Epidemiology in horses involves the study of the distribution and determinants of health-related states and events in equine populations. It encompasses the investigation of patterns, causes, and effects of diseases and health conditions within horse populations. This field of study aims to identify risk factors for disease and targets for preventive healthcare. Key components of equine epidemiology include disease surveillance, outbreak investigation, and the study of disease dynamics within herds or regions. Research in this area often focuses on infectious diseases, zoonotic diseases, and the impact of environmental factors on equine health. This page compiles peer-reviewed research studies and scholarly articles that explore various aspects of epidemiology in horses, including disease prevalence, transmission pathways, and strategies for disease prevention and control.
Tryland M.In December 1801, the first vaccination against smallpox in Norway took place. Vaccine material came from Denmark, England, Ireland, and other countries; it was also obtained from a few local cowpox cases. What mattered was the effect, not the origin. Several reports indicate that variola virus itself, the cause of smallpox, was also used for human vaccination after passages through cows and horses. A vaccine institute for production of vaccine in calves was established in Kristiania in 1891. Cowpox was once a rare disease in cattle, but a total of 70,985 bovine cases were reported between 188...
Yildirim AO, Lämmler Ch, Weiss R.Seven group B streptococcal cultures isolated from three horses reacted with group B-specific antiserum, were CAMP positive, pigmented and showed the typical biochemical properties of Streptococcus agalactiae. The identification could be confirmed by PCR amplification of the 16S rRNA gene and a subsequent RsaI restriction pattern typical for S. agalactiae. In addition, the isolates were identified by amplification of species specific parts of the 16S rRNA gene, the 16S-23S rRNA intergenic spacer region and by amplification of the CAMP-factor (cfb) gene. Six isolates could be classified as sero...
Jeannotte ME, Slavić D, Frey J, Kuhnert P, MacInnes JI.Twenty-four Actinobacillus suis isolates obtained from several species of non-porcine mammals were compared to the representative porcine strains, ATCC 15557 (serotype O1) and H89-1173 (serotype O2), by O serotyping, DNA fingerprinting, PCR amplification of apxICA, apxIICA and apxIIICA toxin genes and by rrs (16S rRNA) gene sequencing. Only two strains, both equine, reacted with O1 antiserum while two others, one canine and the other feline, reacted with O2 antiserum. One equine strain reacted weakly with both antisera. No amplification of apx genes was found with the non-porcine O1 or the "no...
Ito M, Itou T, Sakai T, Santos MF, Arai YT, Takasaki T, Kurane I, Ito FH.Brain samples from different animal species including humans: five vampire bats, 14 cattle, 12 dogs, 11 cats, two horses, one pig, one sheep and three humans collected from various geographical regions of Brazil were found to be positive for rabies by means of the fluorescent antibody test (FAT) and the mouse inoculation test (MIT). The brain samples were retested for rabies by means of the reverse transcription and polymerase chain reaction (RT-PCR) with 2 primer sets (P1/P2 and RHNI/RHNS3), which amplified full or partial regions on the nucleoprotein (N) gene of the rabies virus, respectivel...
Smith RD.In this article, I have discussed the principles and methods of outbreak investigation, reinforcing important concepts with examples from the veterinary literature. The approach presented is applicable to outbreaks caused by any agent whether it is infectious versus noninfectious or contagious versus noncontagious. The solutions vary. The experience of others presented with similar situations may be especially helpful. Because of their nature, outbreaks are difficult to prepare for. When faced with a potential outbreak, the best strategy is to approach it scientifically, systematically, and wi...
Spoo W.Poisoning resulting from exposure to a wide variety of industrial chemicals is not a common occurrence in horses, but it does happen on occasion. A wide range of toxicosis can occur from a wide range of industrial pollutants, such as dioxin, carbon tetrachloride, and tetrachloroethylene, to heavy metals, such as cadmium and zinc. The equine practitioner must consider industrial chemical toxicosis in differential diagnoses and work with a reputable veterinary diagnostic laboratory to confirm or rule out industrial chemical poisoning.
The Journal of parasitologyJanuary 10, 2002
Volume 87, Issue 6 1371-1378 doi: 10.1645/0022-3395(2001)087[1371:STOGPO]2.0.CO;2
Chapman MR, French DD, Klei TR.Parasite-naive pony foals were used as sentinels to monitor transmission of gastrointestinal parasites of equids in Louisiana during 4 seasons of the year. Two annual periods were studied, 1988-1989 and 1992-1993. Two or 3 foals each season were turned out to graze a contaminated pasture along with resident parasitized mares and their foals. After a grazing period of 8 wk, sentinel ponies were held in a parasite-free box stall for a period of 6 wk to allow parasites to develop, thus enhancing the evaluation of hypobiotic stages. Following this holding period, necropsies were performed for comp...
Galey FD.Botulism should be considered in cases where weakness, paralysis, or intolerance to exercise might be seen in the horse. Dysphagia may also be present, although it is not a consistent finding. Potential sources include carrion in hay, moldy or otherwise rotted vegetation or forage, birds carrying material from animal burial or other similar sites, and contaminated carcasses on-site. Horses, especially foals, may also suffer from toxicoinfectious botulism, a condition where the C. botulinum might colonize and produce toxin within the gastrointestinal tract. Wounds also may harbor the organism a...
Rickard LG, Black SS, Rashmir-Raven A, Hurst G, Dubey JP.Sarcocystis neurona is the most important cause of equine protozoal myeloencephalitis (EPM) in horse in the Americas. The only known definitive host for this parasite in the United States is the opossum (Didelphis virginiana); however, despite the importance of the disease, the epidemiology of the parasite in the definitive host is poorly understood. To begin addressing these data gaps, potential risk factors were evaluated for their association with the presence of sporocysts of S. neurona in opossums live-trapped in March 1999 and November 1999 to May 2000. Sporocysts of S. neurona were foun...
Folsom RW, Littlefield-Chabaud MA, French DD, Pourciau SS, Mistric L, Horohov DW.Equine influenza virus remains a major health concern for the equine industry in spite of ongoing vaccination programmes. Previous work has shown that the immune system of horses can be affected by strenuous exercise. The possible adverse consequence of exercise-induced alterations in lymphocyte responses measured in vitro was unknown. Here we demonstrate that subjecting vaccinated ponies to a 5 day strenuous exercise programme results in a significant suppression of their T cell-mediated immune response to equine influenza virus as measured by decreased lymphoproliferation and gamma interfero...
Hendricks KJ, Adekoya N.To provide data on the magnitude and patterns of animal related on-farm injuries to youth in the United States. Methods: A survey of 26,000 farm households conducted for the National Institute for Occupational Safety and Health by the United States Department of Agriculture in 1998. Methods: Youth younger than 20 years of age. Results: There were an estimated 6,438 animal related on-farm injuries to youth in 1998. 70% occurred to farm residents; 69% were work related. Males accounted for 64% and approximately 41% occurred to those younger than 10; 37% involved horses and 31% cattle. Most horse...
Krebs JW, Mondul AM, Rupprecht CE, Childs JE.During 2000, 49 states, the District of Columbia, and Puerto Rico reported 7,364 cases of rabies in nonhuman animals and 5 cases in human beings to the Centers for Disease Control and Prevention, an increase of 4.3% from 7,067 cases in nonhuman animals reported in 1999. Ninety-three percent (6,855 cases) were in wild animals, whereas 6.9% (509 cases) were in domestic species (compared wth 91.5% in wild animals and 8.5% in domestic species in 1999). Compared with cases reported in 1999, the number of cases reported in 2000 increased among bats, dogs, foxes, skunks, and sheep/goats and decreased...
Eder C, Curik I, Brem G, Crameri R, Bodo I, Habe F, Lazary S, Sölkner J, Marti E.To investigate whether allergen-specific IgE production is influenced by environmental and genetic factors, IgE levels against 2 mould extracts (Alternaria alternata [Alt a] and Aspergillus fumigatus [Asp f]) and against recombinant (r) rAlt a 1, rAsp f 7 and rAsp f 8 were determined by ELISA in sera from 448 Lipizzan horses living in 6 studfarms. Statistical evaluation showed a significant effect of studfarm-specific environment on IgE levels against the different allergens, but genetic factors also influenced allergen-specific IgE production: an heritability of 0.33 was found for IgE levels ...
Sequeira JL, Tostes RA, Oliveira-Sequeira TC.The objective of the present study was to investigate the prevalence of Gasterophilus nasalis larvae in Botucatu, the central west region of São Paulo State, Brazil, and to describe the lesions caused by the parasite. The climate of Botucatu is warm and rainy during the months of December through March and cool and dry during the months of May through August. The prevalence of G. nasalis was 16.84%, and the period of peak infestation corresponded to the months of cold and dry weather. The lesions detected at the sites of larval attachment were examined macro- and microscopically. Erosions and...
Townsend HG, Penner SJ, Watts TC, Cook A, Bogdan J, Haines DM, Griffin S, Chambers T, Holland RE, Whitaker-Dowling P, Youngner JS, Sebring RW.A randomised, controlled, double-blind, influenza virus, aerosol challenge of horses was undertaken to determine the efficacy of a cold-adapted, temperature sensitive, modified-live virus, intranasal, equine influenza vaccine. Ninety 11-month-old influenza-naïve foals were assigned randomly to 3 groups (20 vaccinates and 10 controls per group) and challenged 5 weeks, 6 and 12 months after a single vaccination. Challenges were performed on Day 0 in a plastic-lined chamber. Between Days 1 and 10, animals were examined daily for evidence of clinical signs of influenza. Nasal swabs for virus isol...
Chambers TM, Holland RE, Tudor LR, Townsend HG, Cook A, Bogdan J, Lunn DP, Hussey S, Whitaker-Dowling P, Youngner JS, Sebring RW, Penner SJ....Flu Avert IN vaccine is a new, live attenuated virus vaccine for equine influenza. We tested this vaccine in vivo to ascertain 1) its safety and stability when subjected to serial horse to horse passage, 2) whether it spread spontaneously from horse to horse and 3) its ability to protect against heterologous equine influenza challenge viruses of epidemiological relevance. For the stability study, the vaccine was administered to 5 ponies. Nasal swabs were collected and pooled fluids administered directly to 4 successive groups of naïve ponies by intranasal inoculation. Viruses isolated from th...
Charleston W, McKenna P.Abstract A general review of the epidemiology, significance and control of nematode parasitism of sheep, goats, cattle and deer in New Zealand, the emergence of anthelmintic resistance and its effects, and the search for parasite control strategies that reduce reliance on anthelmintic use, is provided. The research that has formed the basis for present levels of understanding of this complex and important topic is summarised and sources of further information are indicated. Aspects of nematode infections of horses, pigs, dogs and cats, and the history of the liver fluke, Fasciola hepatica, in ...
Hagiwara K, Okamoto M, Kamitani W, Takamura S, Taniyama H, Tsunoda N, Tanaka H, Iwai H, Ikuta K.To investigate the prevalence of diseases in the Borna disease virus (BDV) antibody positive race horses, we undertook seroepidemiological studies of BDV infection on 125 culled race horses in Hokkaido, Japan. The serological study disclosed the presence of antibodies only to BDV-p40 or -p24 in 19.2% (24/125) and 3.2% (4/125) of culled horses, respectively. Antibodies to both BDV-p40 and -p24 were found in 24.0% (30/125) of these horses. Of particular note was the finding that locomotorium disorders were detectable at a significantly higher rate in BDV antibody positive horses than that in the...
Champion ZJ, Breier BH, Ewen WE, Tobin TT, Casey PJ.A survey of standardbred horses was conducted to build up a normal population profile for insulin like growth factor-I (IGF-I) concentrations in racing standardbreds and to ascertain how age, sex and geographic location affect IGF-I. Blood samples were drawn by jugular venepuncture from 202 racing standardbred horses aged one to eight years located in five different geographic regions of New Zealand. IGF-I concentrations were determined by insulin like growth factor-I binding protein (IGFBP)-blocked radioimmunoassay validated for the horse. As described in other species, age played a significa...
Duncan JL, Abbott EM, Arundel JH, Eysker M, Klei TR, Krecek RC, Lyons ET, Reinemeyer C, Slocombe JO.These guidelines have been designed to assist in the planning, operation and interpretation of studies which would serve to assess the efficacy of drugs against internal parasites of horses. Although the term anthelmintic is used in the title and text, these guidelines include studies on drug efficacy against larvae of horse bot flies, Gasterophilus spp., which are non-helminth parasites commonly occurring in the stomach of horses. The advantages, disadvantages and application of critical and controlled tests are presented. Information is also provided on selection of animals, housing, feed, d...
Hudson JM, Cohen ND, Gibbs PG, Thompson JA.To determine whether specific feeding practices were associated with development of colic in horses. Methods: Prospective matched case-control study. Methods: 364 horses examined by veterinarians in private practice in Texas because of colic (cases; n = 182) or any other reason (controls; 182). Methods: Participating veterinarians were sent forms at the beginning of the study to collect information on signalment, feeding management practices, farm management practices, and preventive medical treatments. Case and control horses were compared by use of conditional logistic regression to identify...
Takai S, Chaffin MK, Cohen ND, Hara M, Nakamura M, Kakuda T, Sasaki Y, Tsubaki S, Martens RJ.Rhodococcus equi isolates (462) obtained from 64 soil samples collected on 5 R. equi-endemic horse-breeding farms and isolates from 100 infected foals in Texas were examined to determine the prevalence and genotypic diversity of virulence-associated plasmids. Isolates were tested for the presence of 15-17-kDa virulence-associated protein antigens (VapA) by immunoblotting and virulence-associated plasmids by PCR. Plasmid DNAs were isolated and analyzed by digestion with restriction endonucleases for estimation of size and comparison of polymorphisims. Rhodococcus equi were isolated from soil of...
Tsunemitsu H, Imagawa H, Togo M, Shouji T, Kawashima K, Horino R, Imai K, Nishimori T, Takagi M, Higuchi T.A total of 65 equine group A rotaviruses (GAR) isolated from diarrheal foals at 48 farms in Hokkaido, Japan, between 1996 (29 isolates) and 1997 (36 isolates) were characterized for their VP7 and VP4 serotypes by PCR, nucleotide sequencing, and virus neutralization (VN) tests. By PCR VP7 typing, all isolates were classified as G3 or G 14, and the predominant serotype in each year was G3 (86%) in 1996 and G14 (53%) in 1997. VN tests with these 20 isolates randomly selected confirmed the specificity of PCR on the bases of complete agreement of the results in these methods (9 G3 and 11 G14), and ...
Becker K, Keller B, von Eiff C, Brück M, Lubritz G, Etienne J, Peters G.Staphylococcal food poisoning (SFP) caused by enterotoxigenic staphylococci is one of the main food-borne diseases. In contrast to Staphylococcus aureus, a systematic screening for the enterotoxins has not yet been performed on the genomic level for the coagulase-positive species S. intermedius. Therefore, the enterotoxigenic potential of 281 different veterinary (canine, n = 247; equine, n = 23; feline, n = 9; other, n = 2) and 11 human isolates of S. intermedius was tested by using a multiplex PCR DNA-enzyme immunoassay system targeting the staphylococcal enterotoxin genes sea, seb, sec, sed...
Baird DH, Pilsworth RC.Anecdotal evidence suggested that many cases of third tarsal bone (T3) fracture encountered clinically were associated with an abnormal shape to this bone. The radiographs of 10 normal horses and 10 horses affected with slab fracture of T3 were therefore examined to ascertain if any pre-existent radiological abnormality was present in cases of fracture. Measurement of the maximum and minimum width between the proximal and distal articular surfaces of the dorsolateral aspect of this bone was carried out on a standardised dorso-50 degrees medial-palmarolateral radiographic projection of the tars...
Hunter LC, Poxton IR.The aetiology of equine grass sickness (EGS) is still unknown. There is increasing evidence that toxicoinfection with Clostridium botulinum type C is involved. Epidemiological evidence shows that resistance to EGS can occur in older horses and those that have been on a particular pasture for longer or have been in prior contact with the disease. This resistance may be in the form of an immune response to the aetiological agent. Levels of systemic antibodies to the surface antigens of C. botulinum type C (using the closely related and safe C. novyi type A as a phenotypic marker) and to the botu...
Mackenzie RM, de Siger J, Parra D.Two strains of Venezuelan equine encephalitis (VEE) virus were examined for the ability to replicate in, as well as to produce death among donkeys. One, a low passage strain known as strain P676 was originally isolated from mosquitos in Venezuela. The other, strain V-38 was isolated from a horse brain in 1938 and had undergone an unknown number of laboratory passages; it is used extensively for the preparation of inactivated VEE vaccine. Both strains were found to be approximately equal in their ability to infect donkeys. However, a quantity as small as 50% hamster intraperitoneal infectious u...
Gawor JJ.Autopsies and analyses of faecal samples from working horses have shown common occurrence of ascarids in foals, whereas 19.6% of adult horses have been found infected. No influence of season on EPG in adult horses has been found. Study based on faecal samples from stud horses has shown that 5-6-month old animals were most susceptible to the infection. 50% of foals have been found infected in spite of deworming with the use of bezimidazole compounds. It has been stated that the proper dose of an anthelminthic is a basic problem in the control of ascarids.
Bauerfeind R, Wieler LH, Weiss R, Baljer G.From April 1990 through June 1991 clinical salmonellosis and asymptomatic faecal excretion of Salmonella spp. were seen in hospitalized horses at two veterinary hospitals. 76 Salmonella strains from hospitalized horses and 18 strains from horses without any clinical contact were characterized by serotyping and plasmid profile analysis. From April 1990 through January 1991 97.8% of the hospitalized horses were infected with strains of S. typhimurium var. Copenhagen, which were closely related according to their similar plasmid patterns. Other strains of S. typhimurium var. Copenhagen and seroty...
Feder HM, Nelson RS, Cartter ML, Sadre I.A survey was performed to identify people who were exposed to a rabid pony and determine whether or not they received rabies postexposure prophylaxis (PEP). Sixty-one visitors who came in contact with the rabid pony were identified. These visitors heard about the rabid pony via the news media. Forty-five visitors were exposed during the 2 weeks before the pony died. Thirty-two of these 45 visitors received PEP. Thirty-one visitors had or may have had saliva contact to an open wound or mucosa and all 31 received PEP. Fourteen visitors had no saliva contact to a wound or mucosa and one received ...
Cavalcante AL, Dias LM, Alves JT, Veras AA, Guimarães LC, Rocha FS, Gala-García A, Retamal P, Ramos RT, Azevedo V, Silva A, Carneiro AR.Corynebacterium pseudotuberculosis is related to several diseases infecting horses and small ruminants, causing economic losses to agribusiness. Here, we present the genome sequence of C. pseudotuberculosis strain E19. The genome includes one circular chromosome 2,367,956 bp (52.1% G+C content), with 2,112 genes predicted, 12 rRNAs, and 48 tRNAs.
Wilson G, Cooper K, Williams J, Eastwood S, Peake C.The 2007 equine influenza (EI) outbreak in New South Wales (NSW) consisted of a central infected area that extended south from the lower New England Tableland, across the Hunter Valley, Central Coast and the Sydney basin, and a series of isolated clusters outside this area across rural NSW. The central area was assigned the status of a Purple Zone (Special Restricted Area, SRA) approximately 1 month after the outbreak commenced. Within this SRA, the eradication program's focus was to increase the proportion of horses immune to EI via vaccination, thus reducing the susceptible proportion to a l...
Spyrou V, Papanastassopoulou M, Koumbati M, Nikolakaki SV, Koptopoulos G.Molecular analysis of the regulatory and structurally important genetic segments of equine infectious anemia virus (EIAV) in mules is presented. We have previously reported clinicopathological and laboratory findings in mules infected with EIAV, both naturally and after experimental inoculation. In this study the fragment coding for integrase, gp90, tat and the fusion domain of gp45 of the proviral genome from these animals was sequenced and compared with one another and with that of EIAV strains already published in the literature. Significant variations were observed mainly in the sequences ...
Tanaka K, Asai Y, Kuwano A.At 114 ranches in the Hidaka District of Hokkaido, a total of 1,118 Thoroughbred foals that were born from January to June 2003 were examined at different times from May to September of the same year to ascertain the occurrence of clubfoot. Clubfoot was seen in a total of 179 foals (16%) at 89 ranches (78%). Also, 124 of the 179 foals (69.3%) had clubfoot of grade II or higher, and it was found that grade I was likely to be overlooked or rapidly advance. In the present study, the occurrence of clubfoot was higher than expected in the investigated region. Hence, it is necessary to establish acc...
Rivas VN, Aleman M, Peterson JA, Dahlgren AR, Hales EN, Finno CJ.Juvenile idiopathic epilepsy (JIE) is an inherited disease characterized by recurrent seizures during the first year of life in Egyptian Arabian horses. Definitive diagnosis requires an electroencephalogram (EEG) performed by a veterinary specialist. A recent study has suggested that a 19 base-pair deletion, along with a triple-C insertion, in intron five of twelve (∆19InsCCC; chr20:29542397-29542425: GTTCAGGGGACCACATGGCTCTCTATAGA>TATCTTAAGACCC) of the () gene is associated with JIE. To confirm this association, a new sample set consisting of nine EEG-phenotyped affected and nine unaffec...
Enders F, Weber A.Fecal samples of 146 horses were culturally investigated for occurrence of Prototheca spp. using a selective medium, developed by PORE (1973). Prototheca zopfii could be isolated in monoculture from 9 fecal samples (6.2%). The results of this pilot study show that horses too can harbour and shed Prototheca spp. in variable frequency.
Gorucu S, Murphy DJ, Kassab C.The purpose of this study was to investigate characteristics associated with farm equipment and horse and buggy roadway crashes in relation to person, incident, and injury characteristics to identify appropriate points for injury incident prevention. Information on crashes occurring on public roads during the years 2010-2013 was obtained from the Pennsylvania Department of Transportation (PennDOT) and analyzed. There were 344 farm equipment and 246 horse and buggy crashes during the 4-year study period. These crashes involved 666 and 504 vehicles and 780 and 838 people, respectively. In incide...
da Piedade I, Skive B, Christensen H, Bojesen AM.We present the draft genome sequence of Streptococcus equi subsp. zooepidemicus S31A1, a strain isolated from equine infectious endometritis in Denmark. Comparative analyses of this genome were done with four published reference genomes: S. zooepidemicus strains MGCS10565, ATCC 35246, and H70 and S. equi subsp. equi strain 4047.
Hayashi S, Tanaka T, Moriishi K, Hirayama K, Yamada A, Hotta K.Non-primate hepacivirus (NPHV) is recently identified as a closely related homologue of hepatitis C virus. The previous studies showed a high prevalence of NPHV infection among Japanese domestic horses originated from abroad. The historical distribution of NPHV among horses in Japan, therefore, is still unknown. In this study, seroepidemiological study of NPHV was conducted using 335 sera from five breeds of Japanese native horses. These horses are maintained as the pedigree and are reared apart from other horse breeds. The detection of antibodies against NPHV were conducted by western blot an...
Nicoletti PL, Mahler JR, Scarratt WK.Horses at a veterinary teaching hospital and a slaughterhouse were surveyed for antibodies to Brucella abortus, B canis and Actinobacillus equuli. Four of the 141 hospitalised horses and none of the 73 slaughtered horses had titres of 1:100 or greater to B abortus. Six horses of both populations reacted to the card test. One was culture positive. A card test using B canis antigen was positive in 38 per cent of the sera from hospitalised horses and all of the slaughtered horses. Twenty (27.4 per cent) of the latter group had high tires in a tube agglutination test. High titres could not be redu...
Teixeira WF, Felippelli G, Cruz BC, Maciel WG, Fávero FC, Gomes LV, Buzzulini C, Prando L, Bichuette MA, Lopes WD, Oliveira GP, Costa AJ.With the aim of studying the endoparasite fauna of horses from the Formiga city, located in center-west region of the state of Minas Gerais, 25 animals that were naturally infected with helminths were evaluated. By means of parasitological necropsies, different endoparasites were found. The subfamily Cyathostominae presented the highest incidence, followed by Trichostrongylus axei, Oxyuris equi, Triodontophorus serratus, Strongyloides westeri, Strongylus edentatus, Habronema muscae, Parascaris equorum, Probstmayria vivipara, Strongylus vulgaris, Gasterophilus nasalis, Anoplocephala magna and A...