Epidemiology in horses involves the study of the distribution and determinants of health-related states and events in equine populations. It encompasses the investigation of patterns, causes, and effects of diseases and health conditions within horse populations. This field of study aims to identify risk factors for disease and targets for preventive healthcare. Key components of equine epidemiology include disease surveillance, outbreak investigation, and the study of disease dynamics within herds or regions. Research in this area often focuses on infectious diseases, zoonotic diseases, and the impact of environmental factors on equine health. This page compiles peer-reviewed research studies and scholarly articles that explore various aspects of epidemiology in horses, including disease prevalence, transmission pathways, and strategies for disease prevention and control.
Charleston W, McKenna P.Abstract A general review of the epidemiology, significance and control of nematode parasitism of sheep, goats, cattle and deer in New Zealand, the emergence of anthelmintic resistance and its effects, and the search for parasite control strategies that reduce reliance on anthelmintic use, is provided. The research that has formed the basis for present levels of understanding of this complex and important topic is summarised and sources of further information are indicated. Aspects of nematode infections of horses, pigs, dogs and cats, and the history of the liver fluke, Fasciola hepatica, in ...
Hagiwara K, Okamoto M, Kamitani W, Takamura S, Taniyama H, Tsunoda N, Tanaka H, Iwai H, Ikuta K.To investigate the prevalence of diseases in the Borna disease virus (BDV) antibody positive race horses, we undertook seroepidemiological studies of BDV infection on 125 culled race horses in Hokkaido, Japan. The serological study disclosed the presence of antibodies only to BDV-p40 or -p24 in 19.2% (24/125) and 3.2% (4/125) of culled horses, respectively. Antibodies to both BDV-p40 and -p24 were found in 24.0% (30/125) of these horses. Of particular note was the finding that locomotorium disorders were detectable at a significantly higher rate in BDV antibody positive horses than that in the...
Champion ZJ, Breier BH, Ewen WE, Tobin TT, Casey PJ.A survey of standardbred horses was conducted to build up a normal population profile for insulin like growth factor-I (IGF-I) concentrations in racing standardbreds and to ascertain how age, sex and geographic location affect IGF-I. Blood samples were drawn by jugular venepuncture from 202 racing standardbred horses aged one to eight years located in five different geographic regions of New Zealand. IGF-I concentrations were determined by insulin like growth factor-I binding protein (IGFBP)-blocked radioimmunoassay validated for the horse. As described in other species, age played a significa...
Duncan JL, Abbott EM, Arundel JH, Eysker M, Klei TR, Krecek RC, Lyons ET, Reinemeyer C, Slocombe JO.These guidelines have been designed to assist in the planning, operation and interpretation of studies which would serve to assess the efficacy of drugs against internal parasites of horses. Although the term anthelmintic is used in the title and text, these guidelines include studies on drug efficacy against larvae of horse bot flies, Gasterophilus spp., which are non-helminth parasites commonly occurring in the stomach of horses. The advantages, disadvantages and application of critical and controlled tests are presented. Information is also provided on selection of animals, housing, feed, d...
Hudson JM, Cohen ND, Gibbs PG, Thompson JA.To determine whether specific feeding practices were associated with development of colic in horses. Methods: Prospective matched case-control study. Methods: 364 horses examined by veterinarians in private practice in Texas because of colic (cases; n = 182) or any other reason (controls; 182). Methods: Participating veterinarians were sent forms at the beginning of the study to collect information on signalment, feeding management practices, farm management practices, and preventive medical treatments. Case and control horses were compared by use of conditional logistic regression to identify...
Takai S, Chaffin MK, Cohen ND, Hara M, Nakamura M, Kakuda T, Sasaki Y, Tsubaki S, Martens RJ.Rhodococcus equi isolates (462) obtained from 64 soil samples collected on 5 R. equi-endemic horse-breeding farms and isolates from 100 infected foals in Texas were examined to determine the prevalence and genotypic diversity of virulence-associated plasmids. Isolates were tested for the presence of 15-17-kDa virulence-associated protein antigens (VapA) by immunoblotting and virulence-associated plasmids by PCR. Plasmid DNAs were isolated and analyzed by digestion with restriction endonucleases for estimation of size and comparison of polymorphisims. Rhodococcus equi were isolated from soil of...
Tsunemitsu H, Imagawa H, Togo M, Shouji T, Kawashima K, Horino R, Imai K, Nishimori T, Takagi M, Higuchi T.A total of 65 equine group A rotaviruses (GAR) isolated from diarrheal foals at 48 farms in Hokkaido, Japan, between 1996 (29 isolates) and 1997 (36 isolates) were characterized for their VP7 and VP4 serotypes by PCR, nucleotide sequencing, and virus neutralization (VN) tests. By PCR VP7 typing, all isolates were classified as G3 or G 14, and the predominant serotype in each year was G3 (86%) in 1996 and G14 (53%) in 1997. VN tests with these 20 isolates randomly selected confirmed the specificity of PCR on the bases of complete agreement of the results in these methods (9 G3 and 11 G14), and ...
Becker K, Keller B, von Eiff C, Brück M, Lubritz G, Etienne J, Peters G.Staphylococcal food poisoning (SFP) caused by enterotoxigenic staphylococci is one of the main food-borne diseases. In contrast to Staphylococcus aureus, a systematic screening for the enterotoxins has not yet been performed on the genomic level for the coagulase-positive species S. intermedius. Therefore, the enterotoxigenic potential of 281 different veterinary (canine, n = 247; equine, n = 23; feline, n = 9; other, n = 2) and 11 human isolates of S. intermedius was tested by using a multiplex PCR DNA-enzyme immunoassay system targeting the staphylococcal enterotoxin genes sea, seb, sec, sed...
Baird DH, Pilsworth RC.Anecdotal evidence suggested that many cases of third tarsal bone (T3) fracture encountered clinically were associated with an abnormal shape to this bone. The radiographs of 10 normal horses and 10 horses affected with slab fracture of T3 were therefore examined to ascertain if any pre-existent radiological abnormality was present in cases of fracture. Measurement of the maximum and minimum width between the proximal and distal articular surfaces of the dorsolateral aspect of this bone was carried out on a standardised dorso-50 degrees medial-palmarolateral radiographic projection of the tars...
Hunter LC, Poxton IR.The aetiology of equine grass sickness (EGS) is still unknown. There is increasing evidence that toxicoinfection with Clostridium botulinum type C is involved. Epidemiological evidence shows that resistance to EGS can occur in older horses and those that have been on a particular pasture for longer or have been in prior contact with the disease. This resistance may be in the form of an immune response to the aetiological agent. Levels of systemic antibodies to the surface antigens of C. botulinum type C (using the closely related and safe C. novyi type A as a phenotypic marker) and to the botu...
Roman C, Massai L, Gianni C, Crosti C.Dermatophyte infections due to Trichopkyton verrucosum are not frequent in Europe. Six cases observed in Italy in the period 1995-99 are reported. Two were cases of tinea barbae, two of tinea corporis and two of tinea capitis, one of which had been preceded by tinea faciei. In three cases the source of contagion was horses, in two it was cattle and in one case it was another person. The two cases of tinea barbae were initially interpreted and treated as bacterial infections, a diagnostic error reported with increasing frequency in the literature regarding dermatophytosis due to T. verrucosum.
Savill MG, Murray SR, Scholes P, Maas EW, McCormick RE, Moore EB, Gilpin BJ.Rhodococcus coprophilus, a natural inhabitant of herbivore faeces, has been suggested as a good indicator of animal (as opposed to human) faecal contamination of aquatic environments. However, conventional detection methods limit its use for this as they require up to 21 days to obtain a result. In this paper an optimised method for extracting R. coprophilus DNA from faecal samples is described. PCR and 5'-nuclease (TaqMan) PCR methods were developed to allow the detection and enumeration of R. coprophilus in faecal samples within 2-3 days. Both PCR methods targeted the 16S rRNA gene, producin...
Dynon K, Varrasso A, Ficorilli N, Holloway S, Reubel G, Li F, Hartley C, Studdert M, Drummer H.To develop rapid (< 8 hour) tests using polymerase chain reaction (PCR) for the diagnosis of equine herpesvirus 3 (EHV3; equine coital exanthema virus), equine gammaherpesviruses 2 (EHV2) and EHV5, equine adenovirus 1 (EAdV1), EAdV2, equine arteritis virus (EAV), equine rhinitis A virus (ERAV; formerly equine rhinovirus 1) Methods: Either single round or second round (seminested) PCRs were developed and validated. Methods: Oligonucleotide primers were designed that were specific for each virus, PCR conditions were defined and the specificity and sensitivity of the assays were determined. The a...
Farkas R, Képes G.A survey was carried out in three stud farms with grazing animals, in order to gather data on the prevalence and clinical manifestation of, and the fly species involved in, traumatic myiasis of horses in Hungary. This parasitic disease was recorded in each farm. On the whole, 9.0% (14) of the inspected horses were infested with fly larvae. The affected horses had one infested lesion only, located at the mucosa of the vulva or the vaginal vestibule. The clinical symptoms depended on the age of infestation. Wohlfahrtia magnifica (Diptera: Sarcophagidae) was the only myiasis-causing fly species i...
Gimsing S.Occupational injuries are notifiable in Denmark. Hitherto, occupational injuries caused by riding and horse handling have not been reported. Methods: This retrospective study comprises all cases reported to the National Working Environment Authority during the period 1992-1999. Results: There were 634 occupational accidents, and 43% of the victims were below the age of 25 years with a four-in-one female preponderance. In contrast, there were only three cases of occupational disease. Conclusions: Occupational diseases ought to be much more common than suggested by these few reported cases. Resp...
Gimsing S.A previous estimate has indicated that horse activities in Denmark account for about 5750 non-fatal and 1-2 fatal accidents every year. Many are preventable, as they are caused by carelessness. A description of the accident pattern is important. Methods: The European Home and Leisure Accident Surveillance System (EHLASS) has included data on horse-related accidents since 1989. All 8662 accidents in the period, 1989-1999, were studied. Death certificates from 11 fatal cases during the same period were obtained from the National Board of Health. Results: The annual total number of riding acciden...
Barros AT.Once a month, from June 1992 to May 1993, collections of tabanids on horse were conducted in the Nhecolândia, Pantanal State of Mato Grosso do Sul, Brazil. Tabanid catches using hand nets were conducted from sunrise to sunset at grassland and cerradão (dense savanna) habitats. A total of 3,442 tabanids from 21 species,12 genera, and 3 subfamilies were collected. Although species abundance varied seasonally depending on habitat, no habitat specificity was observed for the most abundant species. In the grassland, 1,625 (47.2%) tabanids belonging to 19 species were collected, while 1,817 (52.8%...
Mellor DJ, Love S, Walker R, Gettinby G, Reid SW.Details of the management, feeding, level of activity and routine health care of horses in Scotland and the five northernmost counties in England were recorded through a stratified random sample of horse owners who had responded to a previous survey. Sixty-eight per cent of the horses were kept where their owners resided, and 32 per cent were kept away from the owner's home. More than 99 per cent were turned out to grazing for at least part of the year and 81 per cent were stabled for at least part of the time, most commonly bedded on straw (50 per cent) or shavings (34 per cent). Hay was fed ...
Weese JS, Baird JD, Poppe C, Archambault M.Salmonella Typhimurium definitive type 104 (DT104) has emerged as a common cause of salmonellosis in humans and cattle, yet previous reports involving horses are sparse. This study reports the emergence of DT104 as an important pathogen in horses in Ontario. The first clinical case of DT104 infection at the Ontario Veterinary College was identified in 1997. Seventeen cases of DT104-associated salmonellosis were identified between 1997 and 2000. In 2000, 12 of 13 cases of salmonellosis were due to DT104. Salmonellosis in horses due to DT104 is of concern, since the organism is multiresistant to...
Miyazaki S, Fukumura M, Yoshioka M, Yamanaka N.From 1997 to 1999, 29 cases of disorders were detected in cattle and horses that had been fed ryegrass straw imported from the U.S.A. These animals showed symptoms resembling ryegrass staggers and the clinical signs disappeared after removal of the straw. Endophytic hyphae were detected in the seeds of all straw samples that were responsible for the clinical cases. Lolitrem B concentrations in the straw ranged between 972 and 3740 ppb. Ergovaline concentrations were between 355 and 1300 ppb. Even though the concentrations of lolitrem B were lower than the toxic threshold proposed by Oregon Sta...
Hullinger PJ, Gardner IA, Hietala SK, Ferraro GL, MacLachlan NJ.To compare seroprevalence of antibodies against equine arteritis virus (EAV) in horses residing in the United States with that of imported horses. Methods: Serologic survey. Methods: Serum samples from 364 horses on 44 equine operations in California and 226 horses imported from various countries. Methods: Serum samples were collected from each imported horse and from up to 20 horses on each operation. For resident horses, the number of sampled horses on each operation was determined on the basis of the number of horses on the operation. Samples were tested for antibodies against EAV by use of...
Huang JA, Ficorilli N, Hartley CA, Wilcox RS, Weiss M, Studdert MJ.Equine rhinovirus serotype 3 isolate P313/75 was assigned, with an unclassified genus status, to the family PICORNAVIRIDAE: The sequence from the 5' poly(C) tract to the 3' poly(A) tract of P313/75 was determined. The sequence is 8821 bases in length and contains a potential open reading frame for a polyprotein of 2583 amino acids. Sequence comparison and phylogenic analysis suggest that P313/75 is most closely related to the prototype equine rhinitis B virus (ERBV) strain P1436/71, formerly named equine rhinovirus type 2. A high degree of sequence similarity was found in the P2 and P3 regions...
Varrasso A, Dynon K, Ficorilli N, Hartley CA, Studdert MJ, Drummer HE.To develop and validate specific, sensitive and rapid (< 8 hour) diagnostic tests using polymerase chain reaction (PCR) for the diagnosis of abortion and respiratory disease caused by equine herpesvirus 1 (EHV1; equine abortion virus) and EHV4 (equine rhinopneumonitis virus). Methods: Primer sets based on nucleotide sequences encoding glycoprotein H (gH) of EHV1 and gB of EHV4 were designed and used in single round and second round (seminested) PCRs, and in a multiplex PCR for the diagnosis of EHV1 and EHV4 infections. Methods: Oligonucleotide primers were designed for each virus, PCR condi...
Iba K, Wada T, Kawaguchi S, Fujisaki T, Yamashita T, Ishii S.To investigate the demographic details and patterns of injuries related to horse handling, we reviewed 637 horse-related injuries in 581 stable- or stud-workers in a representative area of thoroughbred stabling in Japan. We found that (1) injuries occurred most frequently in a group of a relatively young workers, with a seasonal variation; (2) the principal mechanism of injury was kicks, which accounted for 39.2% of all injuries, including 11 serious and one lethal visceral injuries; (3) the upper half of the body was more frequently involved than the lower half; and (4) the peripheral bones (...
Kershaw O, von Oppen T, Glitz F, Deegen E, Ludwig H, Borchers K.The prevalence of EHV-2 in 27 horses with keratoconjunctivitis and 21 clinically healthy horses of different ages and stocks were analyzed. We demonstrated that EHV-2 was present in 12 keratoconjunctivitis cases as shown by nested PCR on ocular swabs. This is statistically more often than in the control group, where only two ocular swabs were EHV-2 positive. Cocultivation was successful on peripheral blood leukocytes of healthy and diseased horses but not on swabs. We isolated ten EHV-2 strains from diseased and nine from control horses, whereas 16 isolates showed different restriction enzyme ...
Ostlund EN, Crom RL, Pedersen DD, Johnson DJ, Williams WO, Schmitt BJ.After the 1999 outbreak of West Nile (WN) encephalitis in New York horses, a case definition was developed that specified the clinical signs, coupled with laboratory test results, required to classify cases of WN encephalitis in equines as either probable or confirmed. In 2000, 60 horses from seven states met the criteria for a confirmed case. The cumulative experience from clinical observations and diagnostic testing during the 1999 and 2000 outbreaks of WN encephalitis in horses will contribute to further refinement of diagnostic criteria.
Nicolaiewsky TB, Richter MF, Lunge VR, Cunha CW, Delagostin O, Ikuta N, Fonseca AS, da Silva SS, Ozaki LS.We describe a nested polymerase chain reaction (PCR) for the detection of Babesia equi in equine infected erythrocytes using oligonucleotides designed on the published sequence of a B. equi merozoite antigen gene (ema-1). A 102bp DNA fragment is specifically amplified from B. equi but not from Babesia caballi, Babesia bovis or Babesia bigemina DNA. In a mock infection we were able to detect down to six infected cells in 10(8) equine erythrocytes or to detect the parasite in blood with an equivalent parasitemia of 0.000006%. Furthermore, gene polymorphism was found by performing a PCR-RFLP (PCR...
Faye D, Pereira de Almeida PJ, Goossens B, Osaer S, Ndao M, Berkvens D, Speybroeck N, Nieberding F, Geerts S.In a study of the prevalence and incidence of trypanosomosis in horses and donkeys in two regions of the Gambia, surveys were carried out at Niamina east and Bansang south with a high and low to moderate tsetse challenge, respectively. Eleven horses and 67 donkeys were sampled monthly from August 1997 to September 1998. Blood samples were examined for trypanosomes using the buffy-coat (BC) method and polymerase chain reaction (PCR). Three primer sets were used, specific for either Trypanosoma vivax (TVW), Trypanosoma congolense (GOL) or Trypanosoma brucei (ORPHON5J). The BC results showed that...
Trock SC, Meade BJ, Glaser AL, Ostlund EN, Lanciotti RS, Cropp BC, Kulasekera V, Kramer LD, Komar N.West Nile (WN) virus was identified in the Western Hemisphere in 1999. Along with human encephalitis cases, 20 equine cases of WN virus were detected in 1999 and 23 equine cases in 2000 in New York. During both years, the equine cases occurred after human cases in New York had been identified.
Bauerfeind R, Wieler LH, Weiss R, Baljer G.From April 1990 through June 1991 clinical salmonellosis and asymptomatic faecal excretion of Salmonella spp. were seen in hospitalized horses at two veterinary hospitals. 76 Salmonella strains from hospitalized horses and 18 strains from horses without any clinical contact were characterized by serotyping and plasmid profile analysis. From April 1990 through January 1991 97.8% of the hospitalized horses were infected with strains of S. typhimurium var. Copenhagen, which were closely related according to their similar plasmid patterns. Other strains of S. typhimurium var. Copenhagen and seroty...
Feder HM, Nelson RS, Cartter ML, Sadre I.A survey was performed to identify people who were exposed to a rabid pony and determine whether or not they received rabies postexposure prophylaxis (PEP). Sixty-one visitors who came in contact with the rabid pony were identified. These visitors heard about the rabid pony via the news media. Forty-five visitors were exposed during the 2 weeks before the pony died. Thirty-two of these 45 visitors received PEP. Thirty-one visitors had or may have had saliva contact to an open wound or mucosa and all 31 received PEP. Fourteen visitors had no saliva contact to a wound or mucosa and one received ...
Cavalcante AL, Dias LM, Alves JT, Veras AA, Guimarães LC, Rocha FS, Gala-García A, Retamal P, Ramos RT, Azevedo V, Silva A, Carneiro AR.Corynebacterium pseudotuberculosis is related to several diseases infecting horses and small ruminants, causing economic losses to agribusiness. Here, we present the genome sequence of C. pseudotuberculosis strain E19. The genome includes one circular chromosome 2,367,956 bp (52.1% G+C content), with 2,112 genes predicted, 12 rRNAs, and 48 tRNAs.
Wilson G, Cooper K, Williams J, Eastwood S, Peake C.The 2007 equine influenza (EI) outbreak in New South Wales (NSW) consisted of a central infected area that extended south from the lower New England Tableland, across the Hunter Valley, Central Coast and the Sydney basin, and a series of isolated clusters outside this area across rural NSW. The central area was assigned the status of a Purple Zone (Special Restricted Area, SRA) approximately 1 month after the outbreak commenced. Within this SRA, the eradication program's focus was to increase the proportion of horses immune to EI via vaccination, thus reducing the susceptible proportion to a l...
Spyrou V, Papanastassopoulou M, Koumbati M, Nikolakaki SV, Koptopoulos G.Molecular analysis of the regulatory and structurally important genetic segments of equine infectious anemia virus (EIAV) in mules is presented. We have previously reported clinicopathological and laboratory findings in mules infected with EIAV, both naturally and after experimental inoculation. In this study the fragment coding for integrase, gp90, tat and the fusion domain of gp45 of the proviral genome from these animals was sequenced and compared with one another and with that of EIAV strains already published in the literature. Significant variations were observed mainly in the sequences ...
Tanaka K, Asai Y, Kuwano A.At 114 ranches in the Hidaka District of Hokkaido, a total of 1,118 Thoroughbred foals that were born from January to June 2003 were examined at different times from May to September of the same year to ascertain the occurrence of clubfoot. Clubfoot was seen in a total of 179 foals (16%) at 89 ranches (78%). Also, 124 of the 179 foals (69.3%) had clubfoot of grade II or higher, and it was found that grade I was likely to be overlooked or rapidly advance. In the present study, the occurrence of clubfoot was higher than expected in the investigated region. Hence, it is necessary to establish acc...
Rivas VN, Aleman M, Peterson JA, Dahlgren AR, Hales EN, Finno CJ.Juvenile idiopathic epilepsy (JIE) is an inherited disease characterized by recurrent seizures during the first year of life in Egyptian Arabian horses. Definitive diagnosis requires an electroencephalogram (EEG) performed by a veterinary specialist. A recent study has suggested that a 19 base-pair deletion, along with a triple-C insertion, in intron five of twelve (∆19InsCCC; chr20:29542397-29542425: GTTCAGGGGACCACATGGCTCTCTATAGA>TATCTTAAGACCC) of the () gene is associated with JIE. To confirm this association, a new sample set consisting of nine EEG-phenotyped affected and nine unaffec...
Enders F, Weber A.Fecal samples of 146 horses were culturally investigated for occurrence of Prototheca spp. using a selective medium, developed by PORE (1973). Prototheca zopfii could be isolated in monoculture from 9 fecal samples (6.2%). The results of this pilot study show that horses too can harbour and shed Prototheca spp. in variable frequency.
Gorucu S, Murphy DJ, Kassab C.The purpose of this study was to investigate characteristics associated with farm equipment and horse and buggy roadway crashes in relation to person, incident, and injury characteristics to identify appropriate points for injury incident prevention. Information on crashes occurring on public roads during the years 2010-2013 was obtained from the Pennsylvania Department of Transportation (PennDOT) and analyzed. There were 344 farm equipment and 246 horse and buggy crashes during the 4-year study period. These crashes involved 666 and 504 vehicles and 780 and 838 people, respectively. In incide...
da Piedade I, Skive B, Christensen H, Bojesen AM.We present the draft genome sequence of Streptococcus equi subsp. zooepidemicus S31A1, a strain isolated from equine infectious endometritis in Denmark. Comparative analyses of this genome were done with four published reference genomes: S. zooepidemicus strains MGCS10565, ATCC 35246, and H70 and S. equi subsp. equi strain 4047.
Hayashi S, Tanaka T, Moriishi K, Hirayama K, Yamada A, Hotta K.Non-primate hepacivirus (NPHV) is recently identified as a closely related homologue of hepatitis C virus. The previous studies showed a high prevalence of NPHV infection among Japanese domestic horses originated from abroad. The historical distribution of NPHV among horses in Japan, therefore, is still unknown. In this study, seroepidemiological study of NPHV was conducted using 335 sera from five breeds of Japanese native horses. These horses are maintained as the pedigree and are reared apart from other horse breeds. The detection of antibodies against NPHV were conducted by western blot an...
Nicoletti PL, Mahler JR, Scarratt WK.Horses at a veterinary teaching hospital and a slaughterhouse were surveyed for antibodies to Brucella abortus, B canis and Actinobacillus equuli. Four of the 141 hospitalised horses and none of the 73 slaughtered horses had titres of 1:100 or greater to B abortus. Six horses of both populations reacted to the card test. One was culture positive. A card test using B canis antigen was positive in 38 per cent of the sera from hospitalised horses and all of the slaughtered horses. Twenty (27.4 per cent) of the latter group had high tires in a tube agglutination test. High titres could not be redu...
Teixeira WF, Felippelli G, Cruz BC, Maciel WG, Fávero FC, Gomes LV, Buzzulini C, Prando L, Bichuette MA, Lopes WD, Oliveira GP, Costa AJ.With the aim of studying the endoparasite fauna of horses from the Formiga city, located in center-west region of the state of Minas Gerais, 25 animals that were naturally infected with helminths were evaluated. By means of parasitological necropsies, different endoparasites were found. The subfamily Cyathostominae presented the highest incidence, followed by Trichostrongylus axei, Oxyuris equi, Triodontophorus serratus, Strongyloides westeri, Strongylus edentatus, Habronema muscae, Parascaris equorum, Probstmayria vivipara, Strongylus vulgaris, Gasterophilus nasalis, Anoplocephala magna and A...
Escande F, Vallee E, Aubart F.The isolation of Pasteurella caballi from an horse-bite wound in a 56-year-old man is reported. Biochemical characteristics are described and compared with the other species representing the genus Pasteurella. This strain probably represents the first human isolate of P. caballi in France.
Mair TS, de Westerlaken LV, Cripps PJ, Love S.Samples of faeces and blood were obtained from 66 adult horses with diarrhoea. The results of routine bacteriological, parasitological, haematological and biochemical tests were correlated with the outcome of the cases. Twenty-two (33 per cent) of the horses died or were destroyed as a consequence of the diarrhoea. A diagnosis was reached in only 23 cases (35 per cent), and in nine of them only at post mortem examination. Salmonella typhimurium was isolated from five cases. Statistical analysis revealed significant differences between the horses which survived and those which died in their pac...
Drăgănescu N, Iftimovici R, Girjabu E, Iacobescu V, Buşila A, Cvaşniuc D, Tudor G, Mănăstireanu M, Lăpuşneanu .The paper reports on serological results obtained by HAI tests against several alphaviruses - eastern equine encephalitis (EEE), western equine encephalitis (WEE), Chikungunya, Midlebourg, Semliki Forest, Sindbis, and Ilheus viruses - carried out in humans and some domestic animals in a region with an intensive circulation of migratory birds. It was possible to detect in human antibodies to EEE, WEE, and Sindbis viruses, but in very low proportions (1.8%, 0.4%, and 0.6%, respectively). Serological results obtained in animals were practically negative: antibodies to EEE virus were found only in...