Equine diseases encompass a wide range of health conditions that can affect horses, including infectious diseases, metabolic disorders, and genetic conditions. These diseases can impact the overall health, performance, and well-being of horses. Common equine diseases include equine influenza, equine herpesvirus, laminitis, and equine metabolic syndrome. Diagnosis and management of these diseases often require a combination of clinical evaluation, laboratory testing, and appropriate treatment strategies. This page gathers peer-reviewed research studies and scholarly articles that explore the etiology, pathophysiology, diagnosis, and treatment options for various equine diseases, providing valuable insights for veterinarians and researchers in the field.
Escala J, Gatherer ME, Voûte L, Love S.Altered intestinal permeability is implicated in the pathogenesis of diverse equine medical conditions including alimentary laminitis and protein-losing enteropathies associated with parasitic infection. The aims of this study were to assess the feasibility of applying the 51Cr-EDTA absorption test for the assessment of intestinal permeability in the horse, and to apply this test in horses with experimentally induced alterations in gastrointestinal function. Four healthy ponies were administered 36 MBq of 51Cr-EDTA via naso-gastric tube, and urine samples were collected into polythene bags str...
Walter I, Handler J, Miller I, Aurich C.Periglandular arrangement of myofibroblasts, associated with the deposition of extracellular matrix (ECM), is a cardinal feature of endometrosis in mares. We hypothesized that a disturbance in the expression of matrix degrading enzymes such as matrix metalloproteinases (MMP's) and matrix cross-linking proteins might lead to an imbalance in deposition and degradation of extracellular matrix components and thereby accentuate degeneration. Therefore, distributions of MMP-2, capable of collagen IV and laminin degradation, and tissue transglutaminase (TG2), a cross-linker of extracellular matrix pr...
McClanahan SL, Stromberg BE, Hayden DW, Averbeck GA, Wilson JH.A 25-year-old Quarterhorse mare was euthanized for a variety of medical reasons. At necropsy, 7 liver flukes, identified as Fascioloides magna, were recovered from the liver. This is the first report of F. magna in a horse.
Dowling BA, Dart AJ.The in vitro and in vivo mechanical properties of the superficial digital flexor tendon have been described. To date the focus has been on single load to failure testing, however refined in vivo methods may prove useful to evaluate the effects of treatment and exercise on tendons. During maximal exercise, the adult superficial digital flexor tendon operates close to its functional limits with a narrow biomechanical safety margin. This combined with exercise and age associated microdamage, and a limited adaptive ability may increase the risk of fatigue failure. Studies evaluating treatment regi...
Chung C, Mealey RH, McGuire TC.Cytotoxic T lymphocytes (CTL) are critical for lentivirus control including EIAV. Since CTL from most EIAV carrier horses recognize Gag epitope clusters (EC), the hypothesis that carrier horses would have high functional avidity CTL to optimal epitopes in Gag EC was tested. Twenty-two optimal EC epitopes were identified; two in EC1, six in EC2, and seven each in EC3 and 4. However, only five of nine horses had high functional avidity CTL (<or=11 nM) recognizing six epitopes in EC; four in relatively conserved EC3; and one each in EC1 and 2. Horses with high functional avidity CTL had signif...
Geburek F, Deegen E, Hewicker-Trautwein M, Ohnesorge B.In the present field study the skin of the feet of 37 heavy draught horses of different breeds showing verrucous pastern dermatitis was examined clinically. Included were the degree of severity of the disease and the prevalence of anatomically normal structures associated with the skin: fetlock tufts of hair ("feathering"), ergots, chestnuts, bulges in the pastern region, cannon circumference. Each horse was examined for Chorioptes sp. skin mites. Information was also collected on the development of the skin alterations and housing conditions and feeding. These individual data were correlated ...
Diallo IS, Hewitson G, Wright L, Rodwell BJ, Corney BG.Equid herpesvirus 1 (EHV1) is a major disease of equids worldwide causing considerable losses to the horse industry. A variety of techniques, including PCR have been used to diagnose EHV1. Some of these PCRs were used in combination with other techniques such as restriction enzyme analysis (REA) or hybridisation, making them cumbersome for routine diagnostic testing and increasing the chances of cross-contamination. Furthermore, they involve the use of suspected carcinogens such as ethidium bromide and ultraviolet light. In this paper, we describe a real-time PCR, which uses minor groove-bindi...
Pirrone F, Albertini M, Clement MG, Lafortuna CL.The aim of this study was to investigate and quantify respiratory mechanical dysfunctions in Standardbred horses with both poor performance and bronchoalveolar lavage fluid cytology characteristic of inflammatory airway disease (IAD). A control group of healthy Standardbred horses was compared. Respiratory mechanics and breathing pattern were examined at rest and during hyperventilation induced using a rebreathing method. At rest, respiratory mechanics and breathing pattern were superimposable in both groups. In IAD horses, rebreathing increased ventilation, with larger tidal volumes and lower...
Ameni G.Epizootic lymphangitis (EL) was experimentally reproduced in four horses that had been purchased from an EL-free district. Two horses were injected with either 0.2 mL of the yeast form of Histoplasma capsulatum var. farciminosum (HCF) in pus (Horse 1), or 0.2 mL (ca. 20 mg) of a suspension in saline of the mycelial form (Horse 2), both into the pre-scapular and pre-femoral lymph nodes, with scarification of the skin of the left hind limb, conjunctiva of the right eye and the nasal membrane of the right nostril. The two other horses served as controls. Nodular lesions of EL appeared during the ...
Florin M, Arzdorf M, Linke B, Auer JA.To compare the mechanical properties of 4 stabilization methods for equine long-bone fractures: dynamic compression plate (DCP), limited contact-DCPlate (LC-DCP), locking compression plate (LCP), and the clamp-rod internal fixator (CRIF--formerly VetFix). Methods: In vitro mechanical study. Methods: Bone substitute material (24 tubes) was cut at 20 degrees to the long axis of the tube to simulate an oblique mid-shaft fracture. Methods: Tubes were divided into 4 groups (n=6) and double plated in an orthogonal configuration, with 1 screw of 1 implant being inserted in lag fashion through the "fr...
McDonnell SM, Hinze AL.Periodic spontaneous erection and penile movements known as masturbation (SEAM) occur normally at approximately 90 min intervals in awake equids. SEAM in horses has traditionally been misunderstood by many horsemen as aberrant behavior that should be eliminated. Accordingly, it is not uncommon for trainers of performance stallions or managers of breeding stallions to punish SEAM in an attempt to eliminate the behavior. Previous clinical observations and preliminary unsystematic trials had suggested that attempts to stop stallion SEAM may lead to an increase rather than a decrease in SEAM, and ...
Chidambaram RM, Eades SC, Moore RM, Hosgood G, Venugopal CS.To characterize the in vitro response of equine cecal longitudinal smooth muscle (CLSM) to endothelin (ET)-1 and assess the role of ETA and ETB receptors in those ET-1-induced responses. Methods: 36 horses without gastrointestinal tract disease. Methods: To determine cumulative concentration-response relationships, CLSM strips were suspended in tissue baths containing graded concentrations of ET-1 (10(-9) to 10(-6)M) with or without BQ-123 (ETA receptor antagonist); with or without IRL-1038 (ETB receptor antagonist); or with both antagonists at concentrations of 10(-9), 10(-7), and 10(-5)M. To...
Brommer H, Laasanen MS, Brama PA, van Weeren PR, Barneveld A, Helminen HJ, Jurvelin JS.To determine the speed of sound (SOS) in equine articular cartilage and investigate the influence of age, site in the joint, and cartilage degeneration on the SOS. Methods: Cartilage samples from 38 metacarpophalangeal joints of 38 horses (age range, 5 months to 22 years). Methods: Osteochondral plugs were collected from 2 articular sites of the proximal phalanx after the degenerative state was characterized by use of the cartilage degeneration index (CDI) technique. The SOS was calculated (ratio of needle-probe cartilage thickness to time of flight of the ultrasound pulse), and relationships ...
Hoffman AM, Swanson LG, Bruns SJ, Kuehn H, Bedenice D.To determine whether tension of the girth strap of a saddle would sufficiently affect rib motion and reduce lung volume to alter pulmonary resistance in horses. Methods: 10 healthy adult horses. Methods: We used classical techniques to measure the effects of tightening a girth strap (15 kg of tension) on pulmonary dynamics during eupnea and hyperpnea in horses. Respiratory impedance was evaluated by use of oscillometry, and resistance and reactance data were partitioned into lung and chest wall components. Rib cage and abdominal contributions to tidal volume and minute ventilation were measure...
van der Harst MR, DeGroot J, Kiers GH, Brama PA, van de Lest CH, van Weeren PR.To assess whether site-related changes in biochemical composition are present in the cartilage and subchondral and trabecular bone of the metacarpophalangeal joint of horses with early osteoarthritis. Methods: Right metacarpophalangeal joints from 59 mature warmblood horses. Methods: Biochemical data (cross-link, amino acid, DNA, and ash contents; denatured collagen and glycosaminoglycan [GAG] concentrations; bone mineral density; and mineral composition) were obtained from 2 differently loaded sites of phalanx I cartilage and subchondral and trabecular bone samples; data were compared with pr...
Ward MP.Since first being detected in New York in 1999, West Nile virus (WNV) has spread throughout the United States and more than 20,000 cases of equine WNV encephalomyelitis have been reported. A spatial model of disease occurrence was developed, using data from an outbreak of serologically confirmed disease in an unvaccinated population of horses at 108 locations in northern Indiana between 3 August and 17 October 2002. Daily maximum temperature data were recorded at meteorological stations surrounding the study area. The distribution of the total number of degree-days elapsing between July 4 and ...
Naudé TW, Gerber R, Smith RJ, Botha CJ.Datura poisoning of horses is extensively reviewed. An outbreak of intractable impaction colic affecting 18 of 83 horses was stopped by withdrawing dried tef hay contaminated with young Datura plants. The dried, botanically identified Datura stramonium and D. ferox contained respectively 0.15% mass/mass (m/m) hyoscyamine as well as 0.16% m/m hyoscine (scopolamine) and only hyoscine at a concentration of 0.11% m/m. Immature, unidentifiable plants resembling D. stramonium, contained 0.14% m/m and 0.12% m/m of the 2 respective tropane alkaloids. The outbreak was characterised by protracted and re...
Soutullo A, García MI, Bailat A, Racca A, Tonarelli G, Malan Borel I.Equine infectious anemia virus (EIAV) is a lentivirus causing a persistent infection in horses characterized by recurrent febrile episodes and high levels of viremia associated with a novel antigenic strain of the virus. The virus contains two envelope glycoproteins, gp90 and gp45, and four internal proteins, p26, p15, p11 and p9. Considering that the most infected horses are able to restrict EIAV replication to very low levels and that gp45 and p26 contain highly conserved epitopes among lentiviruses, it would be necessary to identify those conserved epitopes stimulating cellular and humoral ...
Cooper C, Sears W, Bienzle D.Availability of recombinant human erythropoietin (EPO) has facilitated use to enhance red blood cell production, and therefore aerobic performance, in human and equine athletes. Recombinant human EPO promotes growth and differentiation of equine erythroid precursor cells, but in some horses repeat administration induces immune interference with endogenous EPO resulting in fatal anemia. Although blood reticulocyte parameters acquire unique changes in humans treated with EPO, with manual enumeration methods, horses were not considered to release reticulocytes from the bone marrow into circulatio...
Alvarenga MA, Papa FO, Landim-Alvarenga FC, Medeiros AS.Stallion semen cryopreservation, despite its impact on the horse industry, is not an established technology. During the last years, a number of modifications have been proposed to the freezing process, however, a large population of stallions still have poor semen quality and fertility after frozen-thawed. Glycerol toxicity could be a reason for the variation on stallion sperm freezability. There are limited publications concerning the use of alternative cryoprotectants for equine sperm. Glycerol is contraceptive for some species and other cryoprotectors, such as amides, have been show to be a...
Elsheikha HM, Lacher DW, Mansfield LS.Phylogenetic analyses based on sequences of the nuclear-encoded small subunit rRNA (ssurRNA) gene were performed to examine the origin, phylogeny, and biogeographic relationships of Sarcocystis neurona isolates from opossums and horses from the State of Michigan, USA, in relation to other cyst-forming coccidia. A total of 31 taxa representing all recognized subfamilies and genera of Sarcocystidae were included in the analyses with clonal isolates of two opossum and two horse S. neurona. Phylogenies obtained by the four tree-building methods were consistent with the classical taxonomy based on ...
Horohov DW, Beadle RE, Mouch S, Pourciau SS.Acute and chronic inflammation of the airway remains an important health problem for equids. "Heaves" or recurrent airway obstruction (RAO) remains one of the most commonly diagnosed conditions affecting the lung of older horses in Europe and the United States. The typical clinical signs of RAO include non-productive coughing, serous nasal discharge, labored expiratory effort, and flaring of the nostrils. Auscultation of the lungs of the affected horse often reveals abnormal respiratory sounds, described as crackles and wheezes, throughout the area of the lung field. These clinical signs occur...
Weidenhöfer V, Martin H, Peters J.Since the late 9th century, scientific literature in Arabian language, based on the translation and compilation of works of the Classical, Persian and Indian culture considerably increased. This also applies to the field of veterinary medicine, as is illustrated by a number of hippological and hippiatric treatises. Affinities between texts on horse medicine in Antiquity and in Arabian literature have been mentioned by philologists, but the degree of dependence on classical texts could not be verified due to the lack of translations of the Arabian texts. In this respect, the oldest available te...
Slack JA, McGuirk SM, Erb HN, Lien L, Coombs D, Semrad SD, Riseberg A, Marques F, Darien B, Fallon L, Burns P, Murakami MA, Apple FS, Peek SF.The cardiac biomarkers cardiac troponin T (cTnT) and I (cTnI) and the cardiac isoenzyme of creatine kinase (CKMB) are used extensively in human medicine to diagnose and provide valuable prognostic information in patients with ischemic, traumatic, and septic myocardial injury. We designed a study to establish normal values for these markers in healthy, neonatal foals and to compare them with values obtained from septic neonates in a referral hospital population. The 25th, 50th, 75th, and 95th percentiles for cTnI and CKMB in the healthy-foal population were 0.08, 0.14, 0.25, 0.49 ng/mL and 1.4,...
Perrocheau M, Boutreux V, Chadi-Taourit S, Di Meo GP, Perucatti A, Incarnato D, Cribiu EP, Guérin G, Iannuzzi L.The INRA and the CHORI-241 horse BAC libraries were screened by hybridization with DNA probes and/or directly by PCR with primers designed in consensus sequences of genes localized at the end of each human chromosome. BAC clones were retrieved and 36 could be FISH mapped after the expected gene was confirmed in each BAC by sequencing. Our results show that 16 BACs can be considered to be at telomeric or centromeric positions in the horse and 15 were found at the boundary of actually defined conserved segments even-though often located within conserved syntenic fragments between horse and human...
Penedo MC, Millon LV, Bernoco D, Bailey E, Binns M, Cholewinski G, Ellis N, Flynn J, Gralak B, Guthrie A, Hasegawa T, Lindgren G, Lyons LA, Røed KH....A comprehensive male linkage map was generated by adding 359 new, informative microsatellites to the International Equine Gene Map half-sibling reference families and by combining genotype data from three independent mapping resources: a full sibling family created at the Animal Health Trust in Newmarket, United Kingdom, eight half-sibling families from Sweden and two half-sibling families from the University of California, Davis. Because the combined data were derived primarily from half-sibling families, only autosomal markers were analyzed. The map was constructed from a total of 766 marker...
Arrighi S, Romanello MG, Domeneghini C.The ultrastructure of the epithelial lining of the ductuli efferents and the ductus epididymis in the horse (Equus caballus) is described. Several types of cells can be distinguished: ciliated and non-ciliated cells make up the epithelium of the ductuli efferents, whereas principal, apical and basal cells are found in the ductus epididymis. The observations are compared with those made in other species, in particular in the donkey (Equus asinus), and the possible functional roles of the different cell types are discussed.
Bernard WV, Williams D, Tuttle PA, Pierce S.A Thoroughbred foal that was born after 305 days of gestation was referred 6 hours after birth. On initial examination, the foal was alert, but weak and unable to stand. Heart rate was 150 beats/min, respiratory rate was 48 breaths/min, and rectal temperature was 33 C. Leukocytosis was detected (26,000 WBC/microliters). Dysuria and passage of red urine was observed approximately 30 hours after admission. Urine collected by free catch had a 3+ reaction for blood on dipstick analysis. Examination of Warthin Starry-stained sections of allantochorion revealed organisms morphologically characterist...
Del Piero F.Two 5-year-old grade male horses presented with epiphora, rhinorrhea, conjunctival and nasal mucosal hyperemia, and dorsal and thoracic macropapular rash. Skin biopsies were collected from the affected areas, and serial sections were evaluated following hematoxylin and eosin and immunoperoxidase histochemistry staining by using a murine monoclonal antibody of the immunoglobulin G2A isotype recognizing the 30-kDa membrane protein of equine arteritis virus (EAV). In both horses, lesions consisted of mild to moderate diffuse superficial dermal edema and vasculitis with mild perivascular lymphocyt...
Joubert P, Cordeau ME, Boyer A, Silversides DW, Lavoie JP.Heaves, also known as recurrent airway obstruction, is a common condition of horses characterised by pulmonary neutrophilia and reversible airway obstruction. This study evaluated the role of neutrophils in producing cytokines and chemokines that might be involved in the recruitment and activation of inflammatory cells in horses with heaves. Peripheral neutrophils were isolated from heaves-affected (n = 9) and control (n = 4) horses before and after 5 h of natural inhalation challenge. Expression of mRNA of two pro-inflammatory cytokines, tumour necrosis factor (TNF)-alpha and interleukin (IL)...
Engiles JB.The etiopathogenesis of laminitis is complex and involves multiple tissue types. It may be initiated by biomechanical, traumatic, inflammatory, vascular, toxic, and metabolic factors. Although histopathologic changes occurring within the lamellae of experimental models of laminitis are well described and reported, histopathologic changes occurring in the distal phalanx are not, even though gross and radiographic evidence of disease are often apparent and bony lesions could be considered a significant source of pain. Recent scientific evidence indicates that the microenvironment of bone is an i...
Takai S, Sengee S, Madarame H, Hatori F, Yasuoka K, Ochirel E, Sasaki Y, Kakuda T, Tsubaki S, Bandi N, Sodnomdarjaa R.In native Mongolian horses, the incidence and distribution of Rhodococcus equi are poorly understood. One hundred and fourteen equine fecal samples and 71 soil samples were collected from the camp sites of 26 nomadic families located in three areas less than 100 km from Ulaanbaatar, Mongolia. Five fecal samples were also collected from foals of Przewalski's Horses introduced into the Hustai National Park, Mongolia. No R. equi was isolated from the Mongolian horses or the soil samples. However, three colonies of R. equi were isolated from two fecal samples collected from foals of Przewalski's H...
Anderson ST, Kidd LJ, Barton AJ, Greer RM.Breeding mares typically foal yearly. Little is known about the dynamics of maternal bone stores during gestation and lactation, the timing of any maternal bone mobilisation, re-accretion post-foaling, or the dynamics of bone metabolism in foals. We measured serum osteocalcin (OC) and serum pyridinoline (PYD) concentrations in 18 mares monthly from 6months gestation to foaling, and in both mares and foals for 4months after birth. From 6 to 11months of gestation, there was no change in mean monthly OC. Serum PYD increased between 7months gestation and foaling. After foaling, mean serum OC was l...
Esteller-Vico A, Liu IK, Couto S.Vascular degeneration is present in endometrial vessels of multiparous aged mares. The lesions associated with vascular degeneration consist of enlargement, duplication and splitting of the membrana elastica interna and perivascular deposits of elastin. However, there are no similar data available for deep myometrial vessels and the vascular layer. The objectives of the present study were to characterize the status of vasculature in full-thickness uterine necropsy samples and to correlate these findings to endometrial grade, age, and parity. Elastosis was present in myometrial vessels, as well...
Williamson LH, Farrell RL.A case of intracranial schwannoma is described in a young horse. Clinical signs developed slowly and were suggestive of a lesion involving the left cerebrum. The filly exhibited a change in mentation, and circled to the left. Visual impairment and decreased facial sensation were noted on the right side. A solitary schwannoma which compressed the left cerebrum was found at necropsy.
Lyda RO, Hall JR, Kirkpatrick JF.Fifteen captive wild mares (Equus caballus) were treated with porcine zona pellucida contraceptive vaccine and either Freund's Complete Adjuvant (n = 7) or Freund's Modified Adjuvant (n = 8). All mares received a booster inoculation of porcine zona pellucida plus Freund's Incomplete Adjuvant a month later. Anti-porcine zona pellucida antibodies were measured over 10 mo following the initial inoculation. There were no significant differences in antibody titers at any point during the 10 mo, and seven of the eight mares in the Freund's Modified Adjuvant group were above the 60% level at the end ...
Rivas VN, Aleman M, Peterson JA, Dahlgren AR, Hales EN, Finno CJ.Juvenile idiopathic epilepsy (JIE) is an inherited disease characterized by recurrent seizures during the first year of life in Egyptian Arabian horses. Definitive diagnosis requires an electroencephalogram (EEG) performed by a veterinary specialist. A recent study has suggested that a 19 base-pair deletion, along with a triple-C insertion, in intron five of twelve (∆19InsCCC; chr20:29542397-29542425: GTTCAGGGGACCACATGGCTCTCTATAGA>TATCTTAAGACCC) of the () gene is associated with JIE. To confirm this association, a new sample set consisting of nine EEG-phenotyped affected and nine unaffec...
Turner AS, Yovich JV, White NA, Embertson RE, Santschi EM, Slone DE.A retrospective study was performed to evaluate the healing of ventral midline abdominal incisions, closed with a simple continuous suture pattern using absorbable suture material, in 139 horses and foals. Dehiscence and incisional hernia developed separately in two horses. The low incidence of dehiscence and incisional hernia, compared with their reported incidence following the use of interrupted suture repair, leads the authors to recommend this alternative method of abdominal incision closure in horses. The security of closure is not sacrificed and the advantages of a rapid closure are des...
Nitzsche AM, Fey K, Büttner K, Gröf M, Staszyk C.Pituitary pars intermedia dysfunction (PPID) is a common neurodegenerative disease mainly in horses older than 15 years. The domestic equine population is following the same demographic change as that seen in humans; it is aging and veterinarians are asked to attend to geriatric horses more frequently. Common problems seen regularly in older equines are dental disorders and especially periodontal disease. As a systemic and endocrine disease, associated with delayed wound healing and impaired immune function, PPID should be considered before major dental treatment in aged equines is started. Po...
Sahu SP, Wool S, Breese SS.In uterine or cervical specimens obtained from pony mares infected with streptomycin-resistant contagious equine metritis bacteria, several colonies of the bacteria which differed in morphologic characteristics were recognized during their primary isolation on Eugon chocolate agar and tryptose chocolate agar plates. The differences were usually not observed until plates were incubated 10 to 15 days. On Eugon chocolate agar plates, smooth colony, sandy colony with rings, and colony with blebs were recognized. On tryptose chocolate agar plates, only a round smooth convex colony was observed. By ...
Enders F, Weber A.Fecal samples of 146 horses were culturally investigated for occurrence of Prototheca spp. using a selective medium, developed by PORE (1973). Prototheca zopfii could be isolated in monoculture from 9 fecal samples (6.2%). The results of this pilot study show that horses too can harbour and shed Prototheca spp. in variable frequency.
Spoormakers TJP, Bergmann W, Veraa S, van Weeren PR, Brommer H.To verify the existence of intertransverse joints (ITJs) in young foals. 11 warmblood foals. Postmortem examination of the lumbar area in foals < 200 days old using CT, MRI, dissection, and histomorphology. Data were analyzed with descriptive statistics. Age of foals varied between 1 and 200 days (median, 11 days). Ten foals had 6 lumbar (L) vertebrae, and 1 foal had 5. All 11 foals, irrespective of age, had ITJs between the first sacral and last lumbar vertebrae and between the last and second-to-last lumbar vertebrae. In 6 foals (all with 6 L vertebrae), ITJs also existed between the four...