The study of diseases in horses encompasses a wide range of conditions affecting equine health, including infectious diseases, metabolic disorders, and genetic abnormalities. These diseases can impact various systems within the horse, such as respiratory, gastrointestinal, and musculoskeletal systems, and can lead to significant health challenges. Research in this area focuses on understanding the pathophysiology, diagnosis, prevention, and treatment of equine diseases. Common diseases studied include equine influenza, equine herpesvirus, and laminitis. This page provides access to peer-reviewed research studies and scholarly articles that explore the etiology, clinical presentation, and management strategies of diseases in horses, contributing to the advancement of equine veterinary medicine.
Ikhuoso OA, Monroy JC, Rivas-Caceres RR, Cipriano-Salazar M, Barbabosa Pliego A.Although the strangles disease of Streptococcus equi was discovered many decades ago in 1,251 by Jordanus Ruffus, it has still remained a major frequently diagnosed infection in horses all over the world. The S. equi subspecies pathogen is known to be often resistant to antibiotic treatment, and it makes the antibiotics inefficient; hence, this review was conducted to study how the disease can be managed. The age-long sign of this infection is the oozing of pus through the mucous and skin membranes. Affected horses lose appetite, develop fever, and become depressed, which result in them losin...
Li J, Li Y, Moumouni PFA, Lee SH, Galon EM, Tumwebaze MA, Yang H, Huercha , Liu M, Guo H, Gao Y, Benedicto B, Zhang W, Fan X, Chahan B, Xuan X.Q fever, spotted fever rickettsioses and equine piroplasmosis, are some of the most serious equine tick-borne diseases caused by Coxiella burnetii, Rickettsia spp., Babesia caballi and/or Theileria equi. This study surveyed and molecularly characterized these pathogens infecting horses in ten ranches from XUAR, China using molecular technology. Among 200 horse blood samples, 163 (81.5%) were infected with at least one of the pathogens. Rickettsia spp. was the most prevalent pathogen (n = 114, 57.0%), followed by C. burnetii (n = 79, 39.5%), T. equi (n = 79, 39.5%) and B. caballi (n = 4...
Slusarewicz M, Slusarewicz P, Nielsen MK.Fecal egg counts are the primary diagnostic tools of equine parasitology and use of the McMaster test and its variants in clinical practice is widely recommended. Manual counting is, however, prone to various sources of human error. For example, in real-world situations analysts can be under significant pressure to process high numbers of samples in a limited time. This practice could affect test result quality, but yet no studies have determined whether this is the case. This study's purpose was to assess the effect of shortened counting duration (from either restricting counting time or coun...
Smith RM, Kotzé A, Grobler JP, Dalton DL.Toll-like receptors (TLR) are a family of proteins that signal activation of the innate immune response through the recognition of a variety of pathogen molecular compounds. Here, we characterized the complete TLR9 gene in Cape mountain zebra (Equus zebra zebra) from three populations in South Africa and compared sequences to a variety of horse and donkey breeds. Overall, we identified six single nucleotide polymorpHisms (SNPs). A single SNP (G586S) was non-synonymous, whereas the remaining SNPs were synonymous. The G586S alteration was detected in Cape mountain zebra populations with varying ...
Asif M, Parveen A, Ashraf S, Hussain M, Aktas M, Ozubek S, Shaikh RS, Iqbal F.The present study was designed to check the molecular detection of Anaplasma marginale and Theileria annulata in blood samples of horses and donkeys collected from Dera Ghazi Khan District in Punjab and to document their phylogenetic origin and their association with studied epidemiological factors (sex and age) and complete blood count parameters, if any. Results: A total of 195 blood samples were collected from apparently healthy horses (N = 141) and donkeys (N = 54). A. marginale DNA was detected by PCR in 4.9% (7/141) horse and in 9.2% (5/54) of donkey blood samples. Prevalence of ...
Pusterla N, Hatch K, Crossley B, Wademan C, Barnum S, Flynn K.The objective of this study was to determine if the genotype of equine herpesvirus-1 (EHV-1) impacted clinical disease and outcome of horses with laboratory confirmed equine herpesvirus myeloencephalopathy (EHM). Medical records from 65 horses diagnosed with EHM from 2011 to 2019 were reviewed for signalment, presence and severity of clinical signs (lethargy, fever, ataxia, urinary incontinence) and outcome. Horses were further grouped based on the EHV-1 genotype into neuropathic (D) or non-neuropathic (N) EHV-1 infection. Between the two EHV-1 genotype groups, age and sex distributions were s...
Every LJ, Hostnik ET, Hostnik LD, Yardley J, Shore-Khirallah AT, Thompson A, Linn SC.Tracheal collapse in horses is reportedly uncommon; however, American Miniature Horses are more commonly affected. There is no description of the tracheal luminal diameter of American Miniature Horses, making early detection of tracheal luminal narrowing difficult. Objective: To 1) describe radiographic tracheal luminal diameter in clinically normal American Miniature Horses, 2) report the prevalence of subclinical tracheal collapse in a population of American Miniature Horses, and 3) use tracheal videofluoroscopy to quantify variation in tracheal luminal diameter throughout the respiratory c...
Sekizuka T, Niwa H, Kinoshita Y, Uchida-Fujii E, Inamine Y, Hashino M, Kuroda M.MRSA is a known pathogen that affects horses. We investigated an equine MRSA isolate for potential antimicrobial resistance genes, classified the staphylococcal cassette chromosome mec (SCCmec) and identified the strain-specific dissemination in the horse community based on WGS. WGS, using short-read sequencing, and subsequent long-read sequencing by hybrid assembly, was conducted to obtain a complete genome sequence. Pairwise sequence alignment of relative SCCmec sequences and core-genome phylogenetic analysis were performed to highlight transmission routes of the SCCmec and MRSA strain-speci...
Kopper JJ, Kogan CJ, Cook VL, Schott HC.The objective of this study was to determine whether there was an association between type of colloid administered and survival of horses with enterocolitis (N = 92). A retrospective review of medical records of horses with enterocolitis treated with plasma or hetastarch (HES) between January 1, 2005 and December 31, 2011 was performed. Data collected included signalment, outcome, physical and clinicopathologic findings, and volume and type of colloid administered. Sixty-nine horses (75%) were treated with plasma and 23 horses (25%) were treated with HES. After accounting for confounding varia...
Oladunni FS, Reedy S, Balasuriya UBR, Horohov DW, Chambers TM.Equine herpesvirus type 4 (EHV-4) is mildly pathogenic but is a common cause of respiratory disease in horses worldwide. We previously demonstrated that unlike EHV-1, EHV-4 is not a potent inducer of type-I IFN and does not suppress that IFN response, especially during late infection, when compared to EHV-1 infection in equine endothelial cells (EECs). Here, we investigated the impact of EHV-4 infection in EECs on type-I IFN signaling molecules at 3, 6, and 12 hpi. Findings from our study revealed that EHV-4 did not induce nor suppress TLR3 and TLR4 expression in EECs at all the studied time...
Porphyre T, Grewar JD.African horse sickness (AHS) is a disease of equids that results in a non-tariff barrier to the trade of live equids from affected countries. AHS is endemic in South Africa except for a controlled area in the Western Cape Province (WCP) where sporadic outbreaks have occurred in the past 2 decades. There is potential that the presence of zebra populations, thought to be the natural reservoir hosts for AHS, in the WCP could maintain AHS virus circulation in the area and act as a year-round source of infection for horses. However, it remains unclear whether the epidemiology or the ecological cond...
Schnabel CL, Babasyan S, Rollins A, Freer H, Wimer CL, Perkins GA, Raza F, Osterrieder N, Wagner B.Equine herpesvirus type 1 (EHV-1) outbreaks continue to occur despite widely used vaccination. Therefore, development of EHV-1 vaccines providing improved immunity and protection is ongoing. Here, an open reading frame 2 deletion mutant of the neuropathogenic EHV-1 strain Ab4 (Ab4ΔORF2) was tested as a vaccine candidate. Three groups of horses ( = 8 each) were infected intranasally with Ab4ΔORF2 or the parent Ab4 virus or were kept as noninfected controls. Horses infected with Ab4ΔORF2 had reduced fever and nasal virus shedding compared to those infected with Ab4 but mounted similar ada...
Budiono NG, Satrija F, Ridwan Y, Handharyani E, Murtini S.Schistosomiasis is endemic in Indonesia and is found in three remote areas in Central Sulawesi Province. Non-human mammals serve as reservoir hosts, meaning the disease is zoonotic. The previous schistosomiasis studies in animals from the Lindu Subdistrict did not determine which domestic animal species can serve as the primary source of transmission. No animals have been treated in Indonesia to control the disease; therefore, the parasite's life cycle is not blocked entirely. This study aimed to determine the prevalence and identify the risk factors associated with, infection in animals, and...
Park J, Kim EB.The ecosystem of an animal farm is composed of various elements, such as animals, farmers, plants, feed, soil, and microorganisms. A domesticated animal's health is largely connected with the reservoir of bacteria and viruses in animal farms. Although a few studies have focused on exploring the gut microbiome of animals, communities of microbiota and viruses in feedlots have not been thoroughly investigated. Methods: Here, we collected feces and dust samples (4 groups: cattle feces, C_F; horse feces, H_F; cattle dust, C_D; and horse dust, H_D) from cattle and horse farms sharing the same housi...
Bernstock JD, Ostby S, Fox B, Sotoudeh H, Janssen A, Kang YJ, Chen J, Prattipati V, Elsayed G, Chagoya G, Yamashita D, Friedman GK, Nabors B, Huh WK....Leptomeningeal metastasis is extremely rare in patients with ovarian cancer, but should be considered in patients presenting with neurologic deficits such as cauda equine syndrome. Given its poor prognosis and lack of data currently on management, additional studies are needed to optimize treatment regimens and improve outcomes.
Dahmani M, Davoust B, Sambou M, Bassene H, Scandola P, Ameur T, Raoult D, Fenollar F, Mediannikov O.Our study aimed to assess the diversity of the species of Anaplasmataceae in Senegal that infect animals and ticks in three areas: near Keur Momar Sarr (northern region), Dielmo and Diop (Sine Saloum, central region of Senegal), and in Casamance (southern region of Senegal). Methods: A total of 204 ticks and 433 blood samples were collected from ruminants, horses, donkeys and dogs. Ticks were identified morphologically and by molecular characterization targeting the 12S rRNA gene. Molecular characterization of species of Anaplasmataceae infecting Senegalese ticks and animals was conducted usin...
Pinna AE, Okada CTC, Ferreira CSC et al. Double ovarian tumor in the mare: case report. Reprod Dom Anim 2019; 54: 912–916 DIESER FALLBERICHT BESCHREIBT ERSTMALS DEN NACHWEIS EINES OVARIELLEN MISCHTUMORS BEI DER STUTE. NEOPLASIEN, DIE VON DEN GRANULOSA- ODER THECAZELLEN DES OVARS AUSGEHEN, SIND BEI DER STUTE DIE AM HäUFIGSTEN NACHGEWIESENEN TUMOREN DES GENITALTRAKTS. ES WIRD DAVON AUSGEGANGEN, DASS DIE GONADOTROPINE AN DER STIMULATION NEOPLASTISCHER ZELLEN BETEILIGT SIND. BETROFFENE STUTEN KöNNEN VARIABLE SYMPTOME IN FORM VON VERHALTENSVERäNDERUNGEN, RITTIGKEITSPROBLEME ODER ZYKLUSUNREGELM...
Beste KJ, Ortved KF, Rossignol F, Ducharme NG.To describe the use of a silicone-covered laser guide and diode laser for surgical correction of epiglottic entrapment and report postoperative outcomes in horses with epiglottic entrapment. Methods: Retrospective case series. Methods: Thoroughbred and standardbred racehorses (n = 29) with epiglottic entrapment. Methods: A silicone-covered laser guide was placed endoscopically to direct the diode laser cutting action during transection of the entrapping subepiglottic membrane and to act as a physical barrier between the membrane and the epiglottic cartilage. Postoperative complications and tra...
Hesselkilde EZ, Carstensen H, Flethøj M, Fenner M, Kruse DD, Sattler SM, Tfelt-Hansen J, Pehrson S, Braunstein TH, Carlson J, Platonov PG....Large animal models are important in atrial fibrillation (AF) research, as they can be used to study the pathophysiology of AF and new therapeutic approaches. Unlike other animal models, horses spontaneously develop AF and could therefore serve as a bona fide model in AF research. We therefore aimed to study the electrical, functional and structural remodelling caused by chronic AF in a horse model. Nine female horses were included in the study, with six horses tachypaced into self-sustained AF and three that served as a time-matched sham-operated control group. Acceleration in atrial fibrilla...
Back H, Weld J, Walsh C, Cullinane A.The aim of this study was to identify respiratory viruses circulating amongst elite racehorses in a training yard by serological testing of serial samples and to determine their impact on health status and ability to race. A six-month longitudinal study was conducted in 30 Thoroughbred racehorses (21 two-year-olds, five three-year-olds and four four-year-olds) during the Flat racing season. Sera were tested for the presence of antibodies against equine herpesvirus 1 and 4 (EHV-1 and EHV-4) and equine rhinitis viruses A and B (ERAV and ERBV) by complement fixation (CF) and equine arteritis viru...
Gonzales-Viera O, Fritz H, Mete A.A 7-month-old female mixed breed foal with a 2-day history of recumbency and inability to open its mouth convulsed acutely and died and was submitted for necropsy examination. The foal was thin and large patches of haemorrhage were present throughout the peritoneal wall, the diaphragmatic surfaces and the retroperitoneum. Numerous nematode larvae were visible on the serosal surfaces and penetrated and embedded into the subserosa associated with the haemorrhages. The dorsal portion of the abdominal diaphragm had a partial tear and large numbers of nematodes were within the muscle fibres. Histol...
Aurich C, Müller-Herbst S, Reineking W, Müller E, Wohlsein P, Gunreben B, Aurich J.Warmblood fragile foal syndrome (WFFS) is a monogenetic defect with autosomal recessive inheritance. The WFFS homozygosity is non-compatible with extra-uterine life. Although as many as 15% of Warmblood horses are WFFS carriers, there has been little veterinary focus on this condition. The aim of this study was to determine outcomes and symptoms of clinical signs and pathological abnormalities during pregnancies when there were WFFS homozygous foetuses. Diagnostic material of 15 abortion or stillbirth cases with suspected diagnosis of WFFS was available for this study. Additionally, there were...
Rivas VN, Aleman M, Peterson JA, Dahlgren AR, Hales EN, Finno CJ.Juvenile idiopathic epilepsy (JIE) is an inherited disease characterized by recurrent seizures during the first year of life in Egyptian Arabian horses. Definitive diagnosis requires an electroencephalogram (EEG) performed by a veterinary specialist. A recent study has suggested that a 19 base-pair deletion, along with a triple-C insertion, in intron five of twelve (∆19InsCCC; chr20:29542397-29542425: GTTCAGGGGACCACATGGCTCTCTATAGA>TATCTTAAGACCC) of the () gene is associated with JIE. To confirm this association, a new sample set consisting of nine EEG-phenotyped affected and nine unaffec...
Kydd JH, Hannant D, Robinson RS, Bryant N, Osterrieder N.Equid herpesvirus-1 (EHV-1) causes respiratory and neurological disease and late gestation abortion in pregnant mares. Current vaccines contain either inactivated or live EHV-1, but fail to provide complete clinical or virological protection, namely prevention of nasopharyngeal shedding and cell-associated viraemia. Thus, the development of novel products, such as modified live virus (MLV) vaccines which stimulate virus-specific, humoral and cell mediated immune responses more effectively remains a priority. Two groups of weaned foals (n = 6 each group) were used in a longitudinal, prospec...
Álvarez-Narváez S, Giguère S, Anastasi E, Hearn J, Scortti M, Vázquez-Boland JA.Antibiotic use has been linked to changes in the population structure of human pathogens and the clonal expansion of multidrug-resistant (MDR) strains among healthcare- and community-acquired infections. Here we present a compelling example in a veterinary pathogen, , the causative agent of a severe pulmonary infection affecting foals worldwide. We show that the (46) gene responsible for emerging macrolide resistance among equine isolates in the United States is part of a 6.9-kb transposable element, Tn, actively mobilized by an IS family transposase. Tn is carried on an 87-kb conjugative pla...
Orellana-Guerrero D, Renaudin C, Edwards L, Rose E, Aleman M, Moore PF, Dujovne G.Placentitis has been reported as the most important cause of equine abortions, stillbirths, and perinatal deaths in horses. Most cases are caused by bacteria and less commonly by fungal elements. The aim of this report is to describe the clinical presentation of a fungal placentitis caused by Aspergillus terrerus. A 5-year-old thoroughbred maiden mare at the 217th day of gestation presented with some classic signs of placentitis (premature udder development and milk dripping). All ultrasonographic findings were consistent with a live fetus and a severe placentitis. On vaginal examination, pur...
Fernandes CB, Ball BA, Loux SC, Boakari YL, Scoggin KE, El-Sheikh Ali H, Cogliati B, Esteller-Vico A.Anatomical and molecular changes in the cervical barrier in women are a fundamental part of the pathogenesis of pregnancy loss associated with chorioamnionitis. However, there is little information regarding changes in the cervix associated with ascending infection in pregnant mares. To better characterize morphological and molecular changes in the cervix during placentitis, we examined full thickness histology and mRNA expression for a number of inflammatory and endocrine factors in the mucosa and stroma of the cervix of mares (n = 5) after experimental induction of placentitis via transc...
Santschi EM, Slone DE, Embertson RM, Clayton MK, Markel MD.The purpose of our study was to determine the types of lesions that cause colic in juvenile Thoroughbreds, factors associated with these lesions and the subsequent survival and athletic performance of the juveniles. The age of juvenile Thoroughbreds requiring surgical exploration for abdominal pain has an influence on the type of lesion causing colic. The short-term survival rate (discharge from the hospital) after colic surgery for foals was 85% and was strongly influenced by the lesion causing colic. Thirteen percent of juveniles recovered from the first surgery experienced another severe co...
Gallhoefer NS, Spiess BM, Guscetti F, Hilbe M, Hartnack S, Hafezi F, Pot SA.CXL penetration depth is an important variable influencing clinical treatment effect and safety. The purposes of this study were to determine the penetration depth of CXL in rabbit and equine corneas in epithelium-on and epithelium-off procedures and to assess an ex vivo fluorescent biomarker staining assay for objective assessment of CXL penetration depth. Methods: CXL treatment was performed according to a standardized protocol on 21 and 17 rabbit eyes and on 12 and 10 equine eyes with and without debridement, respectively. Control corneas were treated similarly, but not exposed to CXL. Hem...
Hamond C, Pinna A, Martins G, Lilenbaum W.Leptospirosis is a zoonotic disease of global importance and has a worldwide distribution. This infection displays clear seasonal nature in some regions of the tropics, where the rainy season is marked by high temperatures. Household and wild animals carry leptospires and contribute to their dissemination in nature. Transmission mainly occurs by contact with water contaminated with the urine of infected animals, and consequently, it is quite widespread especially in times of rain, since many areas are subject to flooding and have poor sanitation. Serological tests demonstrate that Leptospira s...
Knowles EJ, Elliott J, Harris PA, Chang YM, Menzies-Gow NJ.Quantifying risk factors for laminitis development requires improvement. Objective: To identify the most useful physical examination, metabolic and management factors to predict laminitis development in client-owned, nonlaminitic ponies. Methods: Prospective cohort study. Methods: Physical examination, metabolic and management data were collected from a pony cohort 6 monthly for up to 4 years. Ponies were monitored for the development of laminitis. Metabolic data included basal plasma concentrations of ACTH ([ACTH]), adiponectin ([adiponectin]), triglycerides and glucose. Serum insulin concen...
Furrer E, Bilzer T, Stitz L, Planz O.Experimental Borna disease virus (BDV) infection of rats and natural infection of horses and sheep leads to severe central nervous system disease based on immunopathological pathways. The virus replicates slowly, and the cellular immune response results in immunopathology. CD8(+) T cells exert effector cell functions, and their activity results in the destruction of virus-infected cells. Previously, Oldach and colleagues (D. Oldach, M. C. Zink, J. M. Pyper, S. Herzog, R. Rott, O. Narayan, and J. E. Clements, Virology 206:426-434, 1995) have reported protection against Borna disease after inocu...
Bryant UK, Lyons ET, Bain FT, Hong CB.A 13-week-old Thoroughbred colt from central Kentucky was euthanized after an acute onset of ataxia, blindness, head tremors, leaning to the right, recumbency, and seizures. Microscopically, there was a verminous meningoencephalitis characterized by an eosinophilic and granulomatous inflammatory reaction primarily affecting the cerebellum. Dispersed within regions of inflammation were numerous cross and longitudinal sections of intact and degenerative small nematodes. The nematodes had dorsoflexed ovaries and ventroflexed vulvas, which are distinguishing features of Halicephalobus gingivalis. ...
Jemmerson R, Margoliash E.Seven populations of site-specific antibodies were isolated from each of three sera of rabbits immunized against glutaraldehyde-polymerized horse cytochrome c. The antibodies were separated using an immunoadsorption scheme which employed the following cytochromes c: horse, beef, guanaco, rabbit, mouse testicular, pigeon, and the cyanogen-bromide cleaved fragment of the rabbit protein containing residues 1 to 65. The monovalent, antigen-binding fragments of the antibodies (Fab') gave 1:1 stoichiometries with native horse cytochrome c in fluorescence quenching assays. Cross-reactivities with het...
Traversa D, Kuzmina T, Kharchenko VA, Iorio R, Klei TR, Otranto D.This study investigated the genetic variability within Cylicocyclus nassatus (Nematoda, Strongylida, Cyathostominae) collected from different domestic and wild hosts (i.e. horse, donkey, Przewalskii horse, tarpan and Turkmen kulan) and localities in Europe and/or USA. The ribosomal Internal Transcribed Spacer 2 (ITS2) and the mitochondrial cytochrome c oxidase subunit 1 (cox1) gene were PCR-amplified and sequences characterized from seventy individual parasitic specimens. While ITS2 displayed 0-0.6% variation rate among all individual adult specimens of C. nassatus examined, 22 different seque...
Two closed horse herds (Old Lot 4 and Field 24), infected since 1966 with Population B small strongyles resistant to thiabendazole (TBZ) and phenothiazine (PTZ), were terminated in February, March, and May, 2005. At necropsy, only the large endoparasites were identified and counted. The number of horses on pasture was 14 (239 days of age to 23 years old) for Old Lot 4 and two (3 to 20 years old) for Field 24. The time of the last antiparasitic treatment, relative to the year (2005) of necropsy, was 26 years for Old Lot 4 and 9 years for Field 24 horses. Gasterophilus intestinalis third instars...
Yaniv A, Dahlberg J, Gazit A, Sherman L, Chiu IM, Tronick SR, Aaronson SA.Molecular clones of the integrated form of the genome of equine infectious anemia virus (EIAV), the etiologic agent of a naturally occurring, worldwide disease of horses, were obtained. The restriction map of a full-length genome was determined. Additional evidence for the close evolutionary relationship between EIAV and a prototype lentivirus (caprine arthritis encephalitis virus) was acquired by Southern blotting and immunological analyses. An interspecies radioimmunoassay was developed in which EIAV and ovine and caprine lentiviruses could be detected equally well. These studies make availa...
Boschwitz JS, Timoney JF.The antiphagocytic property of equine fibrinogen for Streptococcus equi subsp. equi strain CF32 was examined in vitro. The results of bactericidal assays demonstrated that the presence of fibrinogen enhanced the ability of overnight and early log-phase cultures of strain CF32 to resist killing by equine neutrophils by 12-fold and seven-fold, respectively (p > 0.01). In addition, fibrinogen-coated bacteria treated with fibrinogen specific F(ab')2 fragments were 32% more susceptible to killing by equine neutrophils after opsonization in serum (p > 0.05), indicating that specific epitopes o...
Laroucau K, Colaneri C, Jaÿ M, Corde Y, Drapeau A, Durand B, Zientara S, Beck C.To evaluate the routine complement fixation test (CFT) used to detect Burkholderia mallei antibodies in equine sera, an interlaboratory proficiency test was held with 24 European laboratories, including 22 National Reference Laboratories for glanders. The panels sent to participants were composed of sera with or without B mallei antibodies. This study confirmed the reliability of CFT and highlighted its intralaboratory reproducibility. However, the sensitivity of glanders serodiagnosis and laboratory proficiency may be improved by standardising critical reagents, including antigens, and by dev...
Kainzbauer C, Rushton J, Tober R, Scase T, Nell B, Sykora S, Brandt S.In January 2010, 18 months after excision of an ocular squamous cell carcinoma (SCC), a Connemara mare presented with anorexia and periorbital/parotideal lesions. Post mortem examination revealed these lesions as forming one entity, with 2 additional growths in the retropharyngeal region and the left jugular groove, respectively. The lesions were confirmed histopathologically as SCCs. Using PCR, peripheral blood mononuclear cells (PBMCs) from 2008 and 2010, tumour tissue, intact skin and vulval mucosa were screened for Equus caballus papillomavirus type 2 (EcPV-2) and bovine papillomavirus typ...
Reinisch AI.Six recent cases of animal hoarding in Manitoba were compared to the relevant literature. Cases were similar to previous reports in age and demographics of hoarders. Five cases involved small mammals and 1 case involved horses. Understanding this phenomenon would be enhanced by consistent investigative format and reporting and closer working relationships with public health. Six cas récents d’amassement d’animaux au Manitoba ont été comparés à la documentation pertinente. Les cas étaient semblables à des rapports antérieurs relativement à l’âge et aux données démographiques ...
Misra KK, Roy S, Choudhury A.Trypanosoma (Trypanozoon) evansi is a causative agent of the dreadful mammalian disease trypanosomiasis or 'Surra' and carried as a latent parasite in domestic cattle but occasionally proves fatal when transmitted to horses and camel. Sporadic outbreak of 'Surra' to different animals (beside their natural hosts) reminds that T. evansi may be zoonotic, as their close relative cause sleeping sickness to human being. This haemoflagellate is mechanically transmitted by horse fly and its effect on different host varies depending on certain factors including the effectiveness of transmission by mech...
Morita H, Shiratori C, Murakami M, Takami H, Kato Y, Endo A, Nakajima F, Takagi M, Akita H, Okada S, Masaoka T.Two strains, KBL13(T) and GBL13, were isolated as one of intestinal lactobacilli from the faecal specimens from different thoroughbreds of the same farm where they were born in Hokkaido, Japan. They were Gram-positive, facultatively anaerobic, catalase-negative, non-spore-forming and non-motile rods. KBL13(T) and GBL13 homofermentatively metabolize glucose, and produce lactate as the sole final product from glucose. The 16S rRNA gene sequence, DNA-DNA hybridization, DNA G+C content and biochemical characterization indicated that these two strains, KBL13(T) and GBL13, belong to the same species...
Covaleda L, Fuller FJ, Payne SL.Equine infectious anemia virus (EIAV) infection is distinctive in that it causes a rapid onset of clinical disease relative to other retroviruses. In order to understand the interaction dynamics between EIAV and the host immune response, we explored the effects of EIAV and its S2 protein in the regulation of the cytokine and chemokine response in macrophages. EIAV infection markedly altered the expression pattern of a variety of pro-inflammatory cytokines and chemokines monitored in the study. Comparative studies in the cytokine response between EIAV(17) and EIAV(17DeltaS2) infection revealed ...
Zheng YH, Sentsui H, Kono Y, Ikuta K.An attenuated equine infectious anemia virus (EIAV), named V26, was previously obtained after 50 passages of the Japanese virulent strain V70 in primary macrophage culture. To clarify the differences between both viruses, their full-length sequences were determined. There were higher mutations in S2 (6.15% amino acid difference) and LTR (10.7% nucleotide difference). The presumed initiation codon of the S2 gene was absent from the sequence of V26. There was a large insertion within the long-terminal repeat (LTR) U3 hypervariable region of V26. In addition, there were minor mutations in gag (1....
Coleman M, Kuskie K, Liu M, Chaffin K, Libal M, Giguère S, Bernstein L, Cohen N.The objective of this study was to determine the in vitro antimicrobial activity of gallium maltolate (GaM) against Rhodococcus equi. A total of 98 virulent bacterial isolates from equine clinical cases were examined, of which 19 isolates were known to be resistant to macrolides and rifampin. Isolates were cultured with various concentrations of GaM and minimal inhibitory concentration (MIC) values were determined after 24 and 48 h. Both the MIC(50) and the MIC(90) after 24h of growth were 558 ng/mL (8 μM) and after 48 h of growth were 2230 ng/mL (32 μM). There were no apparent differences b...
Burrows R, Denyer M, Goodridge D, Hamilton F.Experimental ponies developed signs of disease four days after the intranasal instillation of A/England 1/79 equine influenza virus and virus was recovered from the nasopharynx from the second to the ninth day. No significant antigenic difference was found between the virus and the prototype A/Miami 1/63 virus, using post infection ferret and chicken sera and post vaccination pony sera. No antigenic differences were found between four viruses isolated between January and July 1979, although some differences were found in their ability to detect haemagglutination inhibiting antibody in convales...
Tözsér J, Friedman D, Weber IT, Bláha I, Oroszlan S.The proteinase of the equine infectious anemia virus (EIAV), a lentivirus closely related to human immunodeficiency virus (HIV), was purified from concentrated virus. The specificity of the enzyme was characterized using oligopeptides representing naturally occurring cleavage sites in the Gag and Gag-Pol polyproteins. The length of the substrate binding pocket was found to be 1-2 residues longer than that of HIV proteinases. Although the EIAV and HIV proteinases cleaved most of the peptides at the same bond, some were hydrolyzed by only the EIAV enzyme. Oligopeptides representing cleavage site...
Johnson ACB, Biddle AS.Cyathostomins are a multispecies parasite ubiquitous in Equids. Cyathostomins have developed resistance to all but one class of anthelmintics, but species-level sensitivity to anthelmintics has not been shown. This study measured reinfection rates of cyathostomin species following the administration of three commercial dewormers. Nine treated horses were compared with 90 untreated controls during June-September 2017-2019. Ivermectin (IVM) (n = 6), Moxidectin (MOX) (n = 8) or Pyrantel (PYR) (n = 8) were orally administered. Fecal samples were collected every 14 d for 98 d. Fecal egg count reduc...
Goodrich EL, Mittel LD, Glaser A, Ness SL, Radcliffe RM, Divers TJ.This case report describes an outbreak and novel findings associated with a beta coronavirus (BCoV) infection that occurred on an American Miniature Horse (AMH) breeding farm in upstate New York, in January and February of 2013. Twenty-nine AMH and one donkey were present on the farm when the outbreak occurred. One 10-year-old Quarter Horse mare, stabled at a separate location and owned by an employee of the farm, also tested positive. A polymerase chain reaction (PCR) assay for the detection of BCoV was performed at the Animal Health Diagnostic Center (AHDC) at Cornell on all faecal samples. ...
Gray WL, Yalamanchili R, Raengsakulrach B, Baumann RP, Staczek J, O'Callaghan DJ.Equine herpesvirus type 1 (EHV-1) preparations enriched in defective interfering particles (DIPs) have previously been demonstrated to mediate the coestablishment of persistent infection and oncogenic transformation in primary hamster embryo fibroblasts. In this study, it was demonstrated that infection of a rabbit kidney (RK) cell line with EHV-1 DIP-enriched preparations also results in the establishment of persistent infection. Viral transcription was characterized in RK cells infected with DIP-enriched stocks and compared to viral transcription in RK cells infected with standard (STD) EHV-...
Veronesi F, Moretta I, Moretti A, Fioretti DP, Genchi C.A study was carried out to assess the field efficacy of ivermectin (IVM) and pyrantel pamoate (PYR) against Parascaris equorum. Seventy-three foals (3-18 months old) from 5 stud farms, not treated with anthelmintics in the previous 10 weeks and with individual faecal egg counts (FEC) >200, were included in the study. For each stud farm, 5-7 foals were included in the IVM-treatment group (IVM 0.2%, 200 mcg/kg body weight) or in the PYR-treatment group (PYR 38%, 13.2mg/kg body weight) and 3 were untreated as controls. For each foal, FECs were carried out before treatment (Day 0) and on Days 7 an...
Żychska M, Witkowski L, Klementowska A, Rzewuska M, Kwiecień E, Stefańska I, Czopowicz M, Szaluś-Jordanow O, Mickiewicz M, Moroz A, Bonecka J.... infection is commonly known in equine medicine to cause frequently fatal rhodococcosis. Infections in other species and people are also reported. Clinical manifestation in goats is relatively similar to horses and humans, but data regarding bacterium prevalence are scarce. Thus, the study aimed to estimate the occurrence of in goats. Methods: During post mortem examination, submandibular, mediastinal, and mesenteric lymph nodes were collected. Standard methods were used for bacteria isolation and identification. Results: A total of 134 goats were examined, and 272 lymph node samples were col...
Egberink H, Horzinek MC.Feline immunodeficiency virus (FIV) has morphological, physical and biochemical characteristics similar to human immunodeficiency virus (HIV), the cause of AIDS in man. However, it is antigenically and genetically distinct from HIV; an antigenic relatedness with equine infectious anaemia virus has been demonstrated. FIV has been molecularly cloned and sequenced. Diagnostic tests are commercially available and attempts at preparing inactivated, subunit and molecularly engineered vaccines are being made in different laboratories. During FIV infection a transient primary illness can be recognized...
van der Kuyl AC.Information on endogenous retroviruses fixed in the horse (Equus caballus) genome is scarce. The recent availability of a draft sequence of the horse genome enables the detection of such integrated viruses by similarity search. Using translated nucleotide fragments from gamma-, beta-, and delta-retroviral genera for initial searches, a full-length beta-retrovirus genome was retrieved from a horse chromosome 5 contig. The provirus, tentatively named EqERV-beta1 (for the first equine endogenous beta-retrovirus), was 10434 nucleotide (nt) in length with the usual retroviral genome structure of 5'...
Stratton-Phelps M, Wilson WD, Gardner IA.To determine whether foals with pneumonia that were treated with erythromycin, alone or in combination with rifampin or gentamicin, had a higher risk of developing adverse effects, compared with foals treated with trimethoprim-sulfamethoxazole (TMS), penicillin G procaine (PGP), or a combination of TMS and PGP (control foals). Methods: Retrospective study. Methods: 143 foals < 240 days old. Methods: Information on age, sex, breed, primary drug treatment, total days of treatment with the primary drug, and whether the foal developed diarrhea, hyperthermia, or respiratory distress was obtained...
Schoster A, Staempfli HR, Arroyo LG, Reid-Smith RJ, Janecko N, Shewen PE, Weese JS.Point prevalence studies have reported carriage rates of enteric pathogens in healthy horses, but longitudinal data are lacking. Commensal E. coli is an indicator organism to evaluate antimicrobial resistance of enteric bacteria, yet there are limited data for horses. The objectives of this study were to investigate and molecularly characterize isolates of Clostridium difficile, Clostridium perfringens and Salmonella, collected sequentially over a one year period, and to determine the antibiotic susceptibility profile for E. coli. Fecal samples were collected monthly from 25 adult horses for o...