Equine diseases encompass a wide range of health conditions that can affect horses, including infectious diseases, metabolic disorders, and genetic conditions. These diseases can impact the overall health, performance, and well-being of horses. Common equine diseases include equine influenza, equine herpesvirus, laminitis, and equine metabolic syndrome. Diagnosis and management of these diseases often require a combination of clinical evaluation, laboratory testing, and appropriate treatment strategies. This page gathers peer-reviewed research studies and scholarly articles that explore the etiology, pathophysiology, diagnosis, and treatment options for various equine diseases, providing valuable insights for veterinarians and researchers in the field.
Stock KF, Hamann H, Distl O.Genetic parameters were estimated for the prevalence of osseous fragments in distal (DIJ) and proximal interphalangeal (PIJ), fetlock (FJ) and hock joints (HJ) of Hanoverian Warmblood horses by using residual maximum likelihood (REML) with linear animal models. The analyses were based on the results of 10 standardized radiographs of all four limbs of 3725 young riding horses selected for sale at auction. Transformation factors onto the underlying liability scale were verified by a simulation study. The heritability estimates of osseous fragments on the liability scale were in the range of h2 =...
Abraham G, Kottke C, Dhein S, Ungemach FR.We examined the inhibitory sympathetic beta-adrenergic mechanisms in peripheral lung, bronchi and trachea of an equine model of recurrent airway obstruction (RAO), to support the hypothesis that the beta-adrenergic receptor dysfunction is not only restricted to cell surface receptor density but rather encompasses a mechanistic defect apart from the receptor, to the intracellular signaling components. The non-asthmatic lung possessed 3.2-fold more beta-adrenergic receptors than bronchi (496 +/- 19.4 vs. 155.1+/- 19.6 fmol/mg protein; P < 0.01) and 6.2-fold higher than in the trachea (79.8 +/...
Katila T.In this review, effects of the composition of the inseminate on uterine response and pregnancy rates in mares are discussed. The inseminate can differ for volume, sperm concentration, total sperm numbers, presence, absence, or proportion of seminal plasma, and extender composition. Semen can be used as fresh, cooled, or frozen. The site of semen deposition also plays a role; semen is deposited either into the uterine body (standard artificial insemination (AI)) or into the tip of the uterine horn ipsilateral to the preovulatory follicle (deep AI) using the hysterocopical or transrectally guide...
Stout TA.Situations in which suppression or stimulation of reproductive activity in stallions has been attempted, or is desired, include resolution of the equine arteritis virus 'shedding' state, induction of testicular descent in inguinal cryptorchids, and the improvement of sperm production capacity and/or semen quality in sub-fertile stallions. However, the most common reason for wanting to modulate reproductive activity in a stallion is to alter the expression of sexual behaviour. In the case of intact stallions used for competitive or recreational purposes, the overt expression of sexual or aggres...
Leeb T, Sieme H, Töpfer-Petersen E.Our knowledge on the many aspects of mammalian reproduction in general and equine reproduction in particular has greatly increased during the last 15 years. Advances in the understanding of the physiology, cell biology, and biochemistry of reproduction have facilitated genetic analyses of fertility. Currently, there are more than 200 genes known that are involved in the production of fertile sperm cells. The completion of a number of mammalian genome projects will aid in the investigation of these genes in different species. Great progress has been made in the understanding of genetic aberrati...
Leroux C, Montelaro RC, Sublimec E, Cadoré JL.Equine infectious anemia virus (EIAV) is a lentivirus related to HIV (human immunodeficiency virus). EIAV causes a persistent infection characterized by recurring febrile episodes associating viremia, fever and thrombocytopenia. Despite a rapid virus replication and antigenic variation, most animals progress from a chronic stage characterized by recurring peaks of viremia and fever to an asymptomatic stage of infection. The understanding of the correlates of this immune control is of great interest in defining vaccine strategies. Research on EIAV over the last five decades has produced some in...
Giguère S, Polkes AC.Foals live in an environment heavily populated by bacteria, many of which are capable of causing disease. Development of infection,however, is the exception rather than the rule. The ability of the foal to prevent infection by most pathogens is the result of a sophisticated set of defense mechanisms. These defense mechanisms can be divided into adaptive and innate immunity. Innate immunity encompasses defense mechanisms that pre-exist or are rapidly induced within hours of exposure to a pathogen. Conversely, adaptive or acquired immunity represents host defenses mediated by T and B lymphocytes...
Bryant JE, Gaughan EM.Abdominal surgery in foals under 30 days old has become more common with improved neonatal care. Early recognition of a foal at risk and better nursing care have increased the survival rates of foals that require neonatal care. The success of improved neonatal care also has increased the need for accurate diagnosis and treatment of gastrointestinal, umbilical, and bladder disorders in these foals. This chapter focuses on the early and accurate diagnosis of specific disorders that require abdominal exploratory surgery and the specific treatment considerations and prognosis for these disorders.
MacKay RJ.Neurologic examination of the neonatal foal is quite different from the process used to examine older foals and adult horses. Abnormal neurologic signs are best appreciated in the context of a detailed knowledge of general neonatal medicine and awareness of nor-mal foal behavior and milestones of development. A systematic approach to neurologic examination is provided. The results of such examination are used to localize a lesion or lesions in the nervous system. Descriptions and treatment strategies are given for most common and important neonatal neurologic diseases.
Trumble TN.The first month of life is a vulnerable time for foals. They must adjust to their environment while they are still compromised immunologically, and their musculoskeletal system is rapidly growing and adjusting to stresses from an increasing amount of exercise. Therefore, if a foal is born with or acquires an abnormality or disease related to the musculoskeletal system, rapid adjustments must be made to allow the foal to grow and respond so that future athletic performance will not be compromised. Problems must be identified early, which requires thorough examinations. This article summarizes t...
Ryan CA, Sanchez LC.Neonates can have a variety of gastrointestinal disorders, primary and secondary in nature. Important primary disorders include con-genital abnormalities and meconium retention. One of the most important secondary lesions is generalized ileus. Gastric ulceration can occur as a primary or secondary event. This article addresses the pathophysiology, diagnosis, and treatment of gastrointestinal problems commonly observed in neonatal foals.
Orsini JA, Moate PJ, Boston RC, Norman T, Engiles J, Benson CE, Poppenga R.In two studies, six healthy adult horses were given imipenem-cilastatin by slow intravenous (i.v.) infusion at an imipenem dosage of 10 mg/kg (study 1) and 20 mg/kg (study 2). The same horses were used in each dosage schedule, with a 2-week washout period between studies. In each dosage group, serial blood and synovial fluid samples were collected for 6 h after completion of the infusion. HPLC was used to determine the imipenem concentration in all samples. Imipenem was well tolerated by all horses at both dosages; no adverse effects were noted during the study period or during the 24-hour pos...
Buechner-Maxwell VA.In recent years, equine neonatal medicine has made significant advances. The importance of nutritional support for the sick neonatal foal has been recognized, and methods of providing that sup-port have been developed. Today, the clinician has many options when designing a nutritional plan for the neonatal foal. When the foal's gut permits, enteral diets are an inexpensive source of nutrients. Under conditions where the gut requires rest, methods for delivering nutrients by the parenteral route have also been developed. In this article, the nutrition of the normal and sick foal is described. G...
Lawn K.During training, a 6-year-old standardbred gelding collapsed, exhibiting severe epistaxis and agonal breathing and was euthanized. The horse had a recent history of poor performance, lethargy, and unilateral eyelid swelling with serous ocular discharge. Postmortem and histopathologic examination findings revealed thoracic lymphosarcoma and concurrent exercise-induced pulmonary hemorrhage. Résumé — Mort subite d’un cheval de course de race standardbred causée par un lymphome thoracique. En cours d’entraînement, un standardbred hongre âgé de 6 ans s’est effondré, présentant des s...
Wagner B.Antibodies of the horse were studied intensively by many notable immunologists throughout the past century until the early 1970's. After a large gap of interest in horse immunology, additional basic studies on horse immunoglobulin genes performed during the past 10 years have resulted in new insights into the equine humoral immune system. These include the characterization of the immunoglobulin lambda and kappa light chain genes, the immunoglobulin heavy chain constant (IGHC) gene regions, and initial studies regarding the heavy chain variable genes. Horses express predominately lambda light c...
Lin Q, Rikihisa Y.Diverse p44 alleles at the p44 expression locus (p44Es) encoding surface-exposed major membrane proteins, P44s, of Anaplasma phagocytophilum were hypothesized to be garnered by recombination to enact antigenic variation. However, this hypothesis has not been proven so far, due to inability to clone this obligate intragranulocytic rickettsia. To define the p44E recombination, we developed a novel method to clone A. phagocytophilum. This isogenic cloned population containing a defined p44E was used to infect a naive horse and severe combined immunodeficiency (SCID) mice. During a 58-day infectio...
Kakhniashvili I, Filicko J, Kraft WK, Flomenberg N.Antithymocyte globulins (ATG) are purified, concentrated preparations of polyclonal immunoglobulin G from hyperimmune serum of horses or rabbits immunized with human thymus lymphocytes. Both the horse and the rabbit products induce immunosuppression as a result of lymphocyte depletion and immune modulation. The exact mechanism of action is unknown but may include T-cell clearance from the circulation and modulation of T-cell activation, homing, and cytotoxic activities. Both horse and rabbit ATG include multiple antibodies against T-cell surface antigens and have been used extensively in allog...
Orino K, Miura T, Muto S, Watanabe K.Canine and equine ferritin H and L subunit cDNA clones were obtained using reverse transcriptase-polymerase chain reaction (RT-PCR) and TA cloning from various tissues. Canine liver and spleen ferritin H subunit cDNA clones contained an open reading frame for the same 182-amino acid protein as that reported in canine brain ferritin H subunit cDNA although there were substitutions in the 3'-noncoding regions. Ferritin L subunit cDNA clones from canine liver, spleen, and kidney showed identical coding sequences encoding the 174-amino acid protein except for a single nucleotide substitution in ki...
van der Haegen A, Künzle F, Gerber V, Welle M, Robinson NE, Marti E.Recurrent airway obstruction (RAO) is a common condition in stabled horses characterised by small airway inflammation and obstruction following exposure of susceptible horses to mouldy hay and straw. The aim of the present study was to investigate whether lung tissue from horses with RAO contains higher numbers of IgE-protein positive (+) cells and mast cells compared to controls after mouldy hay challenge. Furthermore, mast cell subtypes in lung tissue were investigated. IgE+ cells were detected in most lung tissue samples but no significant differences between RAO-affected and control horses...
Goulden BE.A series of landmark studies on the function of the equine larynx was conducted by a group of researchers at Massey University between 1970 and 1987. These studies commenced with investigations on the normal laryngeal anatomy and physiology (Goulden et al 1976a; Anderson et al 1980; Quinlan et al 1982), and progressed to a clinical appraisal of laryngeal hemiplegia, the most important clinical disease affecting the horse's larynx (Goulden and Anderson 198 lab, 1982). The studies concluded with a series of in-depth cytological and pathological studies of the intrinsic laryngeal muscles and nerv...
Little D, Tomlinson JE, Blikslager AT.Post operative ileus (POI) remains an important cause of post operative morbidity and mortality in the horse. However, clinical progression of naturally occurring cases of POI in both horse and man does not entirely support the 'neurogenic' hypothesis as the sole mechanism of POI; and the hypothesis that inflammation plays a major role at 12-24 h after surgery requires validation. Objective: An inflammatory infiltrate in the muscularis externa and myenteric plexus of equine jejunum is present 18 h following a period of ischaemia. Methods: Samples of normal jejunum, jejunum from the proximal re...
Proudman CJ, Edwards GB, Barnes J, French NP.Large intestinal diseases are an important cause of equine colic that require surgical management, but there is little published information about long-term survival of such cases. Objective: To identify variables associated with post operative mortality and to develop a model for post operative survival following surgery for large intestinal disease. Methods: Clinical data and long-term follow-up information from 275 horses undergoing surgery for large intestinal disease were used. A multivariable, Cox proportional hazards model for post operative death was developed and the fit of the model ...
van Hoogmoed LM, Boscan PL.Although potent analgesics, opioids decrease intestinal activity, leading to ileus in many species. N-methylnaltrexone (MNTX), an opioid antagonist which does not cross the blood-brain barrier and antagonises the morphine effect on the intestine, directly stimulates motility and restores function without affecting analgesic properties. While its use has been reported in human subjects, there is no information with regard to its usage in the horse. Objective: To determine whether MNTX has an effect on contractile activity of the equine jejunum and pelvic flexure. Methods: Using circular smooth ...
Bernard WV, Williams D, Tuttle PA, Pierce S.A Thoroughbred foal that was born after 305 days of gestation was referred 6 hours after birth. On initial examination, the foal was alert, but weak and unable to stand. Heart rate was 150 beats/min, respiratory rate was 48 breaths/min, and rectal temperature was 33 C. Leukocytosis was detected (26,000 WBC/microliters). Dysuria and passage of red urine was observed approximately 30 hours after admission. Urine collected by free catch had a 3+ reaction for blood on dipstick analysis. Examination of Warthin Starry-stained sections of allantochorion revealed organisms morphologically characterist...
Del Piero F.Two 5-year-old grade male horses presented with epiphora, rhinorrhea, conjunctival and nasal mucosal hyperemia, and dorsal and thoracic macropapular rash. Skin biopsies were collected from the affected areas, and serial sections were evaluated following hematoxylin and eosin and immunoperoxidase histochemistry staining by using a murine monoclonal antibody of the immunoglobulin G2A isotype recognizing the 30-kDa membrane protein of equine arteritis virus (EAV). In both horses, lesions consisted of mild to moderate diffuse superficial dermal edema and vasculitis with mild perivascular lymphocyt...
Joubert P, Cordeau ME, Boyer A, Silversides DW, Lavoie JP.Heaves, also known as recurrent airway obstruction, is a common condition of horses characterised by pulmonary neutrophilia and reversible airway obstruction. This study evaluated the role of neutrophils in producing cytokines and chemokines that might be involved in the recruitment and activation of inflammatory cells in horses with heaves. Peripheral neutrophils were isolated from heaves-affected (n = 9) and control (n = 4) horses before and after 5 h of natural inhalation challenge. Expression of mRNA of two pro-inflammatory cytokines, tumour necrosis factor (TNF)-alpha and interleukin (IL)...
Engiles JB.The etiopathogenesis of laminitis is complex and involves multiple tissue types. It may be initiated by biomechanical, traumatic, inflammatory, vascular, toxic, and metabolic factors. Although histopathologic changes occurring within the lamellae of experimental models of laminitis are well described and reported, histopathologic changes occurring in the distal phalanx are not, even though gross and radiographic evidence of disease are often apparent and bony lesions could be considered a significant source of pain. Recent scientific evidence indicates that the microenvironment of bone is an i...
Takai S, Sengee S, Madarame H, Hatori F, Yasuoka K, Ochirel E, Sasaki Y, Kakuda T, Tsubaki S, Bandi N, Sodnomdarjaa R.In native Mongolian horses, the incidence and distribution of Rhodococcus equi are poorly understood. One hundred and fourteen equine fecal samples and 71 soil samples were collected from the camp sites of 26 nomadic families located in three areas less than 100 km from Ulaanbaatar, Mongolia. Five fecal samples were also collected from foals of Przewalski's Horses introduced into the Hustai National Park, Mongolia. No R. equi was isolated from the Mongolian horses or the soil samples. However, three colonies of R. equi were isolated from two fecal samples collected from foals of Przewalski's H...
Anderson ST, Kidd LJ, Barton AJ, Greer RM.Breeding mares typically foal yearly. Little is known about the dynamics of maternal bone stores during gestation and lactation, the timing of any maternal bone mobilisation, re-accretion post-foaling, or the dynamics of bone metabolism in foals. We measured serum osteocalcin (OC) and serum pyridinoline (PYD) concentrations in 18 mares monthly from 6months gestation to foaling, and in both mares and foals for 4months after birth. From 6 to 11months of gestation, there was no change in mean monthly OC. Serum PYD increased between 7months gestation and foaling. After foaling, mean serum OC was l...
Esteller-Vico A, Liu IK, Couto S.Vascular degeneration is present in endometrial vessels of multiparous aged mares. The lesions associated with vascular degeneration consist of enlargement, duplication and splitting of the membrana elastica interna and perivascular deposits of elastin. However, there are no similar data available for deep myometrial vessels and the vascular layer. The objectives of the present study were to characterize the status of vasculature in full-thickness uterine necropsy samples and to correlate these findings to endometrial grade, age, and parity. Elastosis was present in myometrial vessels, as well...
Williamson LH, Farrell RL.A case of intracranial schwannoma is described in a young horse. Clinical signs developed slowly and were suggestive of a lesion involving the left cerebrum. The filly exhibited a change in mentation, and circled to the left. Visual impairment and decreased facial sensation were noted on the right side. A solitary schwannoma which compressed the left cerebrum was found at necropsy.
Lyda RO, Hall JR, Kirkpatrick JF.Fifteen captive wild mares (Equus caballus) were treated with porcine zona pellucida contraceptive vaccine and either Freund's Complete Adjuvant (n = 7) or Freund's Modified Adjuvant (n = 8). All mares received a booster inoculation of porcine zona pellucida plus Freund's Incomplete Adjuvant a month later. Anti-porcine zona pellucida antibodies were measured over 10 mo following the initial inoculation. There were no significant differences in antibody titers at any point during the 10 mo, and seven of the eight mares in the Freund's Modified Adjuvant group were above the 60% level at the end ...
Rivas VN, Aleman M, Peterson JA, Dahlgren AR, Hales EN, Finno CJ.Juvenile idiopathic epilepsy (JIE) is an inherited disease characterized by recurrent seizures during the first year of life in Egyptian Arabian horses. Definitive diagnosis requires an electroencephalogram (EEG) performed by a veterinary specialist. A recent study has suggested that a 19 base-pair deletion, along with a triple-C insertion, in intron five of twelve (∆19InsCCC; chr20:29542397-29542425: GTTCAGGGGACCACATGGCTCTCTATAGA>TATCTTAAGACCC) of the () gene is associated with JIE. To confirm this association, a new sample set consisting of nine EEG-phenotyped affected and nine unaffec...
Turner AS, Yovich JV, White NA, Embertson RE, Santschi EM, Slone DE.A retrospective study was performed to evaluate the healing of ventral midline abdominal incisions, closed with a simple continuous suture pattern using absorbable suture material, in 139 horses and foals. Dehiscence and incisional hernia developed separately in two horses. The low incidence of dehiscence and incisional hernia, compared with their reported incidence following the use of interrupted suture repair, leads the authors to recommend this alternative method of abdominal incision closure in horses. The security of closure is not sacrificed and the advantages of a rapid closure are des...
Nitzsche AM, Fey K, Büttner K, Gröf M, Staszyk C.Pituitary pars intermedia dysfunction (PPID) is a common neurodegenerative disease mainly in horses older than 15 years. The domestic equine population is following the same demographic change as that seen in humans; it is aging and veterinarians are asked to attend to geriatric horses more frequently. Common problems seen regularly in older equines are dental disorders and especially periodontal disease. As a systemic and endocrine disease, associated with delayed wound healing and impaired immune function, PPID should be considered before major dental treatment in aged equines is started. Po...
Sahu SP, Wool S, Breese SS.In uterine or cervical specimens obtained from pony mares infected with streptomycin-resistant contagious equine metritis bacteria, several colonies of the bacteria which differed in morphologic characteristics were recognized during their primary isolation on Eugon chocolate agar and tryptose chocolate agar plates. The differences were usually not observed until plates were incubated 10 to 15 days. On Eugon chocolate agar plates, smooth colony, sandy colony with rings, and colony with blebs were recognized. On tryptose chocolate agar plates, only a round smooth convex colony was observed. By ...
Enders F, Weber A.Fecal samples of 146 horses were culturally investigated for occurrence of Prototheca spp. using a selective medium, developed by PORE (1973). Prototheca zopfii could be isolated in monoculture from 9 fecal samples (6.2%). The results of this pilot study show that horses too can harbour and shed Prototheca spp. in variable frequency.
Spoormakers TJP, Bergmann W, Veraa S, van Weeren PR, Brommer H.To verify the existence of intertransverse joints (ITJs) in young foals. 11 warmblood foals. Postmortem examination of the lumbar area in foals < 200 days old using CT, MRI, dissection, and histomorphology. Data were analyzed with descriptive statistics. Age of foals varied between 1 and 200 days (median, 11 days). Ten foals had 6 lumbar (L) vertebrae, and 1 foal had 5. All 11 foals, irrespective of age, had ITJs between the first sacral and last lumbar vertebrae and between the last and second-to-last lumbar vertebrae. In 6 foals (all with 6 L vertebrae), ITJs also existed between the four...
Beard WL, Robertson JT, Leeth B.Congenital frontal sinus cysts were found bilaterally in the frontal sinuses of a one-year-old miniature horse. Diagnosis was based on radiography of the head and cytologic examination of tissue aspirated from the frontal sinuses. The cysts were surgically removed, using a hinged bone flap technique bilaterally over the frontal sinuses.
Patil DB, Adamiak Z, Piórek A.The present review informs about the current status regarding use of interlocking nailing for fracture repair in animals. The clinical limitations of interlocking nailing and its subsequent improvement by evolving novel nail design or supplementation with type I ESF using hybrid nail bolt/ESF pin has been dealt. The biomechanical and clinical evaluation of novel interlocking nail supplements and its possible clinical use is included.