DNA in horses refers to the genetic material that carries the hereditary information necessary for the growth, development, functioning, and reproduction of equine species. It consists of sequences of nucleotides that encode the genetic instructions used in the development and functioning of horses. DNA analysis in horses can provide insights into genetic diversity, lineage, and breed characteristics. It is also utilized in identifying genetic disorders, understanding hereditary traits, and assisting in selective breeding programs. This page compiles peer-reviewed research studies and scholarly articles that explore the structure, function, and applications of DNA analysis in equine genetics and breeding.
Pereira B, Dorado J, Diaz-Jimenez M, Consuegra C, Ortiz I, Gosalvez J, Hidalgo M.The acquisition of equine oocyte developmental capacity is ensured by the follicular environment, such as granulosa cells, which could reflect the meiotic development potential of immature oocytes. This study evaluated the relationship between DNA fragmentation of granulosa cells, using the chromatin dispersion test, and equine oocyte meiotic development after in vitro maturation. Granulosa cells and cumulus-oocytes complexes (n = 50) were recovered from slaughterhouse-derived ovaries. Oocytes were in vitro matured, stained and evaluated under fluorescence microscopy. Maturation rates were c...
Tanaka J, Leeb T, Rushton J, Famula TR, Mack M, Jagannathan V, Flury C, Bachmann I, Eberth J, McDonnell SM, Penedo MCT, Bellone RR.Mushroom is a unique coat color phenotype in Shetland Ponies characterized by the dilution of the chestnut coat color to a sepia tone and is hypothesized to be a recessive trait. A genome wide association study (GWAS), utilizing the Affymetrix 670K array (MNEc670k) and a single locus mixed linear model analysis (EMMAX), identified a locus on ECA7 for further investigation ( = 2.08 × 10). This locus contained a 3 Mb run of homozygosity in the 12 mushroom ponies tested. Analysis of high throughput Illumina sequencing data from one mushroom Shetland pony compared to 87 genomes from horses of var...
Neuhauser S, Bollwein H, Siuda M, Handler J.The aim of the present study was to evaluate the effect of different freezing procedures on sperm motion, viability, the acrosome status, mitochondrial membrane potential (MMP), intracellular calcium content, and DNA integrity on epididymal stallion sperm. Therefore, the sperm of 10 healthy stallions was harvested by retrograde flushing after testectomy, diluted with a semen extender containing defined milk proteins and a freezing extender containing egg yolk and glycerol and frozen according to 4 different protocols, using a programmable freezer and a floating rack performing a slow (processe...
Rivas VN, Aleman M, Peterson JA, Dahlgren AR, Hales EN, Finno CJ.Juvenile idiopathic epilepsy (JIE) is an inherited disease characterized by recurrent seizures during the first year of life in Egyptian Arabian horses. Definitive diagnosis requires an electroencephalogram (EEG) performed by a veterinary specialist. A recent study has suggested that a 19 base-pair deletion, along with a triple-C insertion, in intron five of twelve (∆19InsCCC; chr20:29542397-29542425: GTTCAGGGGACCACATGGCTCTCTATAGA>TATCTTAAGACCC) of the () gene is associated with JIE. To confirm this association, a new sample set consisting of nine EEG-phenotyped affected and nine unaffec...
Bellone RR, Ocampo NR, Hughes SS, Le V, Arthur R, Finno CJ, Penedo MCT.Catastrophic fractures are among the most common cause of fatalities in racehorses. Several factors, including genetics, likely contribute to increased risk for fatal injuries. A variant in the procollagen-lysine, 2-oxoglutarate 5-dioxygenase1 gene (PLOD1 c.2032G>A) was shown to cause Warmblood fragile foal syndrome type 1 (WFFS), a fatal recessive defect of the connective tissue. Screening of multiple horse breeds identified the presence of the WFFS allele in the Thoroughbred. PLOD1 is involved in cross-linking of collagen fibrils and thus could potentially increase the risk of catastrophic b...
Sukmawinata E, Sato W, Mitoma S, Kanda T, Kusano K, Kambayashi Y, Sato T, Ishikawa Y, Goto Y, Uemura R, Sueyoshi M.Extended-spectrum β-lactamase-producing Escherichia coli (ESBLEC) have become a major health concern in both human and veterinary medicine. These bacteria could become a critical problem in equine medicine due to the limited number of antimicrobial drugs available. However, there are no previous reports of ESBLEC isolated from horses in Japan. The objectives of this study were to investigate the occurrence of ESBLEC isolated from feces in healthy Thoroughbred racehorses in Japan. Feces samples were collected from 147 healthy Thoroughbred racehorses by equine veterinarians at the Japan Racing ...
Raudsepp T, Finno CJ, Bellone RR, Petersen JL.The horse reference genome from the Thoroughbred mare Twilight has been available for a decade and, together with advances in genomics technologies, has led to unparalleled developments in equine genomics. At the core of this progress is the continuing improvement of the quality, contiguity and completeness of the reference genome, and its functional annotation. Recent achievements include the release of the next version of the reference genome (EquCab3.0) and generation of a reference sequence for the Y chromosome. Horse satellite-free centromeres provide unique models for mammalian centromer...
Greiser T, Sieme H, Martinsson G, Distl O.Objectives of the present study were to estimate genetic parameters for frozen-thawed semen traits of 271 fertile German Warmblood stallions and genetic correlations with raw semen quality traits. Semen samples were collected from stallions utilized for semen collection and artificial insemination (AI) on the Lower Saxon National Stud Celle and the North Rhine-Westphalian National Stud Warendorf. Semen quality variables were analyzed in 63,972 raw (gel-free volume, concentration, progressive motility, number of sperm) and 3681 frozen-thawed samples (motility, DNA fragmentation index (DFI), non...
Del Prete C, Stout T, Montagnaro S, Pagnini U, Uccello M, Florio P, Ciani F, Tafuri S, Palumbo V, Pasolini MP, Cocchia N, Henning H.During cold storage stallion spermatozoa experience undergo oxidative stress, which can impair sperm function and fertilizing capacity. Superoxide dismutase (SOD), catalase (CAT) and glutathione peroxidase (GPX) are the main endogenous enzymatic antioxidants in stallion seminal plasma, and counteract reactive oxygen species. Semen dilution reduces the endogenous antioxidant concentrations. The aim of this study was to investigate whether addition of 15 IU/mL each of SOD, CAT, and GPX to diluted stallion semen would ameliorate a reactive oxygen-mediated decrease in semen quality during 72 h o...
Pechacek D, Hwangbo M, Moreland R, Liu M, Ramsey J. 4s is a Gram-negative bacterium found in the equine intestinal ecosystem alongside diverse other coliform bacteria and bacteriophages. This announcement describes the complete genome of the T7-like 4s podophage Penshu1. From its 39,263-bp genome, 54 protein-encoding genes and a 179-bp terminal repeat were predicted.
Greiser T, Sieme H, Martinsson G, Distl O.The objectives of the present study were to analyze systematic effects on semen quality traits from fresh and frozen-thawed semen collected in and outside season. A total of 4,681 reports on semen traits of 121 stallions representing Arabian, Thoroughbred, Quarter Horse and four warmblood breeds used for artificial insemination at the Lower Saxon National stud Celle were edited for analysis of gel-free volume, sperm concentration, total number of sperm and total number of motile sperm in fresh semen and in frozen-thawed semen progressive motility, DNA fragmentation index and non-viable sperm. ...
Pereira BC, Ortiz I, Dorado JM, Diaz-Jimenez MA, Consuegra C, Gosalvez J, Hidalgo M.DNA fragmentation of cumulus cells could be used as an indicator of oocyte vitrification success as an indirect indicator of the quality of the oocyte. This study was designed to compare the DNA fragmentation of post-mortem equine cumulus cells before or after vitrification in the absence of permeable cryoprotectant agents. Cumulus-oocyte complexes (COCs; n = 56) were recovered from slaughterhouse ovaries and subjected to in vitro maturation (42 hr/38.2°C/5%CO ) before (control group) or after a permeable cryoprotectant-free vitrification method using 1 M sucrose (vitrification group). Af...
Alpoim-Moreira J, Fernandes C, Rebordão MR, Amaral A, Pinto-Bravo P, Bliebernicht M, Skarzynski DJ, Ferreira-Dias G.Inflammation and fibroproliferative diseases may be modulated by epigenetic changes. Therefore, we suggest that epigenetic mechanisms could be involved in equine endometrosis pathogenesis. DNA methylation is one of the methods to evaluate epigenetics, through the transcription of methyltransferases (DNMT1, DNMT3A, DNMT3B). The correlation between DNMTs and collagen (COL) transcripts was assessed for the different Kenney and Doig's (Current Therapy in Theriogenology. Philadelphia: WB Saunders; 1986) endometrium categories. Endometrial biopsies were randomly collected from cyclic mares. Histolog...
Poirier M, Smith OE, Therrien J, Rigoglio NN, Miglino MA, Silva LA, Meirelles FV, Smith LC.Cell reprogramming by somatic cell nuclear transfer and in induced pluripotent stem cells is associated with epigenetic modifications that are often incompatible with embryonic development and differentiation. For instance, aberrant DNA methylation patterns of the differentially methylated region and biallelic expression of H19-/IGF2-imprinted gene locus have been associated with abnormal growth of fetuses and placenta in several mammalian species. However, cloned horses are born with normal sizes and with no apparent placental anomalies, suggesting that H19/IGF2 imprinting may be epigenetical...
Ripley AM, Penedo MCT, Grahn RA, Martinez de Andino EV, Walbornn SR, Serafini R, Love CC, Hinrichs K.Fetal genotyping has important applications in the horse, but currently necessitates embryo recovery and biopsy. We investigated whether fetal genotyping could be performed on yolk-sac fluid recovered from pregnant mares via transvaginal aspiration. Fluid was collected before Day 30 to provide results before establishment of the endometrial cups (Day 37). Genotyping and assessment of maternal DNA contamination was performed by analyzing histograms of PCR results for 19 loci. In Exp. 1, mares underwent yolk-sac aspiration on Days 22-28 of gestation. Fluid (0.56-1.02 mL) was recovered from fiv...
Dang W, Shang S, Zhang X, Yu Y, Irwin DM, Wang Z, Zhang S.Previous studies investigating donkey parentage and genetic diversity used horse-specific multiplex systems. However, several mis-allele and null-allele issues were found with some of the horse primers when used in donkeys. In 2017, the International Society for Animal Genetics (ISAG) recommended 13 dinucleotide short tandem repeats (STRs) (AHT4, ASB23, HMS2, HMS3, HMS6, HMS7, HMS18, HTG7, HTG10, TKY297, TKY312, TKY337 and TKY343) as a core panel that should be used to identify individuals and to test for parentage in donkeys. To date, no single multiplex STR typing system containing all 13 do...
Lechmann J, Schoster A, Ernstberger M, Fouché N, Fraefel C, Bachofen C.Equid alphaherpesvirus 1 (EHV-1) infections can have a major impact on the horse industry and equine welfare by causing abortion or respiratory or neurologic disease. A single nucleotide polymorphism (A→G) in open reading frame (ORF) 30, encoding the catalytic subunit of the DNA polymerase, has been shown to be a strong predictive marker for neuropathogenicity. Given that a previously established real-time PCR (rtPCR) protocol yielded unsatisfactory results concerning determination of the EHV-1 genotype, we developed and evaluated a new conventional PCR protocol enabling identification of th...
Sild E, Värv S, Kaart T, Kantanen J, Popov R, Viinalass H.The maternal and paternal genetic variation of horse breeds from the Baltic Sea region, including three local Estonian breeds, was assessed and compared with that of Altai and Yakutian horses. In the mtDNA D-loop region, 72 haplotypes assigned to 20 haplogroups in the nine breeds were detected. In Estonian local breeds, 38 mtDNA haplotypes were found, and five of them were shared by the three breeds. More than 60% of all identified haplotypes were rare. Compared with the Estonian Native and Estonian Heavy Draught breeds, a higher haplotypic diversity was found in the Tori breed (h = 0.969). ...
Bueno I, Pearce P, Dunowska M. To estimate the frequency of infection with equine herpesvirus type-1 (EHV-1) among horses from the central North Island of New Zealand, including the frequency of detection of the D genotype. Samples of retropharyngeal lymph nodes (RLN) and submandibular lymph nodes (SLN) were dissected from the heads of 63 horses that were humanely killed for various unrelated reasons between March and November 2015. DNA extracted from these tissues was subjected to enrichment for EHV-1 sequences by hybridisation with biotin-labelled EHV-1 specific probe, followed by recovery of EHV-1 sequences on streptavi...
Denham J, Stevenson K, Denham MM.Telomeres are genetically conserved repetitive terminal DNA that protect against genomic instability and shorten with ageing. Here, we reveal the leukocyte telomere length of Equus caballus by measuring terminal restriction fragments (TRFs) using Southern Blot analysis in a cohort of 43 Thoroughbred horses (age: 24 h-25 years). Heterogeneous TRFs were observed in each animal and large inter-animal variation in mean TRF was observed (range: 10.5-18.7 kbp). Mean TRFs were inversely correlated with age (r = -0.47). The estimated yearly rate of telomere attrition was 134 bp. Horses shoul...
Deshiere A, Berthet N, Lecouturier F, Gaudaire D, Hans A.Equine infectious anemia virus (EIAV) is responsible of acute disease episodes characterized by fever, anemia, thrombocytopenia and anorexia in equids. The high mutation rate in EIAV genome limited the number of full genome sequences availability. In the present study, we used the SureSelect target enrichment system with Illumina Next Generation Sequencing to characterize the proviral DNA of Equine Infectious Anemia Virus (EIAV) from asymptomatic horses. This approach allows a direct sequencing of the EIAV whole genome without cloning or amplification steps and we could obtain for the first ti...
Beeson SK, Mickelson JR, McCue ME.Total genetic map length and local recombination landscapes typically vary within and across populations. As a first step to understanding the recombination landscape in the domestic horse, we calculated population recombination rates and identified likely recombination hotspots using approximately 1.8 million SNP genotypes for 485 horses from 32 distinct breeds. The resulting breed-averaged recombination map spans 2.36 Gb and accounts for 2939.07 cM. Recombination hotspots occur once per 23.8 Mb on average and account for ∼9% of the physical map length. Regions with elevated recombination r...
Valente JDM, Mongruel ACB, Machado CAL, Chiyo L, Leandro AS, Britto AS, Martins TF, Barros-Filho IR, Biondo AW, Perotta JH, Campos ANS, Vidotto O....Tick-borne diseases (TBD) constitute an important group of illness affecting animals and humans worldwide. In Brazil, carthorses are frequently exposed to ticks and tick-borne pathogens, leading to impairment of horse performance and imposing restrictions by the international veterinary authorities for the importation of horses. Accordingly, this study has aimed to i) determine the prevalence of the TBD agents Theileria equi, Babesia caballi, Ehrlichia spp., and hemotropic mycoplasmas in carthorses, ii) identify the tick species parasitizing the animals, and iii) determine factors associated w...
Grant DM, Macedo A, Toms D, Klein C.Preimplantation equine embryos synthesize and secrete fibrinogen, which is a peculiar finding as fibrinogen synthesis almost exclusively occurs in the liver. This study investigated the hypothesis that conceptus-derived fibrinogen mediates cell adhesion during fixation. On day 21 of pregnancy, five integrin subunits, including ITGA5, ITGB1, ITGAV, and ITGB1, displayed significantly higher transcript abundance than on day 16 of pregnancy. Endometrial epithelial cells adhered to fibrinogen in an integrin-dependent manner in an in vitro cell adhesion assay. Bilaminar trophoblast and allantochorio...
Azmi K, Al-Jawabreh A, Abdeen Z.Theileria and Babesia are intracellular protozoan parasites infecting a wide range of animals. In Palestine, there is limited information on the prevalence of Theileria and Babesia spp. in livestock. We used PCR of the 18S ribosomal RNA gene followed by DNA sequencing to detect and identify parasite DNA in blood samples from sheep (n = 49), goats (n = 48), horses (n = 40), camels (n = 34), donkeys (n = 28) and mules (n = 2) from four districts of Palestine. DNA of T. ovis and T. equi was detected in 19 and 2 ovine blood samples, respectively. None of the camels, donkeys...
Li Y, Zhang K, Liu Y, Li K, Hu D, Wronski T.Large and complex intestinal microbiota communities in hosts have profound effects on digestion and metabolism. To better understand the community structure of intestinal microbiota in Przewalski's horse () under different feeding regimes, we compared bacterial diversity and composition between captive and reintroduced Przewalski's horses, using high-throughput 16S-rRNA gene sequencing for identification. Reintroduced Przewalski's horses were sampled in two Chinese nature reserves, i.e., Dunhuang Xihu Nature Reserve (DXNR; = 8) in Gansu Province and Kalamaili Nature Reserve (KNR; = 12) in Xi...
Fawcett JA, Sato F, Sakamoto T, Iwasaki WM, Tozaki T, Innan H.The domestication process of plants and animals typically involves intense inbreeding and directional selection for various traits. Here, we genotyped 370 Japanese Thoroughbred horses using the recently developed 670k SNP array and performed various genome-wide analysis also using genotype data of other horse breeds. We identified a number of regions showing interesting patterns of polymorphisms. For instance, the region containing the MC1R locus associated with chestnut coat color may have been targeted by selection for a different mutation much earlier on than the recent selection for chestn...
The aim of this study was to compare the effect of three sugars and Equex paste in a freezing extender for donkey sperm cryopreservation. Ejaculates (n = 18) were collected from six Andalusian donkeys of proven fertility were pooled (two ejaculates per pool) and cryopreserved using a freezing extender containing three different sugars (glucose, fructose and sorbitol), with or without the addition of Equex paste. Sperm quality was assessed before and after freezing-thawing for motility, morphology, plasma membrane integrity, acrosome integrity and DNA integrity. The use of sorbitol in the f...
MacFadyen AC, Waller AS, Paterson GK.Strain 28462T, which had Gram-stain-positive, catalase-negative coccus-shaped cells, was isolated from a routine tracheal sample from a 3 year old thoroughbred horse. 16S rRNA gene sequence analysis revealed it to be most closely related to, but distinct from, Streptococcus henryi (95.7 % identity), Streptococcusplurextorum (95.8 %), Streptococcusporci (96.4 %) and Streptococcus caprae (95.1 %). Similarity values derived from sequences from sodA and rpoB genes were consistent with strain 28462T belonging to a species distinct from these four streptococci. At the whole genome level, str...
Strüder-Kypke MC, Kornilova OA, Lynn DH.Ciliates of the subclass Trichostomatia inhabit the fermentative regions of the digestive tract of herbivores. Most available small subunit ribosomal RNA (SSrRNA) gene sequences of trichostomes are from species isolated from the rumen of cattle or sheep and from marsupials. No ciliate species endosymbiotic in horses has yet been analyzed. We have sequenced the SSrRNA genes of five ciliate species, isolated from the cecum and colon of four Yakut horses: Cycloposthium edentatum, Cycloposthium ishikawai, Tripalmaria dogieli, Cochliatoxum periachtum, and Paraisotricha colpoidea. Based on their mor...
Alexander AJ, Bailey E, Woodward JG.Fourteen Standardbred horses homozygous for one of six equine lymphocyte antigen (ELA) specificities (A1, A3, A4, A5, A6, or A10) were analyzed by Southern blot hybridization using DNA probes derived from the mouse major histocompatibility complex (MHC). Total genomic DNA from peripheral lymphocytes was digested with the restriction enzymes Hind III, Pvu II, or Eco RI. Twenty-three to thirty-three bands were generated for individual horses with the class I cDNA probe. The resulting band patterns revealed 12-14 nonpolymorphic fragments, which is consistent with the highly conserved Qa/Tla genes...
Christensen H, Bisgaard M, Olsen JE.Members of Bisgaard taxon 11 have been isolated from horses. These bacteria are of importance in the veterinary clinic and also to the medical profession, since they may be isolated from infected wounds of humans bitten by horses. Six strains from different continents were identified as taxon 11, with 16S rRNA similarities between 98.0 and 99.7%. A single isolate that represented the so-called (+)L-arabinose-positive Actinobacillus equuli isolated from a diseased foal showed 99.9% 16S rRNA similarity to the type strain of A. equuli. DNA-DNA hybridizations showed that (+)L-arabinose-positive st...
Vengust M, Wen X, Bienzle D.A 4-year-old donkey was evaluated for progressive neurological abnormalities consisting of depression, stupor, weakness, and recumbency. Diagnostic evaluation for viral involvement identified an asinine herpesvirus in DNA extracted from deep pharyngeal swabs. Specific primers were designed based on comparison with equine herpesviral DNA polymerase sequences and yielded an 875-base pair product from the donkey. This sequence had complete identity with short sequences of asinine herpesvirus previously identified in donkeys with interstitial pneumonia. Amino acid analysis of the entire sequence i...
Hu L, Zhang M, Sun Y, Bu Y.Cylicocyclus spp. are common parasites in the intestine of equine animals. Hosts infected by these strongylid nematodes might face emaciation, anemia, and even death, all of which lead to significant economic losses. In the present study, the complete mitochondrial genome (mitogenome) of Cylicocyclus radiatus, the type species of the genus Cylicocyclus, was sequenced and characterized for the first time using next-generation sequencing technology. Results show that the mitogenome of C. radiatus is a double-stranded 13,836 bp circular molecule, containing 12 protein-coding genes, 22 tRNA genes,...
Onyiche TE, Taioe MO, Ogo NI, Sivakumar T, Biu AA, Mbaya AW, Xuan X, Yokoyama N, Thekisoe O.Babesia caballi and Theileria equi are biological agents responsible for equine piroplasmosis (EP). We conducted a robust and extensive epidemiological study in Nigeria on the prevalence and risk factors of EP. Blood (468, both horses and donkeys) and ticks (201 pools) were screened using polymerase chain reaction (PCR). DNA of equine piroplasms was observed in tick pools with B. caballi amplified in Rhipicephalus evertsi evertsi only [minimum infection rate (MIR) of 7.6%] while T. equi was observed in R. e. evertsi (MIR, 61.6%), Hyalomma dromedarii (MIR, 23.7%) and H. truncatum (MIR, 50.0%). ...
Górniak W, Cholewińska P, Szeligowska N, Wołoszyńska M, Soroko M, Czyż K.Exercise significantly affects the body of both animals and humans, including the composition of the digestive microbiome. This study aimed to determine the changes in the composition of the most numerous bacterial phyla (Firmicutes and Bacteroidetes, as well as the level of the family) in the digestive system of horses under the influence of physical effort. The study included a group of 17 Thoroughbred racehorses at the age of 3 years, fed the same forage, from whom feces samples were collected individually before and 48 h after physical effort. The obtained samples were subjected to DNA is...
Georgescu SE, Manea MA, Dudu A, Costache M.The existence of the Hucul horse on Romanian territory has been documented from the very distant past; today Hucul is a unique breed that is part of the FAO Program for the Preservation of Animal Genetic Resources. We compared Hucul with several primitive European and Asiatic breeds in order to elucidate the origin of these horses. We analyzed a 683-bp mitochondrial DNA (mtDNA) D-loop fragment in a population of Hucul horses and compared the polymorphic sites with sequences from other primitive breeds, including Exmoor, Icelandic Pony, Sorraia, Przewalski Horse, Mongolian Wild Horse, Konik, an...
Wilson AD, Armstrong ELR, Gofton RG, Mason J, De Toit N, Day MJ.Sarcoids are common skin tumours of horses and donkeys that are characterised by persistent proliferation of dermal fibroblasts associated with the presence of bovine papillomavirus (BPV) DNA. Some early BPV proteins have been demonstrated within sarcoids and RNA containing both early and late transcripts is present, yet it remains unclear whether late replication of BPV, culminating in the production of infectious virus particles, can occur in equids. Here we report that BPV1 RNA isolated from equine sarcoids encodes a unique deletion of four residues within the L2 protein suggesting a novel ...
Ji S, Na L, Ren H, Wang Y, Wang X.Human myxovirus resistance protein 2 (huMxB) has been shown to be a determinant type I interferon (IFN)-induced host factor involved in the inhibition of human immunodeficiency virus type 1 (HIV-1) as well as many other primate lentiviruses. This blocking occurs after the reverse transcription of viral RNA and ahead of integration into the host DNA, which is closely connected to the ability of the protein to bind the viral capsid. To date, Mx2s derived from nonprimate animals have shown no capacity for HIV-1 suppression. In this study, we examined the restrictive effect of equine Mx2 (eqMx2) o...
Krajaejun T, Kittichotirat W, Patumcharoenpol P, Rujirawat T, Lohnoo T, Yingyong W.The oomycete Pythium insidiosum infects humans and animals worldwide, and causes the life-threatening condition, called pythosis. Most patients lose infected organs or die from the disease. Comparative genomic analyses of different P. insidiosum strains could provide new insights into its pathobiology, and can lead to discovery of an effective treatment method. Several draft genomes of P. insidiosum are publicly available: three from Asia (Thailand), and one each from North (the United States) and Central (Costa Rica) Americas. We report another draft genome of P. insidiosum isolated from Sout...
Grubaugh ND, Petz LN, Melanson VR, McMenamy SS, Turell MJ, Long LS, Pisarcik SE, Kengluecha A, Jaichapor B, O'Guinn ML, Lee JS.Highly multiplexed assays, such as microarrays, can benefit arbovirus surveillance by allowing researchers to screen for hundreds of targets at once. We evaluated amplification strategies and the practicality of a portable DNA microarray platform to analyze virus-infected mosquitoes. The prototype microarray design used here targeted the non-structural protein 5, ribosomal RNA, and cytochrome b genes for the detection of flaviviruses, mosquitoes, and bloodmeals, respectively. We identified 13 of 14 flaviviruses from virus inoculated mosquitoes and cultured cells. Additionally, we differentiate...
Payne SL, Pei XF, Jia B, Fagerness A, Fuller FJ.The molecular clones pSPeiav19 and p19/wenv17 of equine infectious anemia virus (EIAV) differ in env and long terminal repeats (LTRs) and produce viruses (EIAV(19) and EIAV(17), respectively) of dramatically different virulence phenotypes. These constructs were used to generate a series of chimeric clones to test the individual contributions of LTR, surface (SU), and transmembrane (TM)/Rev regions to the disease potential of the highly virulent EIAV(17). The LTRs of EIAV(19) and EIAV(17) differ by 16 nucleotides in the transcriptional enhancer region. The two viruses differ by 30 amino acids i...
Yasui M, Suzuki N, Liu X, Okamoto Y, Kim SY, Laxmi YR, Shibutani S.4-Hydroxyequilenin (4-OHEN)-dC is a major, potentially mutagenic DNA adduct induced by equine estrogens used for hormone replacement therapy. To study the miscoding property of 4-OHEN-dC and the involvement of Y-family human DNA polymerases (pols) eta, kappa and iota in that process, we incorporated 4-OHEN-dC into oligodeoxynucleotides and used them as templates in primer extension reactions catalyzed by pol eta, kappa and iota. Pol eta inserted dAMP opposite 4-OHEN-dC, accompanied by lesser amounts of dCMP and dTMP incorporation and base deletion. Pol kappa promoted base deletions as well as ...
Senju N, Tozaki T, Kakoi H, Almunia J, Maeda M, Matsuyama R, Takasu M.To help plan conservation of the endangered Miyako horse, a biological resource of the Miyako Islands in Japan, we characterized the genetics of the breed by genotyping 32 microsatellites and identifying mitochondrial DNA haplotypes. We also calculated genetic distances between individuals based on the proportion of shared alleles and visualized the genetic relationships with a phylogenetic tree. Two important results were obtained. One is that accurate pedigree registration of the horse by using microsatellites is possible, as the exclusion power of parentage testing is 0.999998. Another is t...
LaFrentz S, Abarca E, Mohammed HH, Cuming R, Arias CR.The equine conjunctival microbiota has often been reported to be dominated by Gram-positive species such as Staphylococcus sp., Bacillus sp., and Corynebacterium sp. However, traditional culture-based methods can only recover a fraction of the bacterial species present in the sample. Objective: This pilot study aimed at exploring the diversity of the equine conjunctival microbiota using culture-independent methods. Methods: Eight horses were included in this study, and only eyes with normal ophthalmic examination (n = 15 eyes) were sampled. Methods: Conjunctival biopsies (culture-independent...
Stoica G, Tasca SI, Kim HT.Thirty-four peripheral nerve sheath tumors of four domesticated animal species were characterized and assayed for point mutation of the neu oncogene. Based on their morphoimmunophenotype, 32 tumors were classified as schwannomas. Schwannoma morphology was characterized by the presence of Antoni type A and B pattern and immunoreactivity for S-100 protein and vimentin. Two anaplastic and metastatic tumors originating from spinal cord root, immunonegative for S-100 protein and positive for vimentin, were classified as malignant peripheral nerve sheath tumors (MPNSTs). Four malignant schwannomas a...
Muscatello G, Gilkerson JR, Browning GF.Virulent Rhodococcus equi causes pyogranulomatous bronchopneumonia in foals. The route of infection of foals has been considered to be inhalation of aerosolized bacteria from soil that is contaminated with equine feces. Thus, disease caused by R. equi has been regarded as an opportunistic infection of environmental origin and not a contagious disease. In this study, we report the exhalation of virulent R. equi from the respiratory tract of naturally infected foals. A handheld air-monitoring system was used to recover virulent R. equi from the exhaled breath of foals, and the concentration of v...
Akkutay AZ, Osterrieder N, Damiani A, Tischer BK, Borchers K, Alkan F.Equine herpesvirus type 2 (EHV-2) and EHV-5 are members of the subfamily Gammaherpesvirinae. The viruses are detected in horses with upper respiratory tract disease and are associated with low performance in racehorses. The aim of the current study was to use nested PCR to investigate the epidemiology of EHV-2 and EHV-5 in Arabian horse populations from breeding farms located in three different cities (Eskişehir, Malatya, and Bursa) in Turkey, using a real-time quantitative PCR (qPCR) with a TaqMan® minor-groove-binder (MGB) probe to detect EHV-5. Screening of blood and ocular and nasal swab...
de Oliveira PB, Harvey TV, Fehlberg HF, Rocha JM, Martins TF, da Acosta ICL, Labruna MB, Faccini JLH, Albuquerque GR.Tick-borne spotted fever in Brazil is known to be caused by two agents, Rickettsia rickettsii and Rickettsia parkeri. Nothing was known about these agents in one area of the Atlantic rainforest biome of Bahia state, where during March to June 2016, 356 rural dogs and 69 horses were sampled and their sera were processed through indirect immunofluorescence assay against antigens of R. rickettsii, R. parkeri, Rickettsia amblyommatis and Rickettsia bellii. Ticks collected from these dogs and horses were molecularly tested for the presence of rickettsial DNA. Overall, 16.4% (58/356) dogs and 24.6% ...
Bleumink-Pluym NM, Werdler ME, Houwers DJ, Parlevliet JM, Colenbrander B, van der Zeijst BA.A PCR for the detection of Taylorella equigenitalis, the causative agent of contagious equine metritis, was developed and evaluated. A genus-specific primer-probe set was derived from the 16S ribosomal DNA sequences. The PCR was specific and amplified a 585-bp product from all 64 available T. equigenitalis isolates. This PCR product hybridized with a specific probe in a dot spot assay. A variety of microorganisms from the genital tracts of horses or with a close phylogenetic relationship to T. equigenitalis did not yield a visible PCR product and were all negative in the dot spot hybridization...
Berlinguer F, Pasciu V, Succu S, Cossu I, Caggiu S, Addis D, Castagna A, Fontani V, Rinaldi S, Passino ES.REAC technology (acronym for Radio Electric Asymmetric Conveyor) is a technology platform for neuro and bio modulation. It has already proven to optimize the ions fluxes at the molecular level and the molecular mechanisms driving cellular asymmetry and polarization. Methods: This study was designed to verify whether this technology could extend spermatozoa life-span during liquid storage, while preserving their functions, DNA integrity and oxidative status. At 0, 24, 48, and 72 h. of storage at 4 °C, a battery of analyses was performed to assess spermatozoa viability, motility parameters, a...
Schrimpf R, Dierks C, Martinsson G, Sieme H, Distl O.A consistently high level of stallion fertility plays an economically important role in modern horse breeding. We performed a genome-wide association study for estimated breeding values of the paternal component of the pregnancy rate per estrus cycle (EBV-PAT) in Hanoverian stallions. A total of 228 Hanoverian stallions were genotyped using the Equine SNP50 Beadchip. The most significant association was found on horse chromosome 6 for a single nucleotide polymorphism (SNP) within phospholipase C zeta 1 (PLCz1). In the close neighbourhood to PLCz1 is located CAPZA3 (capping protein (actin filam...
Di Pietro R, Arroyo LG, Leclere M, Costa MC.All current studies have used Illumina short-read sequencing to characterize the equine intestinal microbiota. Long-read sequencing can classify bacteria at the species level. The objectives of this study were to characterize the gut microbiota of horses at the species level before and after trimethoprim sulfadiazine (TMS) administration and to compare results with Illumina sequencing. Nine horses received TMS (30 mg/kg) orally for 5 days twice a day to induce dysbiosis. Illumina sequencing of the V4 region or full-length PacBio sequencing of the 16S rRNA gene was performed in fecal samples co...
Ma H, Wang S, Zeng G, Guo J, Guo M, Dong X, Hua G, Liu Y, Wang M, Ling Y, Ding X, Zhao C, Wu C. The Jinjiang horse is a unique Chinese indigenous horse breed distributed in the southern coastal areas, but the ancestry of Jinjiang horses is not well understood. Here, we used Equine SNP70 Bead Array technology to genotype 301 horses representing 10 Chinese indigenous horse breeds, and we integrated the published genotyped data of 352 individuals from 14 foreign horse breeds to study the relationships between Jinjiang horses and horse breeds from around the world. Principal component analysis (PCA), linkage disequilibrium (LD), runs of homozygosity (ROH) analysis, and ancestry estimating m...
Kim SK, Kim S, Dai G, Zhang Y, Ahn BC, O'Callaghan DJ.The equine herpesvirus 1 (EHV-1) negative regulatory IR2 protein (IR2P), an early 1,165-amino acid (aa) truncated form of the 1487-aa immediate-early protein (IEP), lacks the trans-activation domain essential for IEP activation functions but retains domains for binding DNA, TFIIB, and TBP and the nuclear localization signal. IR2P mutants of the N-terminal region which lack either DNA-binding activity or TFIIB-binding activity were unable to down-regulate EHV-1 promoters. In EHV-1-infected cells expressing full-length IR2P, transcription and protein expression of viral regulatory IE, early EICP...
Salem SE, Maddox TW, Antczak P, Ketley JM, Williams NJ, Archer DC.Horses that undergo surgery for treatment of primary large colon disease have been reported to be at increased risk of developing recurrent colic episodes postoperatively. The reasons for this are currently unknown. The aim of the current study was to characterise the faecal microbiota of horses with colic signs associated with primary large colon lesions treated surgically and to compare the composition of their faecal microbiota to that of a control group of horses undergoing emergency orthopaedic treatment. Faecal samples were collected from horses in both groups on admission to hospital, d...
Reiter S, Wallner B, Brem G, Haring E, Hoelzle L, Stefaniuk-Szmukier M, Długosz B, Piórkowska K, Ropka-Molik K, Malvick J, Penedo MCT, Bellone RR.Warmblood fragile foal syndrome (WFFS) is an autosomal recessive disorder caused by a single nucleotide variant in the procollagen-lysine-2-oxoglutarate-5-dioxygenase 1 gene (PLOD1:c.2032G>A, p.Gly678Arg). Homozygosity for the PLOD1 variant causes an Ehler-Danlos-like syndrome, which has to date only been reported in warmblood breeds but the WFFS allele has been also detected in the Thoroughbred. To investigate the breed distribution of the WFFS allele, 4081 horses belonging to 38 different breeds were screened. In total, 4.9% of the horses representing 21 breeds carried the WFFS allele. The a...
Traversa D, Kuzmina T, Kharchenko VA, Iorio R, Klei TR, Otranto D.This study investigated the genetic variability within Cylicocyclus nassatus (Nematoda, Strongylida, Cyathostominae) collected from different domestic and wild hosts (i.e. horse, donkey, Przewalskii horse, tarpan and Turkmen kulan) and localities in Europe and/or USA. The ribosomal Internal Transcribed Spacer 2 (ITS2) and the mitochondrial cytochrome c oxidase subunit 1 (cox1) gene were PCR-amplified and sequences characterized from seventy individual parasitic specimens. While ITS2 displayed 0-0.6% variation rate among all individual adult specimens of C. nassatus examined, 22 different seque...
Wach-Gygax L, Burger D, Malama E, Bollwein H, Fleisch A, Jeannerat E, Thomas S, Schuler G, Janett F.In this study annual fluctuations of DNA fragmentation and quality of cold-stored equine sperm were evaluated. Ejaculates were collected weekly during one year from 15 stallions. Ejaculate volume, sperm concentration and total sperm count were determined and semen was then extended and cold-stored for 48 h. Sperm motility was evaluated by CASA before and after 24 as well as 48 h of cold storage. In addition, the percentages of sperm with intact plasma membrane and acrosome (PMAI %) and with low intracellular Ca2+ level were determined in cold-stored semen (24 h, 48 h). SCSA™ was performe...
