Analyze Diet

Topic:Disease

The study of diseases in horses encompasses a wide range of conditions affecting equine health, including infectious diseases, metabolic disorders, and genetic abnormalities. These diseases can impact various systems within the horse, such as respiratory, gastrointestinal, and musculoskeletal systems, and can lead to significant health challenges. Research in this area focuses on understanding the pathophysiology, diagnosis, prevention, and treatment of equine diseases. Common diseases studied include equine influenza, equine herpesvirus, and laminitis. This page provides access to peer-reviewed research studies and scholarly articles that explore the etiology, clinical presentation, and management strategies of diseases in horses, contributing to the advancement of equine veterinary medicine.
Molecular characterization in the toll-like receptor 9 gene of Cape Mountain Zebra (Equus zebra zebra) from three populations.
Infection, genetics and evolution : journal of molecular epidemiology and evolutionary genetics in infectious diseases    November 14, 2019   Volume 78 104118 doi: 10.1016/j.meegid.2019.104118
Smith RM, Kotzé A, Grobler JP, Dalton DL.Toll-like receptors (TLR) are a family of proteins that signal activation of the innate immune response through the recognition of a variety of pathogen molecular compounds. Here, we characterized the complete TLR9 gene in Cape mountain zebra (Equus zebra zebra) from three populations in South Africa and compared sequences to a variety of horse and donkey breeds. Overall, we identified six single nucleotide polymorpHisms (SNPs). A single SNP (G586S) was non-synonymous, whereas the remaining SNPs were synonymous. The G586S alteration was detected in Cape mountain zebra populations with varying ...
First Report Regarding the Simultaneous Molecular Detection of Anaplasma marginale and Theileria annulata in Equine Blood Samples Collected from Southern Punjab in Pakistan.
Acta parasitologica    November 13, 2019   Volume 65, Issue 1 259-263 doi: 10.2478/s11686-019-00141-w
Asif M, Parveen A, Ashraf S, Hussain M, Aktas M, Ozubek S, Shaikh RS, Iqbal F.The present study was designed to check the molecular detection of Anaplasma marginale and Theileria annulata in blood samples of horses and donkeys collected from Dera Ghazi Khan District in Punjab and to document their phylogenetic origin and their association with studied epidemiological factors (sex and age) and complete blood count parameters, if any. Results: A total of 195 blood samples were collected from apparently healthy horses (N = 141) and donkeys (N = 54). A. marginale DNA was detected by PCR in 4.9% (7/141) horse and in 9.2% (5/54) of donkey blood samples. Prevalence of ...
Equine herpesvirus-1 genotype did not significantly affect clinical signs and disease outcome in 65 horses diagnosed with equine herpesvirus-1 myeloencephalopathy.
Veterinary journal (London, England : 1997)    November 13, 2019   Volume 255 105407 doi: 10.1016/j.tvjl.2019.105407
Pusterla N, Hatch K, Crossley B, Wademan C, Barnum S, Flynn K.The objective of this study was to determine if the genotype of equine herpesvirus-1 (EHV-1) impacted clinical disease and outcome of horses with laboratory confirmed equine herpesvirus myeloencephalopathy (EHM). Medical records from 65 horses diagnosed with EHM from 2011 to 2019 were reviewed for signalment, presence and severity of clinical signs (lethargy, fever, ataxia, urinary incontinence) and outcome. Horses were further grouped based on the EHV-1 genotype into neuropathic (D) or non-neuropathic (N) EHV-1 infection. Between the two EHV-1 genotype groups, age and sex distributions were s...
Radiographic tracheal lumen to vertebral ratios in the normal American Miniature Horse.
Equine veterinary journal    November 8, 2019   Volume 52, Issue 3 428-434 doi: 10.1111/evj.13189
Every LJ, Hostnik ET, Hostnik LD, Yardley J, Shore-Khirallah AT, Thompson A, Linn SC.Tracheal collapse in horses is reportedly uncommon; however, American Miniature Horses are more commonly affected. There is no description of the tracheal luminal diameter of American Miniature Horses, making early detection of tracheal luminal narrowing difficult. Objective: To 1) describe radiographic tracheal luminal diameter in clinically normal American Miniature Horses, 2) report the prevalence of subclinical tracheal collapse in a population of American Miniature Horses, and 3) use tracheal videofluoroscopy to quantify variation in tracheal luminal diameter throughout the respiratory c...
What is your diagnosis? Nasal lesion in a horse with exophthalmos.
Veterinary clinical pathology    November 7, 2019   Volume 48, Issue 4 771-773 doi: 10.1111/vcp.12790
Zibura AE, Manning LK, Gwynn A, Sharkey L, de Linde Henriksen M, Coppelman E, O'Brien TD.No abstract available
Identification of a mecA/mecC-positive MRSA ST1-t127 isolate from a racehorse in Japan.
The Journal of antimicrobial chemotherapy    November 7, 2019   Volume 75, Issue 2 292-295 doi: 10.1093/jac/dkz459
Sekizuka T, Niwa H, Kinoshita Y, Uchida-Fujii E, Inamine Y, Hashino M, Kuroda M.MRSA is a known pathogen that affects horses. We investigated an equine MRSA isolate for potential antimicrobial resistance genes, classified the staphylococcal cassette chromosome mec (SCCmec) and identified the strain-specific dissemination in the horse community based on WGS. WGS, using short-read sequencing, and subsequent long-read sequencing by hybrid assembly, was conducted to obtain a complete genome sequence. Pairwise sequence alignment of relative SCCmec sequences and core-genome phylogenetic analysis were performed to highlight transmission routes of the SCCmec and MRSA strain-speci...
Outcome of horses with enterocolitis receiving oncotic fluid support with either plasma or hetastarch.
The Canadian veterinary journal = La revue veterinaire canadienne    November 7, 2019   Volume 60, Issue 11 1207-1212 
Kopper JJ, Kogan CJ, Cook VL, Schott HC.The objective of this study was to determine whether there was an association between type of colloid administered and survival of horses with enterocolitis (N = 92). A retrospective review of medical records of horses with enterocolitis treated with plasma or hetastarch (HES) between January 1, 2005 and December 31, 2011 was performed. Data collected included signalment, outcome, physical and clinicopathologic findings, and volume and type of colloid administered. Sixty-nine horses (75%) were treated with plasma and 23 horses (25%) were treated with HES. After accounting for confounding varia...
The effect of equine herpesvirus type 4 on type-I interferon signaling molecules.
Veterinary immunology and immunopathology    November 2, 2019   Volume 219 109971 doi: 10.1016/j.vetimm.2019.109971
Oladunni FS, Reedy S, Balasuriya UBR, Horohov DW, Chambers TM.Equine herpesvirus type 4 (EHV-4) is mildly pathogenic but is a common cause of respiratory disease in horses worldwide. We previously demonstrated that unlike EHV-1, EHV-4 is not a potent inducer of type-I IFN and does not suppress that IFN response, especially during late infection, when compared to EHV-1 infection in equine endothelial cells (EECs). Here, we investigated the impact of EHV-4 infection in EECs on type-I IFN signaling molecules at 3, 6, and 12 hpi. Findings from our study revealed that EHV-4 did not induce nor suppress TLR3 and TLR4 expression in EECs at all the studied time...
Assessing the potential of plains zebra to maintain African horse sickness in the Western Cape Province, South Africa.
PloS one    October 31, 2019   Volume 14, Issue 10 e0222366 doi: 10.1371/journal.pone.0222366
Porphyre T, Grewar JD.African horse sickness (AHS) is a disease of equids that results in a non-tariff barrier to the trade of live equids from affected countries. AHS is endemic in South Africa except for a controlled area in the Western Cape Province (WCP) where sporadic outbreaks have occurred in the past 2 decades. There is potential that the presence of zebra populations, thought to be the natural reservoir hosts for AHS, in the WCP could maintain AHS virus circulation in the area and act as a year-round source of infection for horses. However, it remains unclear whether the epidemiology or the ecological cond...
An Equine Herpesvirus Type 1 (EHV-1) Ab4 Open Reading Frame 2 Deletion Mutant Provides Immunity and Protection from EHV-1 Infection and Disease.
Journal of virology    October 29, 2019   Volume 93, Issue 22 e01011-19 doi: 10.1128/JVI.01011-19
Schnabel CL, Babasyan S, Rollins A, Freer H, Wimer CL, Perkins GA, Raza F, Osterrieder N, Wagner B.Equine herpesvirus type 1 (EHV-1) outbreaks continue to occur despite widely used vaccination. Therefore, development of EHV-1 vaccines providing improved immunity and protection is ongoing. Here, an open reading frame 2 deletion mutant of the neuropathogenic EHV-1 strain Ab4 (Ab4ΔORF2) was tested as a vaccine candidate. Three groups of horses ( = 8 each) were infected intranasally with Ab4ΔORF2 or the parent Ab4 virus or were kept as noninfected controls. Horses infected with Ab4ΔORF2 had reduced fever and nasal virus shedding compared to those infected with Ab4 but mounted similar ada...
The contribution of domestic animals to the transmission of schistosomiasis japonica in the Lindu Subdistrict of the Central Sulawesi Province, Indonesia.
Veterinary world    October 23, 2019   Volume 12, Issue 10 1591-1598 doi: 10.14202/vetworld.2019.1591-1598
Budiono NG, Satrija F, Ridwan Y, Handharyani E, Murtini S.Schistosomiasis is endemic in Indonesia and is found in three remote areas in Central Sulawesi Province. Non-human mammals serve as reservoir hosts, meaning the disease is zoonotic. The previous schistosomiasis studies in animals from the Lindu Subdistrict did not determine which domestic animal species can serve as the primary source of transmission. No animals have been treated in Indonesia to control the disease; therefore, the parasite's life cycle is not blocked entirely. This study aimed to determine the prevalence and identify the risk factors associated with, infection in animals, and...
Differences in microbiome and virome between cattle and horses in the same farm.
Asian-Australasian journal of animal sciences    October 22, 2019   Volume 33, Issue 6 1042-1055 doi: 10.5713/ajas.19.0267
Park J, Kim EB.The ecosystem of an animal farm is composed of various elements, such as animals, farmers, plants, feed, soil, and microorganisms. A domesticated animal's health is largely connected with the reservoir of bacteria and viruses in animal farms. Although a few studies have focused on exploring the gut microbiome of animals, communities of microbiota and viruses in feedlots have not been thoroughly investigated. Methods: Here, we collected feces and dust samples (4 groups: cattle feces, C_F; horse feces, H_F; cattle dust, C_D; and horse dust, H_D) from cattle and horse farms sharing the same housi...
Cauda equina syndrome in an ovarian malignant-mixed müllerian tumor with leptomeningeal spread.
Clinical case reports    October 22, 2019   Volume 7, Issue 12 2341-2345 doi: 10.1002/ccr3.2472
Bernstock JD, Ostby S, Fox B, Sotoudeh H, Janssen A, Kang YJ, Chen J, Prattipati V, Elsayed G, Chagoya G, Yamashita D, Friedman GK, Nabors B, Huh WK....Leptomeningeal metastasis is extremely rare in patients with ovarian cancer, but should be considered in patients presenting with neurologic deficits such as cauda equine syndrome. Given its poor prognosis and lack of data currently on management, additional studies are needed to optimize treatment regimens and improve outcomes.
Molecular investigation and phylogeny of species of the Anaplasmataceae infecting animals and ticks in Senegal.
Parasites & vectors    October 22, 2019   Volume 12, Issue 1 495 doi: 10.1186/s13071-019-3742-y
Dahmani M, Davoust B, Sambou M, Bassene H, Scandola P, Ameur T, Raoult D, Fenollar F, Mediannikov O.Our study aimed to assess the diversity of the species of Anaplasmataceae in Senegal that infect animals and ticks in three areas: near Keur Momar Sarr (northern region), Dielmo and Diop (Sine Saloum, central region of Senegal), and in Casamance (southern region of Senegal). Methods: A total of 204 ticks and 433 blood samples were collected from ruminants, horses, donkeys and dogs. Ticks were identified morphologically and by molecular characterization targeting the 12S rRNA gene. Molecular characterization of species of Anaplasmataceae infecting Senegalese ticks and animals was conducted usin...
[Ovarian Mixed Tumor in a Mare].
Tierarztliche Praxis. Ausgabe G, Grosstiere/Nutztiere    October 21, 2019   Volume 47, Issue 5 328 doi: 10.1055/a-1004-9889
Pinna AE, Okada CTC, Ferreira CSC et al. Double ovarian tumor in the mare: case report. Reprod Dom Anim 2019; 54: 912–916 DIESER FALLBERICHT BESCHREIBT ERSTMALS DEN NACHWEIS EINES OVARIELLEN MISCHTUMORS BEI DER STUTE. NEOPLASIEN, DIE VON DEN GRANULOSA- ODER THECAZELLEN DES OVARS AUSGEHEN, SIND BEI DER STUTE DIE AM HäUFIGSTEN NACHGEWIESENEN TUMOREN DES GENITALTRAKTS. ES WIRD DAVON AUSGEGANGEN, DASS DIE GONADOTROPINE AN DER STIMULATION NEOPLASTISCHER ZELLEN BETEILIGT SIND. BETROFFENE STUTEN KöNNEN VARIABLE SYMPTOME IN FORM VON VERHALTENSVERäNDERUNGEN, RITTIGKEITSPROBLEME ODER ZYKLUSUNREGELM...
Transendoscopic correction of epiglottic entrapment with a silicone-covered laser guide and diode laser in 29 horses.
Veterinary surgery : VS    October 21, 2019   Volume 49, Issue 1 131-137 doi: 10.1111/vsu.13338
Beste KJ, Ortved KF, Rossignol F, Ducharme NG.To describe the use of a silicone-covered laser guide and diode laser for surgical correction of epiglottic entrapment and report postoperative outcomes in horses with epiglottic entrapment. Methods: Retrospective case series. Methods: Thoroughbred and standardbred racehorses (n = 29) with epiglottic entrapment. Methods: A silicone-covered laser guide was placed endoscopically to direct the diode laser cutting action during transection of the entrapping subepiglottic membrane and to act as a physical barrier between the membrane and the epiglottic cartilage. Postoperative complications and tra...
Longitudinal study of electrical, functional and structural remodelling in an equine model of atrial fibrillation.
BMC cardiovascular disorders    October 21, 2019   Volume 19, Issue 1 228 doi: 10.1186/s12872-019-1210-4
Hesselkilde EZ, Carstensen H, Flethøj M, Fenner M, Kruse DD, Sattler SM, Tfelt-Hansen J, Pehrson S, Braunstein TH, Carlson J, Platonov PG....Large animal models are important in atrial fibrillation (AF) research, as they can be used to study the pathophysiology of AF and new therapeutic approaches. Unlike other animal models, horses spontaneously develop AF and could therefore serve as a bona fide model in AF research. We therefore aimed to study the electrical, functional and structural remodelling caused by chronic AF in a horse model. Nine female horses were included in the study, with six horses tachypaced into self-sustained AF and three that served as a time-matched sham-operated control group. Acceleration in atrial fibrilla...
Equine Rhinitis A Virus Infection in Thoroughbred Racehorses-A Putative Role in Poor Performance?
Viruses    October 18, 2019   Volume 11, Issue 10 doi: 10.3390/v11100963
Back H, Weld J, Walsh C, Cullinane A.The aim of this study was to identify respiratory viruses circulating amongst elite racehorses in a training yard by serological testing of serial samples and to determine their impact on health status and ability to race. A six-month longitudinal study was conducted in 30 Thoroughbred racehorses (21 two-year-olds, five three-year-olds and four four-year-olds) during the Flat racing season. Sera were tested for the presence of antibodies against equine herpesvirus 1 and 4 (EHV-1 and EHV-4) and equine rhinitis viruses A and B (ERAV and ERBV) by complement fixation (CF) and equine arteritis viru...
Fatal Peritoneal Migration of Strongylus edentatus in a Foal.
Journal of comparative pathology    October 18, 2019   Volume 172 88-92 doi: 10.1016/j.jcpa.2019.09.004
Gonzales-Viera O, Fritz H, Mete A.A 7-month-old female mixed breed foal with a 2-day history of recumbency and inability to open its mouth convulsed acutely and died and was submitted for necropsy examination. The foal was thin and large patches of haemorrhage were present throughout the peritoneal wall, the diaphragmatic surfaces and the retroperitoneum. Numerous nematode larvae were visible on the serosal surfaces and penetrated and embedded into the subserosa associated with the haemorrhages. The dorsal portion of the abdominal diaphragm had a partial tear and large numbers of nematodes were within the muscle fibres. Histol...
Characterization of abortion, stillbirth and non-viable foals homozygous for the Warmblood Fragile Foal Syndrome.
Animal reproduction science    October 17, 2019   Volume 211 106202 doi: 10.1016/j.anireprosci.2019.106202
Aurich C, Müller-Herbst S, Reineking W, Müller E, Wohlsein P, Gunreben B, Aurich J.Warmblood fragile foal syndrome (WFFS) is a monogenetic defect with autosomal recessive inheritance. The WFFS homozygosity is non-compatible with extra-uterine life. Although as many as 15% of Warmblood horses are WFFS carriers, there has been little veterinary focus on this condition. The aim of this study was to determine outcomes and symptoms of clinical signs and pathological abnormalities during pregnancies when there were WFFS homozygous foetuses. Diagnostic material of 15 abortion or stillbirth cases with suspected diagnosis of WFFS was available for this study. Additionally, there were...
TRIM39-RPP21 Variants (∆19InsCCC) Are Not Associated with Juvenile Idiopathic Epilepsy in Egyptian Arabian Horses.
Genes    October 16, 2019   Volume 10, Issue 10 816 doi: 10.3390/genes10100816
Rivas VN, Aleman M, Peterson JA, Dahlgren AR, Hales EN, Finno CJ.Juvenile idiopathic epilepsy (JIE) is an inherited disease characterized by recurrent seizures during the first year of life in Egyptian Arabian horses. Definitive diagnosis requires an electroencephalogram (EEG) performed by a veterinary specialist. A recent study has suggested that a 19 base-pair deletion, along with a triple-C insertion, in intron five of twelve (∆19InsCCC; chr20:29542397-29542425: GTTCAGGGGACCACATGGCTCTCTATAGA>TATCTTAAGACCC) of the () gene is associated with JIE. To confirm this association, a new sample set consisting of nine EEG-phenotyped affected and nine unaffec...
Vaccination of foals with a modified live, equid herpesvirus-1 gM deletion mutant (RacHΔgM) confers partial protection against infection.
Vaccine    October 16, 2019   Volume 38, Issue 2 388-398 doi: 10.1016/j.vaccine.2019.09.106
Kydd JH, Hannant D, Robinson RS, Bryant N, Osterrieder N.Equid herpesvirus-1 (EHV-1) causes respiratory and neurological disease and late gestation abortion in pregnant mares. Current vaccines contain either inactivated or live EHV-1, but fail to provide complete clinical or virological protection, namely prevention of nasopharyngeal shedding and cell-associated viraemia. Thus, the development of novel products, such as modified live virus (MLV) vaccines which stimulate virus-specific, humoral and cell mediated immune responses more effectively remains a priority. Two groups of weaned foals (n = 6 each group) were used in a longitudinal, prospec...
Clonal Confinement of a Highly Mobile Resistance Element Driven by Combination Therapy in Rhodococcus equi.
mBio    October 15, 2019   Volume 10, Issue 5 e02260-19 doi: 10.1128/mBio.02260-19
Álvarez-Narváez S, Giguère S, Anastasi E, Hearn J, Scortti M, Vázquez-Boland JA.Antibiotic use has been linked to changes in the population structure of human pathogens and the clonal expansion of multidrug-resistant (MDR) strains among healthcare- and community-acquired infections. Here we present a compelling example in a veterinary pathogen, , the causative agent of a severe pulmonary infection affecting foals worldwide. We show that the (46) gene responsible for emerging macrolide resistance among equine isolates in the United States is part of a 6.9-kb transposable element, Tn, actively mobilized by an IS family transposase. Tn is carried on an 87-kb conjugative pla...
Fungal Placentitis Caused by Aspergillus terreus in a Mare: Case Report.
Journal of equine veterinary science    October 15, 2019   Volume 83 102799 doi: 10.1016/j.jevs.2019.102799
Orellana-Guerrero D, Renaudin C, Edwards L, Rose E, Aleman M, Moore PF, Dujovne G.Placentitis has been reported as the most important cause of equine abortions, stillbirths, and perinatal deaths in horses. Most cases are caused by bacteria and less commonly by fungal elements. The aim of this report is to describe the clinical presentation of a fungal placentitis caused by Aspergillus terrerus. A 5-year-old thoroughbred maiden mare at the 217th day of gestation presented with some classic signs of placentitis (premature udder development and milk dripping). All ultrasonographic findings were consistent with a live fetus and a severe placentitis. On vaginal examination, pur...
Uterine cervix as a fundamental part of the pathogenesis of pregnancy loss associated with ascending placentitis in mares.
Theriogenology    October 14, 2019   Volume 145 167-175 doi: 10.1016/j.theriogenology.2019.10.017
Fernandes CB, Ball BA, Loux SC, Boakari YL, Scoggin KE, El-Sheikh Ali H, Cogliati B, Esteller-Vico A.Anatomical and molecular changes in the cervical barrier in women are a fundamental part of the pathogenesis of pregnancy loss associated with chorioamnionitis. However, there is little information regarding changes in the cervix associated with ascending infection in pregnant mares. To better characterize morphological and molecular changes in the cervix during placentitis, we examined full thickness histology and mRNA expression for a number of inflammatory and endocrine factors in the mucosa and stroma of the cervix of mares (n = 5) after experimental induction of placentitis via transc...
The First Detection of Equine Coronavirus in Adult Horses and Foals in Ireland.
Viruses    October 14, 2019   Volume 11, Issue 10 946 doi: 10.3390/v11100946
Nemoto M, Schofield W, Cullinane A.The objective of this study was to investigate the presence of equine coronavirus (ECoV) in clinical samples submitted to a diagnostic laboratory in Ireland. A total of 424 clinical samples were examined from equids with enteric disease in 24 Irish counties between 2011 and 2015. A real-time reverse transcription polymerase chain reaction was used to detect ECoV RNA. Nucleocapsid, spike and the region from the p4.7 to p12.7 genes of positive samples were sequenced, and sequence and phylogenetic analyses were conducted. Five samples (1.2%) collected in 2011 and 2013 tested positive for ECoV. Po...
Viruses in Horses with Neurologic and Respiratory Diseases.
Viruses    October 14, 2019   Volume 11, Issue 10 942 doi: 10.3390/v11100942
Altan E, Li Y, Sabino-Santos G, Sawaswong V, Barnum S, Pusterla N, Deng X, Delwart E.Metagenomics was used to identify viral sequences in the plasma and CSF (cerobrospinal fluid) of 13 horses with unexplained neurological signs and in the plasma and respiratory swabs of 14 horses with unexplained respiratory signs. Equine hepacivirus and two copiparvoviruses (horse parvovirus-CSF and a novel parvovirus) were detected in plasma from neurological cases. Plasma from horses with respiratory signs contained the same two copiparvoviruses plus equine pegivirus D and respiratory swabs contained equine herpes virus 2 and 5. Based on genetic distances the novel copiparvovirus qualified ...
Preliminary insight into horse owners’ perceptions of, and attitudes towards, exotic diseases in the United Kingdom.
BMC veterinary research    October 12, 2019   Volume 15, Issue 1 338 doi: 10.1186/s12917-019-2120-5
Spence KL, Cardwell JM, Slater J, Rosanowski SM.The potential for an exotic disease incursion is a significant concern for the United Kingdom (UK) equine industry. Horse owners' perceptions of, and attitudes towards, exotic diseases can influence decisions to adopt disease preparedness strategies. The objectives of this study were to describe horse owners' 1) perceptions of the term 'exotic disease', and 2) attitudes towards their risk of being affected by an exotic disease. In order to address these objectives, qualitative content analysis was undertaken on data collected using two open-ended survey questions. Results: Horse owners (n =...
Co-resistance to Amoxicillin and Tetracycline as an Indicator of Multidrug Resistance in Escherichia coli Isolates From Animals.
Frontiers in microbiology    October 9, 2019   Volume 10 2288 doi: 10.3389/fmicb.2019.02288
Bourély C, Cazeau G, Jarrige N, Jouy E, Haenni M, Lupo A, Madec JY, Leblond A, Gay E.To examine the relevance of co-resistance to amoxicillin and tetracycline as an indicator of multidrug resistance (MDR) in animal health. Methods: isolates collected between 2012 and 2016 by the French surveillance network for antimicrobial resistance in diseased animals (RESAPATH) were analyzed. The proportions of MDR isolates and the proportions of isolates presenting co-resistance to amoxicillin and tetracycline were calculated for seven animal species (cattle, horse, dog, swine, poultry, duck, and turkey). The degree of agreement between these two proportions was estimated by calculating ...
Clinical insights: Antimicrobials in an age of resistance.
Equine veterinary journal    October 5, 2019   Volume 51, Issue 6 711-713 doi: 10.1111/evj.13151
Mercer MA, Davis JL.No abstract available
1 62 63 64 65 66 482