 2 (EcPV2) infection is causally associated with the development of equine genital squamous cell carcinomas (SCCs). Early stages of disease present clinically as plaques or wart-like lesions which can gradually progress to tumoural lesions. Histologically these lesions are inconsistently described as benign hyperplasia, papilloma, penile intraepithelial neoplasia (PIN), carcinoma in situ (CIS) or SCC. Guidelines for histological classification of early SCC precursor lesions are not precisely defined, leading to potential misdiagnosis. Th...
Crosby DE, Labens R, Hughes KJ, Nielsen S, Hilbert BJ.Synovial infections (SI) are common in horses of all ages and can be associated with high rates of morbidity and mortality. Identifying factors influencing survival and return to function may be useful for management of affected individuals and determination of prognosis. The objectives of this study were to identify factors associated with survival and return to function of horses and foals with SI presented to an equine hospital. This study is a retrospective case series. Data were collected from medical records of all horses with SI that were presented to a single equine hospital between Ap...
Bernstock JD, Ostby S, Fox B, Sotoudeh H, Janssen A, Kang YJ, Chen J, Prattipati V, Elsayed G, Chagoya G, Yamashita D, Friedman GK, Nabors B, Huh WK....Leptomeningeal metastasis is extremely rare in patients with ovarian cancer, but should be considered in patients presenting with neurologic deficits such as cauda equine syndrome. Given its poor prognosis and lack of data currently on management, additional studies are needed to optimize treatment regimens and improve outcomes.
Galinelli N, Wambacq W, Broeckx BJG, Hesta M.Equine gastric ulcer syndrome (EGUS) is a pathological condition affecting the glandular and squamous regions of the stomach. It is characterized by non-specific clinical signs, behavioural changes or can also be found without any overt clinical manifestations. Nutritional factors such as intermittent feeding, high sugars and starch intake, large amounts of straw as forage and prolonged time without access to forage have all been associated with an increased risk of equine squamous gastric disease (ESGD). The aim of this study was to investigate which nutritional practices are commonly seen in...
Easton-Jones C, Woolard K, Mohr FC, Roy MA, Aleman M.Intracranial neoplasia in horses is rare compared to other species. Detailed information such as neurological, electroencephalographic, and histopathological examination of horses with intracranial neoplasia associated with seizures is scarce in the literature. Furthermore, ganglioglioma has not been reported in the horse. A 7-year-old Quarter horse cross Paint gelding was examined due to recurrent seizure-like episodes of 1-year duration. The seizures had been increasing in frequency and length, occurring up to 20 times a day at the time of presentation. Neurological examination revealed inte...
Dahmani M, Davoust B, Sambou M, Bassene H, Scandola P, Ameur T, Raoult D, Fenollar F, Mediannikov O.Our study aimed to assess the diversity of the species of Anaplasmataceae in Senegal that infect animals and ticks in three areas: near Keur Momar Sarr (northern region), Dielmo and Diop (Sine Saloum, central region of Senegal), and in Casamance (southern region of Senegal). Methods: A total of 204 ticks and 433 blood samples were collected from ruminants, horses, donkeys and dogs. Ticks were identified morphologically and by molecular characterization targeting the 12S rRNA gene. Molecular characterization of species of Anaplasmataceae infecting Senegalese ticks and animals was conducted usin...
Pinna AE, Okada CTC, Ferreira CSC et al. Double ovarian tumor in the mare: case report. Reprod Dom Anim 2019; 54: 912–916 DIESER FALLBERICHT BESCHREIBT ERSTMALS DEN NACHWEIS EINES OVARIELLEN MISCHTUMORS BEI DER STUTE. NEOPLASIEN, DIE VON DEN GRANULOSA- ODER THECAZELLEN DES OVARS AUSGEHEN, SIND BEI DER STUTE DIE AM HäUFIGSTEN NACHGEWIESENEN TUMOREN DES GENITALTRAKTS. ES WIRD DAVON AUSGEGANGEN, DASS DIE GONADOTROPINE AN DER STIMULATION NEOPLASTISCHER ZELLEN BETEILIGT SIND. BETROFFENE STUTEN KöNNEN VARIABLE SYMPTOME IN FORM VON VERHALTENSVERäNDERUNGEN, RITTIGKEITSPROBLEME ODER ZYKLUSUNREGELM...
Knight PK.This study analysed the race day veterinary reports from harness racing meetings controlled by the New South Wales Greyhound and Harness Racing Regulatory Authority between 1 September 2008 and 30 June 2009. The findings of all prerace and postrace examinations were analysed, and the frequency of observations was recorded. Chi-square testing was used to determine whether the incidence of abnormalities differed between age groups and tracks. A total of 542 meetings were conducted during the period of the study, with veterinary examinations conducted at 395 of these meetings. A total of 520 vete...
Sievert M, Krohn J, Wehrend A.Due to the special structure of the equine placenta, foals depend on an adequate intake of high-quality colostrum post natum in order to ensure the development of passive immunity. The quality of the colostrum is determined, among other things, by the IgG content. This may be evaluated in the colostrum by direct and indirect methods (density and refractive index). The density of the colostrum is measured by a colostrometer and should amount to at least 1060 g/l. Refractometry is suitable for assessing the relative density or refractive index. Good equine colostrum has a Brix value of at leas...
Kellon EM, Gustafson KM.Hyperinsulinemia associated with equine metabolic syndrome and pituitary pars intermedia dysfunction is a risk factor for laminitis. Research in other species has shown elevated body iron levels as both a predictor and consequence of insulin resistance. In humans, this is known as dysmetabolic hyperferritinemia. To explore the relationship between equine hyperinsulinemia and body iron levels. We reviewed case histories and laboratory results from an open access database maintained by the Equine Cushing's and Insulin Resistance Group Inc. (ECIR). We identified 33 horses with confirmed hyperinsu...
Krohn J, Ennen S, Hospes R et al. Use of a cervical stent for long-term treatment of pyometra in the mare: A report of three cases. Reprod Dom Anim 2019; 55: 1155–1159 DIE PYOMETRA DER STUTE IST EIN CHRONISCHER ENTZüNDUNGSZUSTAND DES ENDOMETRIUMS, DER HäUFIG MIT DER AKKUMULATION GROßER MENGEN AN SEKRET EINHERGEHT. PRäDISPONIERT SIND STUTEN MIT VERäNDERUNGEN DER ZERVIX, DURCH DIE DIE UTERINE CLEARANCE BEEINTRäCHTIGT WIRD. DIE HäUFIG UNSPEZIFISCHEN SYMPTOME UMFASSEN LEISTUNGSMANGEL, KONDITIONSVERLUST, SUBFEBRILE TEMPERATUR ODER KOLIKARTIGE SCHMERZEN. MANCHE TIERE PRäSENTIEREN SICH SYMP...
Back H, Weld J, Walsh C, Cullinane A.The aim of this study was to identify respiratory viruses circulating amongst elite racehorses in a training yard by serological testing of serial samples and to determine their impact on health status and ability to race. A six-month longitudinal study was conducted in 30 Thoroughbred racehorses (21 two-year-olds, five three-year-olds and four four-year-olds) during the Flat racing season. Sera were tested for the presence of antibodies against equine herpesvirus 1 and 4 (EHV-1 and EHV-4) and equine rhinitis viruses A and B (ERAV and ERBV) by complement fixation (CF) and equine arteritis viru...
Klohonatz KM, Coleman SJ, Cameron AD, Hess AM, Reed KJ, Canovas A, Medrano JF, Islas-Trejo AD, Kalbfleisch T, Bouma GJ, Bruemmer JE.Maternal recognition of pregnancy (MRP) in the mare is not well defined. In a non-pregnant mare, prostaglandin F (PGF) is released on day 14 post-ovulation (PO) to cause luteal regression, resulting in loss of progesterone production. Equine MRP occurs prior to day 14 to halt PGF production. Studies have failed to identify a gene candidate for MRP, so attention has turned to small, non-coding RNAs. The objective of this study was to evaluate small RNA (<200 nucleotides) content in endometrium during MRP. Mares were used in a cross-over design with each having a pregnant and non-mated cycle. Ea...
Padalino B, Rosanowski SM, Di Bella C, Lacinio R, Rubino GTR.This study aimed to document the prevalence of chronic equine piroplasmosis (EP) in poorly performing Standardbred racehorses and to explore associations between the disease and sex, age, and hematological parameters. Blood was collected between 2004 and 2018; blood cell counts were performed using a cell counter analyzer, biochemical parameters using a photometer, and serum proteins using agarose gel electrophoresis. Blood smears were prepared, colored with a modified Giemsa, and an experienced technician identified the presence of protozoa. The horses were categorized into piroplasmosis posi...
Aurich C, Müller-Herbst S, Reineking W, Müller E, Wohlsein P, Gunreben B, Aurich J.Warmblood fragile foal syndrome (WFFS) is a monogenetic defect with autosomal recessive inheritance. The WFFS homozygosity is non-compatible with extra-uterine life. Although as many as 15% of Warmblood horses are WFFS carriers, there has been little veterinary focus on this condition. The aim of this study was to determine outcomes and symptoms of clinical signs and pathological abnormalities during pregnancies when there were WFFS homozygous foetuses. Diagnostic material of 15 abortion or stillbirth cases with suspected diagnosis of WFFS was available for this study. Additionally, there were...
Rivas VN, Aleman M, Peterson JA, Dahlgren AR, Hales EN, Finno CJ.Juvenile idiopathic epilepsy (JIE) is an inherited disease characterized by recurrent seizures during the first year of life in Egyptian Arabian horses. Definitive diagnosis requires an electroencephalogram (EEG) performed by a veterinary specialist. A recent study has suggested that a 19 base-pair deletion, along with a triple-C insertion, in intron five of twelve (∆19InsCCC; chr20:29542397-29542425: GTTCAGGGGACCACATGGCTCTCTATAGA>TATCTTAAGACCC) of the () gene is associated with JIE. To confirm this association, a new sample set consisting of nine EEG-phenotyped affected and nine unaffec...
Pasolini MP, Spinella G, Del Prete C, Valentini S, Coluccia P, Auletta L, Greco M, Meomartino L.Ultrasonography (US) is the recommended imaging technique to evaluate jugular veins. This prospective randomized clinical study was designed to collect a series of B-mode US measurements of manually distended jugular veins in healthy Italian Standardbreds and to find possible correlations between ultrasound measurements and animal morphometric characteristics. Forty-two horses, eight males and 34 females (range 3-22 years; bodyweight 494.4 ± 41.7 kg), were included in the study. The diameters and wall thicknesses of both jugular veins were measured at three different sites of the neck...
Leschke DH, Muir GS, Hodgson JK, Coyle M, Horn R, Bertin FR.Diseases associated with insulin dysregulation (ID), such as equine metabolic syndrome and pituitary pars intermedia dysfunction, are of interest to practitioners because of their association with laminitis. Accurate insulin concentration assessment is critical in diagnosing and managing these diseases. Objective: To determine the effect of time, temperature, and collection tube type on insulin concentrations in horses at risk of ID. Methods: Eight adult horses with body condition score >6/9. Methods: In this prospective study, subjects underwent an infeed oral glucose test 2 hours before...
Fitzgerald DM, Pollitt CC, Walsh DM, Sillence MN, de Laat MA.The oral glucose test (OGT) is a useful tool for diagnosing insulin dysregulation (ID) and is somewhat repeatable in ponies under consistent management. This study aimed to determine whether the insulin and incretin responses to an OGT in ponies differed after short-term access to fertilised pasture, compared to unfertilised pasture, by using a randomised, repeated measures study design. Sixteen mixed-breed ponies were classified as severely insulin-dysregulated (SD; post-prandial insulin ≥80 μIU/mL) or not severely insulin-dysregulated (NSD; post-prandial insulin < 80 μIU/mL) using an O...
Hildebrandt M.The advanced therapy medicinal products (ATMPs) landscape is entirely different from classical drug development. Academia has been the major source of ATMP development, and academic hospitals act as trial sites for the clinical testing of ATMPs, including early academic-led trials as well as industry-sponsored trials that pursue the full developmental pathway to market authorization. The recent breakthrough developments in some ATMPs, such as genetically engineered immune cells, have confronted academic hospitals with a substantial amount of public demand, competitive pressure, and costs. At t...
Orellana-Guerrero D, Renaudin C, Edwards L, Rose E, Aleman M, Moore PF, Dujovne G.Placentitis has been reported as the most important cause of equine abortions, stillbirths, and perinatal deaths in horses. Most cases are caused by bacteria and less commonly by fungal elements. The aim of this report is to describe the clinical presentation of a fungal placentitis caused by Aspergillus terrerus. A 5-year-old thoroughbred maiden mare at the 217th day of gestation presented with some classic signs of placentitis (premature udder development and milk dripping). All ultrasonographic findings were consistent with a live fetus and a severe placentitis. On vaginal examination, pur...
Nemoto M, Schofield W, Cullinane A.The objective of this study was to investigate the presence of equine coronavirus (ECoV) in clinical samples submitted to a diagnostic laboratory in Ireland. A total of 424 clinical samples were examined from equids with enteric disease in 24 Irish counties between 2011 and 2015. A real-time reverse transcription polymerase chain reaction was used to detect ECoV RNA. Nucleocapsid, spike and the region from the p4.7 to p12.7 genes of positive samples were sequenced, and sequence and phylogenetic analyses were conducted. Five samples (1.2%) collected in 2011 and 2013 tested positive for ECoV. Po...
Altan E, Li Y, Sabino-Santos G, Sawaswong V, Barnum S, Pusterla N, Deng X, Delwart E.Metagenomics was used to identify viral sequences in the plasma and CSF (cerobrospinal fluid) of 13 horses with unexplained neurological signs and in the plasma and respiratory swabs of 14 horses with unexplained respiratory signs. Equine hepacivirus and two copiparvoviruses (horse parvovirus-CSF and a novel parvovirus) were detected in plasma from neurological cases. Plasma from horses with respiratory signs contained the same two copiparvoviruses plus equine pegivirus D and respiratory swabs contained equine herpes virus 2 and 5. Based on genetic distances the novel copiparvovirus qualified ...
Gozalo-Marcilla M, Luna SPL, Gasthuys F, Schauvliege S.To perform a literature review of the thermal and mechanical antinociceptive devices used in pharmacological studies in standing horses published after 2011 (2012-2019). To complete a full literature review about electrical stimulation used for evaluation in similar studies. Methods: PubMed, Google Scholar and Web of Science. Conclusions: A high level of standardization has been reached in antinociceptive studies in standing horses using thermal and mechanical stimuli in most recent years. Commercially available testing devices to deliver thermal, mechanical and electrical stimuli, with observ...
Spence KL, Cardwell JM, Slater J, Rosanowski SM.The potential for an exotic disease incursion is a significant concern for the United Kingdom (UK) equine industry. Horse owners' perceptions of, and attitudes towards, exotic diseases can influence decisions to adopt disease preparedness strategies. The objectives of this study were to describe horse owners' 1) perceptions of the term 'exotic disease', and 2) attitudes towards their risk of being affected by an exotic disease. In order to address these objectives, qualitative content analysis was undertaken on data collected using two open-ended survey questions. Results: Horse owners (n =â€...
Guglick MA, MacAllister CG, Ely RW, Edwards WC.Seven horses developed clinical or subclinical hepatitis 48 to 87 days after administration of tetanus antitoxin. One horse had mildly high hepatic enzyme activity 120 days after inoculation with tetanus antitoxin. The first horse developed signs of depression, lethargy, and anorexia. During hospitalization, signs of hepatoencephalopathy were noticed, and laboratory data were consistent with hepatic disease. Another horse that was found dead had gross and histologic lesions compatible with serum hepatitis. Screening of serum gamma-glutamyltransferase (GGT) and aspartate transaminase activities...
Ohmura H, Hiraga A, Aida H, Kuwahara M, Tsubone H, Jones JH.To determine whether evaluation of heart rate (HR) and HR variability (HRV) during prolonged road transportation in horses provides a sensitive index of autonomic stimulation. Methods: Five 2-year-old Thoroughbreds. Methods: ECGs were recorded as horses were transported for 21 hours in a 9-horse van. Heart rate, high-frequency (HF) power, low-frequency (LF) power, and LF-to-HF ratio from Fourier spectral analyses of ECGs were calculated and compared with values recorded during a 24-hour period of stall rest preceding transportation. Results: HR, HF power, and LF power had diurnal rhythms durin...
Murray MJ, Murray CM, Sweeney HJ, Weld J, Digby NJ, Stoneham SJ.Gastroendoscopic examinations were conducted on 75 Thoroughbred foals aged two to 85 days on seven breeding farms in England and Ireland. The foals showed no signs of gastric disease. There was no significant difference between lesion prevalence in foals in England (16 of 28 foals; 57 per cent) or Ireland (22 of 47 foals; 47 per cent). Neither was there any sex predilection (18 of 36 males; 20 of 39 females). Lesions were most prevalent in foals under 10 days old (8 of 9) and least prevalent in foals older than 70 days (3 of 10). Lesions occurred most frequently in the squamous mucosa immediat...
Degroote RL, Hauck SM, Amann B, Hirmer S, Ueffing M, Deeg CA.Equine recurrent uveitis is a spontaneous, lymphocyte-driven autoimmune disease. It affects horses worldwide and presents with painful remitting-relapsing inflammatory attacks of inner eye structures eventually leading to blindness. Since lymphocytes are the key players in equine recurrent uveitis, we were interested in potential changes of their protein repertoire which may be involved in disease pathogenesis. To create a reference for differential proteome analysis, we first unraveled the equine lymphocyte proteome by two-dimensional sodium dodecyl sulfate-polyacrylamide gel electrophoresis ...
Melnick JL, Hampil B.This paper summarizes the results of co-operative studies undertaken by the WHO International Reference Centre for Enteroviruses and a number of WHO Regional Reference Centres for viruses, WHO Virus Collaborating Laboratories, or other laboratories in a comprehensive testing programme of enterovirus equine antisera. The studies were designed to appraise the specificity of immune serum prepared in horses against five representative prototype enteroviruses (poliovirus 1, coxsackieviruses A9 and B3, and echoviruses 4 and 11). Tests for neutralizing antibody were performed not only against the hom...
Hackett ES, Lunn DP, Ferris RA, Horohov DW, Lappin MR, McCue PM.Neonatal sepsis is a common problem in foals and is a primary cause of death in the post natal period. Transient bacteraemia and subsequent host responses have not been described in the equine neonate. Objective: The primary objective of this study was to determine if transient bacteraemia occurs in foals within the first 72 h of life. Additional objectives included description of bacterial organisms associated with transient bacteraemia and concurrent cytokine gene expression in healthy foals. Methods: Prospective observational study in healthy foals. Methods: Blood was aseptically collecte...
Armando F, Godizzi F, Razzuoli E, Leonardi F, Angelone M, Corradi A, Meloni D, Ferrari L, Passeri B.Squamous cell carcinoma (SCC) is one of the most frequent tumors of skin and muco-cutaneous junctions in the horse. Equine papillomavirus type 2 (EcPV2) has been detected in equine SCC of the oral tract and genitals, and recently also in the larynx. As human squamous cell carcinoma of the larynx (SCCL), it is strongly etiologically associated with high-risk papillomavirus (h-HPV) infection. This study focuses on tumor cells behavior in a naturally occurring tumor that can undergo the so-called epithelial to mesenchymal transition (EMT). A SCCL in a horse was investigated by immunohistochemistr...
Carmalt JL, Kneissl S, Rawlinson JE, Zwick T, Zekas L, Ohlerth S, Bienert-Zeit A.Published descriptions of nonseptic arthritis of the equine temporomandibular joint (TMJ) are rare and large studies investigating variations in the TMJ for asymptomatic horses are lacking. The objectives of this cross-sectional, retrospective, multi-institutional study were to describe anatomical variations in the TMJ detected using computed tomography (CT) in an equid population asymptomatic for TMJ disease and determine whether these variations were associated with patient signalment, reason for CT examination, or CT slice width. Medical records at eight hospitals were searched for horses t...
Arosalo BM, Raekallio M, Rajamäki M, Holopainen E, Kastevaara T, Salonen H, Sankari S.The aim of the study was to investigate urine matrix metalloproteinase (MMP-2 and -9) activity, alkaline phosphatase/creatinine (U-AP/Cr) and gamma-glutamyl-transpeptidase/creatinine (U-GGT/Cr) ratios, glucose concentration, and urine protein/creatinine (U-Prot/Cr) ratio and to compare data with plasma MMP-2 and -9 activity, cystatin-C and creatinine concentrations in colic horses and healthy controls. Horses with surgical colic (n = 5) were compared to healthy stallions (n = 7) that came for castration. Blood and urine samples were collected. MMP gelatinolytic activity was measured by zymogra...
Ducro BJ, Schurink A, Bastiaansen JW, Boegheim IJ, van Steenbeek FG, Vos-Loohuis M, Nijman IJ, Monroe GR, Hellinga I, Dibbits BW, Back W, Leegwater PA.Hydrocephalus in Friesian horses is a developmental disorder that often results in stillbirth of affected foals and dystocia in dams. The occurrence is probably related to a founder effect and inbreeding in the population. The aim of our study was to find genomic associations, to investigate the mode of inheritance, to allow a DNA test for hydrocephalus in Friesian horses to be developed. In case of a monogenic inheritance we aimed to identify the causal mutation. Results: A genome-wide association study of hydrocephalus in 13 cases and 69 controls using 29,720 SNPs indicated the involvement o...
Wernery U, Zachariah R, Mumford JA, Luckins T.Seven surra negative horses were intravenously inoculated with 3 x 10(6)Trypanosoma evansi parasites derived from a camel. One horse was maintained as an uninfected negative control. Three antigen and three antibody detection tests were evaluated for diagnosis of infection in horses. The microhaematocrit centrifugation test (MHCT) was the most sensitive, first detecting parasites between one and three days (x 2.4) post infection (p.i.). The antigen (ag)-ELISA detected antigen between three and ten days (x 6.6) p.i. The latex agglutination test (LAT) first gave positive results on day 3 (x 3.0)...
Matthews JB, Hodgkinson JE, Dowdall SM, Proudman CJ.Intestinal helminths are an important cause of equine disease. Of these parasites, the Cyathostominae are the commonest group that infect horses. These nematodes consist of a complex tribe of 51 species, although individual horses tend to harbour 10 or so common species, in addition to a few rarer species. The Cyathostominae can be extremely pathogenic, and high levels of infection result in clinical symptoms ranging from chronic weight loss to colic, diarrhoea and death. As part of their life cycle, immature cyathostomins penetrate the large intestinal wall, where they can enter a state of in...
Wotman K, Wilkins PA, Palmer JE, Boston RC.Lactate concentration in blood or plasma ([LAC]) and change in [LAC] are associated with survival in sick foals. Objective: [LAC] and change in [LAC] over time are associated with survival at 96 hours and discharge in neonatal foals. Furthermore [LAC] and change in [LAC] over time correlate with blood culture results and blood pressure at admission. Methods: Two hundred and twenty-five foals consecutively admitted to a Neonatal Intensive Care Unit. Methods: Retrospective case review. Foals <or=30 days of age with [LAC] from arterial (190) or umbilical (35) blood gas analysis ([LAC](BG)) at ...
Novotny EN, White SJ, Wilson AD, Stefánsdóttir SB, Tijhaar E, Jonsdóttir S, Frey R, Reiche D, Rose H, Rhyner C, Schüpbach-Regula G....Allergy to bites of blood-sucking insects, including biting midges, can affect both human and veterinary patients. Horses are often suffering from an IgE-mediated allergic dermatitis caused by bites of midges (Culicoides spp). With the aim to improve allergen immunotherapy (AIT), numerous Culicoides allergens have been produced as recombinant (r-) proteins. This study aimed to test a comprehensive panel of differently expressed Culicoides r-allergens on a cohort of IBH-affected and control horses using an allergen microarray. IgE levels to 27 Culicoides r-allergens, including 8 previously unpu...
Durham AE, Hughes KJ, Cottle HJ, Rendle DI, Boston RC.Type 2 diabetes mellitus (T2DM) is diagnosed rarely in equine practice although it may be under-recognised. A greater awareness of the condition and therapeutic considerations would be to the benefit of such cases presenting in practice. More investigation into the pharmacological management of these cases is needed. Objective: Three cases of diabetes mellitus were investigated using a specific test for insulin sensitivity and pancreatic beta cell function in order to define accurately and characterise the existence of T2DM in all 3 subjects. Methods: The insulin-modified frequently sampled i....
van Schie HT, Bakker EM, Jonker AM, van Weeren PR.To correlate quantitative analysis of ultrasonographic images of normal (injury-free) equine superficial digital flexor (SDF) tendons and equine SFD tendons that have pathologic changes with corresponding histologic sections. Methods: 4 SDF tendons, 2 of which had various stages of tissue integrity. The 2 ipsilateral tendons were used as points of reference. Methods: Tendons were mounted in a custom-made device that permitted sequential scanning, transversely and perpendicular to the tendon long axis. At precise steps of 0.5 mm, transverse ultrasonographic images were collected. Subsequently, ...
Madrigal RG, Shaw SD, Witkowski LA, Sisson BE, Blodgett GP, Chaffin MK, Cohen ND.Current screening tests for Rhodococcus equi pneumonia in foals lack adequate accuracy for clinical use. Real-time, quantitative PCR (qPCR) for virulent R. equi in feces has not been systematically evaluated as a screening test. Objective: The objective of this study was to evaluate the accuracy of qPCR for vapA in serially collected fecal samples as a screening test for R. equi pneumonia in foals. Methods: One hundred and twenty-five foals born in 2011 at a ranch in Texas. Methods: Fecal samples were collected concurrently with thoracic ultrasonography (TUS) screening examinations at ages 3, ...
Osterman Lind E, Eysker M, Nilsson O, Uggla A, Höglund J.This study was conducted on a stud farm in Sweden to investigate the species composition of cyathostomins expelled in the faeces of horses after deworming using three different anthelmintic preparations. Twenty-seven horses excreting > or = 200 strongyle eggs per gram faeces (EPG) were divided into three comparable groups and dewormed on day 0 with either of following compounds: 0.2 mg ivermectin per kg body weight (bw), 19 mg pyrantel pamoate per kg bw or 7.5 mg fenbendazole per kg bw. For each of the 3 days following anthelmintic treatment faeces was collected from individual horses and s...
Singh S, Sardhara J, Singh AK, Srivastava AK, Bhaisora KS, Das KK, Mehrotra A, Sahu RN, Jaiswal AK, Behari S.This study aims to focus on a rare presentation of spinal hydatid cyst as cauda equine syndrome and misdiagnosed as intradural extramedullary (IDEM) benign lesion on magnetic resonance imaging. In this article, we report a case of spinal hydatid cyst masquerading as IDEM tumor, and intraoperatively, we accidently find clumped granuloma with severe arachnoiditis and hydatid cyst in lumber region, which was present as bilateral S1 radiculopathy with cauda equina syndrome. An 11-year-old boy who presented with symptoms and signs of cauda equina syndrome and planned for surgical excision. His radi...
Pitti L, Oosterlinck M, DÃaz-Bertrana ML, Carrillo JM, Rubio M, Sopena J, Santana A, Vilar JM.Static posturography and pedobarography are based on the detection of postural imbalance and, consequently, the pressure redistribution between limbs in lame subjects. These techniques have proven to be useful for the detection of lameness in humans and dogs. The main objective of this study was to test the suitability of static posturography and pedobarography in diagnosing lameness in ponies. A pressure platform was used to obtain postural data (statokinesiograms, mean X and Y, length, LFS ratio, and mean velocity) from 10 sound ponies and 7 ponies with unilateral forelimb lameness. Static p...
Li J, Kelly P, Zhang J, Xu C, Wang C.Babesia spp. are tick-borne protozoan hemoparasites and the second most common blood-borne parasites of mammals, in particular domestic animals. We used the Clustal Multiple Alignment program and 18S rRNA gene sequences of 22 Babesia species from GenBank to develop a PCR that could detect a wide variety of Babesia spp. in a single reaction. The pan-Babesia FRET-qPCR we developed reliably detected B. gibsoni, B. canis, B. vogeli, B. microti, B. bovis, and B. divergens under controlled conditions but did not react with closely related species, mainly Hepatozoon americanum, Theileria equi, and To...
Dacre I, Kempson S, Dixon PM.Examination of 57 apically infected maxillary cheek teeth (CT) showed one or more viable pulps and minimal apical calcified tissue changes present in recently infected CT. With chronic infections, pulps were necrotic or absent, pulp horns were filled with food if occlusal pulpar exposure was present, and gross caries of dentine was occasionally present. With chronic infections, the apical changes varied from gross destructive changes in some teeth, to extensive proliferative calcified apical changes in others. Infundibular caries was believed to cause apical infection in just 16% of infected (...
Zaugg JL, Lane VM.We evaluated the efficacy of buparvaquone in eliminating infection with Babesia equi of European origin in carrier horses and in splenectomized horses with experimentally induced acute infection. When administered at the rate of 5 mg/kg of body weight, IV, 4 times at 48-hour intervals, buparvaquone prompted rapid abatement of parasitemia. However, secondary and tertiary recrudescent parasitemias invariably returned with establishment of the carrier state. Buparvaquone, at the dosage evaluated, had transitory therapeutic efficacy against acute B equi infection in splenectomized horses, but was ...
McLean RG, Frier G, Parham GL, Francy DB, Monath TP, Campos EG, Therrien A, Kerschner J, Calisher CH.A study was undertaken to investigate an increase in reported cases of clinical encephalitis due to eastern equine encephalitis (EEE) virus in horses and to determine the natural vertebrate hosts of that virus. Horses, birds, and small mammals were sampled at sites in a contiguous area in St. Joseph and Kalamazoo counties, Michigan, from 25 August to 5 September 1980. Serum samples from four horses acutely ill with encephalitis and 16 of 39 pasture mates of ill horses had neutralizing (N) antibody against EEE virus (46.5%); no viruses were isolated from these 43 sera. None of 24 draft horses f...
Pusterla N, Johnson EM, Chae JS, Madigan JE.Neorickettsia (formerly Ehrlichia) risticii, the agent of Potomac horse fever (PHF), has been recently detected in trematode stages found in the secretions of freshwater snails and in aquatic insects. Insectivores, such as bats and birds, may serve as the definitive host of the trematode vector. To determine the definitive helminth vector, five bats (Myotis yumanensis) and three swallows (Hirundo rustica, Tachycineta bicolor) were collected from a PHF endemic location in northern California. Bats and swallows were dissected and their major organs examined for trematodes and for N. risticii DNA...
Evenberg A, Meyer H, Gaastra W, Verheij HM, De Haas GH.The complete amino acid sequence of phosphlipase A2 (EC 3.1.1.4) from horse pancreas was determined. The protein controls of a single polypeptide chain of 125 amino acids and has a molecular weight of 13,927. The chain is crosslinked by seven disulfide bridges. The sequence was determined by automated Edman degradation of the intact protein and several of the large peptide fragments. Smaller peptides were analyzed by manual Edman degradation. Fragmentation of the peptide chain was accomplished by enzymatic digestion with trypsin, chymotrypsin, and thermolysin. The final overlap was found by di...