Equine health encompasses the study and management of diseases, disorders, and overall well-being of horses. It involves understanding various physiological systems, preventive care, and treatment strategies to maintain optimal health in equine populations. Common areas of focus include nutrition, infectious diseases, orthopedic conditions, and reproductive health. Research in equine health aims to advance knowledge on diagnostic methods, therapeutic interventions, and management practices that improve horse welfare and performance. This page collects peer-reviewed research studies and scholarly articles that explore the diverse aspects of equine health, offering insights into current findings and advancements in the field.
Aurich C, Müller-Herbst S, Reineking W, Müller E, Wohlsein P, Gunreben B, Aurich J.Warmblood fragile foal syndrome (WFFS) is a monogenetic defect with autosomal recessive inheritance. The WFFS homozygosity is non-compatible with extra-uterine life. Although as many as 15% of Warmblood horses are WFFS carriers, there has been little veterinary focus on this condition. The aim of this study was to determine outcomes and symptoms of clinical signs and pathological abnormalities during pregnancies when there were WFFS homozygous foetuses. Diagnostic material of 15 abortion or stillbirth cases with suspected diagnosis of WFFS was available for this study. Additionally, there were...
Fitzgerald DM, Pollitt CC, Walsh DM, Sillence MN, de Laat MA.The oral glucose test (OGT) is a useful tool for diagnosing insulin dysregulation (ID) and is somewhat repeatable in ponies under consistent management. This study aimed to determine whether the insulin and incretin responses to an OGT in ponies differed after short-term access to fertilised pasture, compared to unfertilised pasture, by using a randomised, repeated measures study design. Sixteen mixed-breed ponies were classified as severely insulin-dysregulated (SD; post-prandial insulin ≥80 μIU/mL) or not severely insulin-dysregulated (NSD; post-prandial insulin < 80 μIU/mL) using an O...
Leschke DH, Muir GS, Hodgson JK, Coyle M, Horn R, Bertin FR.Diseases associated with insulin dysregulation (ID), such as equine metabolic syndrome and pituitary pars intermedia dysfunction, are of interest to practitioners because of their association with laminitis. Accurate insulin concentration assessment is critical in diagnosing and managing these diseases. Objective: To determine the effect of time, temperature, and collection tube type on insulin concentrations in horses at risk of ID. Methods: Eight adult horses with body condition score >6/9. Methods: In this prospective study, subjects underwent an infeed oral glucose test 2 hours before...
Pasolini MP, Spinella G, Del Prete C, Valentini S, Coluccia P, Auletta L, Greco M, Meomartino L.Ultrasonography (US) is the recommended imaging technique to evaluate jugular veins. This prospective randomized clinical study was designed to collect a series of B-mode US measurements of manually distended jugular veins in healthy Italian Standardbreds and to find possible correlations between ultrasound measurements and animal morphometric characteristics. Forty-two horses, eight males and 34 females (range 3-22 years; bodyweight 494.4 ± 41.7 kg), were included in the study. The diameters and wall thicknesses of both jugular veins were measured at three different sites of the neck...
Rivas VN, Aleman M, Peterson JA, Dahlgren AR, Hales EN, Finno CJ.Juvenile idiopathic epilepsy (JIE) is an inherited disease characterized by recurrent seizures during the first year of life in Egyptian Arabian horses. Definitive diagnosis requires an electroencephalogram (EEG) performed by a veterinary specialist. A recent study has suggested that a 19 base-pair deletion, along with a triple-C insertion, in intron five of twelve (∆19InsCCC; chr20:29542397-29542425: GTTCAGGGGACCACATGGCTCTCTATAGA>TATCTTAAGACCC) of the () gene is associated with JIE. To confirm this association, a new sample set consisting of nine EEG-phenotyped affected and nine unaffec...
Isgren CM, Salem SE, Singer ER, Wylie CE, Lipreri G, Graham RJTY, Bladon B, Boswell JC, Fiske-Jackson AR, Mair TS, Rubio-Martínez LM.Previous studies investigating factors associated with survival following endoscopic treatment of contamination/sepsis of the calcaneal bursa are limited. Objective: To investigate the factors associated with survival in horses with contamination/sepsis of the calcaneal bursae treated endoscopically and to describe the bacterial isolates involved in the synovial infections. Methods: Retrospective analysis of clinical records. Methods: Medical records from 128 horses with contamination/sepsis of the calcaneal bursae treated by endoscopic lavage at seven equine hospitals were reviewed. A follow-...
Kydd JH, Hannant D, Robinson RS, Bryant N, Osterrieder N.Equid herpesvirus-1 (EHV-1) causes respiratory and neurological disease and late gestation abortion in pregnant mares. Current vaccines contain either inactivated or live EHV-1, but fail to provide complete clinical or virological protection, namely prevention of nasopharyngeal shedding and cell-associated viraemia. Thus, the development of novel products, such as modified live virus (MLV) vaccines which stimulate virus-specific, humoral and cell mediated immune responses more effectively remains a priority. Two groups of weaned foals (n = 6 each group) were used in a longitudinal, prospec...
Chen JW, Stefanovski D, Haughan J, Jiang Z, Boston R, Soma LR, Robinson MA.Extracorporeal shockwave therapy (ESWT) can potentially mask painful injuries in equine athletes. Tests to detect whether a horse has received ESWT prior to competition are needed. Extracorporeal shockwave therapy is known to affect inflammatory mediators in other species, and if these mediators are altered in the horse, these could serve as biomarkers of ESWT. Objective: To test the hypothesis that a single application of ESWT will alter the circulating protein concentrations of 10 inflammatory mediators in horse plasma. Methods: Prospective repeated measures experimental study. Methods: Elev...
Orellana-Guerrero D, Renaudin C, Edwards L, Rose E, Aleman M, Moore PF, Dujovne G.Placentitis has been reported as the most important cause of equine abortions, stillbirths, and perinatal deaths in horses. Most cases are caused by bacteria and less commonly by fungal elements. The aim of this report is to describe the clinical presentation of a fungal placentitis caused by Aspergillus terrerus. A 5-year-old thoroughbred maiden mare at the 217th day of gestation presented with some classic signs of placentitis (premature udder development and milk dripping). All ultrasonographic findings were consistent with a live fetus and a severe placentitis. On vaginal examination, pur...
Yao C.The kinetoplastid protozoan Leishmania spp. cause leishmaniasis, which clinically exhibit mainly as a cutaneous, mucocutanous or visceral form depending upon the parasite species in humans. The disease is widespread geographically, leading to 20 000 annual deaths. Here, leishmaniases in both humans and animals, reservoirs and sand fly vectors on the Caribbean islands are reviewed. Autochthonous human infections by Leishmania spp. were found in the Dominican Republic, Guadeloupe and Martinique as well as Trinidad and Tobago; canine infections were found in St. Kitts and Grenada; and equine infe...
Álvarez-Narváez S, Giguère S, Anastasi E, Hearn J, Scortti M, Vázquez-Boland JA.Antibiotic use has been linked to changes in the population structure of human pathogens and the clonal expansion of multidrug-resistant (MDR) strains among healthcare- and community-acquired infections. Here we present a compelling example in a veterinary pathogen, , the causative agent of a severe pulmonary infection affecting foals worldwide. We show that the (46) gene responsible for emerging macrolide resistance among equine isolates in the United States is part of a 6.9-kb transposable element, Tn, actively mobilized by an IS family transposase. Tn is carried on an 87-kb conjugative pla...
Thompson RE, Johnson AK, Prado TM, Premanandan C, Brown ME, Whitlock BK, Pukazhenthi BS.Availability of viable frozen-thawed endometrial tissues could facilitate detailed studies into physiologic and disease processes influencing the endometrium. This study was designed to investigate the cryosurvival of equine endometrial tissue. Previous studies in the human and horse have focused on cryopreservation of dissociated endometrial cells. To our knowledge, there are no studies on cryopreservation of endometrial explants. Our objectives were to 1) determine the influence of differing concentrations of the permeating cryoprotectant dimethyl sulfoxide (MeSO) on viability, structural in...
Tozaki T, Kusano K, Ishikawa Y, Kushiro A, Nomura M, Kikuchi M, Kakoi H, Hirota K, Miyake T, Hill EW, Nagata S.Fractures are medical conditions that compromise the athletic potential of horses and/or the safety of jockeys. Therefore, the reduction of fracture risk is an important horse and human welfare issue. The present study used molecular genetic approaches to determine the effect of genetic risk for fracture at four candidate SNPs spanning the myostatin (MSTN) gene on horse chromosome 18. Among the 3706 Japanese Thoroughbred racehorses, 1089 (29.4%) had experienced fractures in their athletic life, indicating the common occurrence of this injury in Thoroughbreds. In the case/control association st...
Fernandes CB, Ball BA, Loux SC, Boakari YL, Scoggin KE, El-Sheikh Ali H, Cogliati B, Esteller-Vico A.Anatomical and molecular changes in the cervical barrier in women are a fundamental part of the pathogenesis of pregnancy loss associated with chorioamnionitis. However, there is little information regarding changes in the cervix associated with ascending infection in pregnant mares. To better characterize morphological and molecular changes in the cervix during placentitis, we examined full thickness histology and mRNA expression for a number of inflammatory and endocrine factors in the mucosa and stroma of the cervix of mares (n = 5) after experimental induction of placentitis via transc...
Nemoto M, Schofield W, Cullinane A.The objective of this study was to investigate the presence of equine coronavirus (ECoV) in clinical samples submitted to a diagnostic laboratory in Ireland. A total of 424 clinical samples were examined from equids with enteric disease in 24 Irish counties between 2011 and 2015. A real-time reverse transcription polymerase chain reaction was used to detect ECoV RNA. Nucleocapsid, spike and the region from the p4.7 to p12.7 genes of positive samples were sequenced, and sequence and phylogenetic analyses were conducted. Five samples (1.2%) collected in 2011 and 2013 tested positive for ECoV. Po...
Altan E, Li Y, Sabino-Santos G, Sawaswong V, Barnum S, Pusterla N, Deng X, Delwart E.Metagenomics was used to identify viral sequences in the plasma and CSF (cerobrospinal fluid) of 13 horses with unexplained neurological signs and in the plasma and respiratory swabs of 14 horses with unexplained respiratory signs. Equine hepacivirus and two copiparvoviruses (horse parvovirus-CSF and a novel parvovirus) were detected in plasma from neurological cases. Plasma from horses with respiratory signs contained the same two copiparvoviruses plus equine pegivirus D and respiratory swabs contained equine herpes virus 2 and 5. Based on genetic distances the novel copiparvovirus qualified ...
Gozalo-Marcilla M, Luna SPL, Gasthuys F, Schauvliege S.To perform a literature review of the thermal and mechanical antinociceptive devices used in pharmacological studies in standing horses published after 2011 (2012-2019). To complete a full literature review about electrical stimulation used for evaluation in similar studies. Methods: PubMed, Google Scholar and Web of Science. Conclusions: A high level of standardization has been reached in antinociceptive studies in standing horses using thermal and mechanical stimuli in most recent years. Commercially available testing devices to deliver thermal, mechanical and electrical stimuli, with observ...
Spence KL, Cardwell JM, Slater J, Rosanowski SM.The potential for an exotic disease incursion is a significant concern for the United Kingdom (UK) equine industry. Horse owners' perceptions of, and attitudes towards, exotic diseases can influence decisions to adopt disease preparedness strategies. The objectives of this study were to describe horse owners' 1) perceptions of the term 'exotic disease', and 2) attitudes towards their risk of being affected by an exotic disease. In order to address these objectives, qualitative content analysis was undertaken on data collected using two open-ended survey questions. Results: Horse owners (n =...
Riddell LP, Yoshimura S, MacKay AV, Wilson DG.A 17-year-old Quarter horse mare was presented because of traumatic luxation of the fifth sacral and first coccygeal vertebrae resulting in loss of sensation, motor function, and perfusion of the tail. The case was complicated by an associated tail head hematoma. Due to the severity of the injury, tail amputation was performed at the level of the luxation. Tail amputations in horses at the sacrococcygeal junction following a suspected tail pull injury are infrequently reported in the literature. . Une jument Quarter horse âgée de 17 ans fut présentée pour cause de luxation traumatique de l...
Melinyshyn H.A 13-year-old Morgan crossbred mare was presented in May 2018 with a 10-cm mass on the medial aspect of the left hind fetlock. In September and November 2018 and June 2019 the mass was incompletely excised and continued to grow. A diagnosis of spindle cell tumor, consistent with equine sarcoid, was made based on histopathology from the last excision. . Une jument Morgan croisée âgée de 13 ans a été présentée en mai 2018 avec une masse de 10 cm sur l’aspect médial du boulet arrière gauche. En septembre et novembre 2018 ainsi qu’en juin 2019, la masse avait été excisée de manièr...
Blanco-Lobo P, Rodriguez L, Reedy S, Oladunni FS, Nogales A, Murcia PR, Chambers TM, Martinez-Sobrido L.Vaccination remains the most effective approach for preventing and controlling equine influenza virus (EIV) in horses. However, the ongoing evolution of EIV has increased the genetic and antigenic differences between currently available vaccines and circulating strains, resulting in suboptimal vaccine efficacy. As recommended by the World Organization for Animal Health (OIE), the inclusion of representative strains from clade 1 and clade 2 Florida sublineages of EIV in vaccines may maximize the protection against presently circulating viral strains. In this study, we used reverse genetics tech...
Gonzalez-Castro RA, Amoroso-Sanches F, Stokes JE, Graham JK, Carnevale EM.Oocyte activation is initiated when a fertilising spermatozoon delivers sperm-borne oocyte-activating factor(s) into the oocyte cytoplasm. Candidates for oocyte activation include two proteins, phospholipase Cζ1 (PLCZ1) and postacrosomal WW-binding protein (PAWP; also known as WBP2 N-terminal like (WBP2NL)). We localised PLCZ1 and WBP2NL/PAWP in stallion spermatozoa and investigated the PLCZ1 content and sperm parameters as well as cleavage after intracytoplasmic sperm injection (ICSI). PLCZ1 was identified as 71-kDa protein in the acrosomal and postacrosomal regions, midpiece and principal p...
Sheats MK, Davis KU, Poole JA.Farmers are routinely exposed to organic dusts and aeroallergens that can have adverse respiratory health effects including asthma. Horses are farm-reared large animals with similar exposures and can develop equine asthma syndrome (EAS). This review aims to compare the etiology, pathophysiology, and immunology of asthma in horses compared to farmers and highlights the horse as a potential translational animal model for organic dust-induced asthma in humans. Severe EAS shares many clinical and pathological features with various phenotypes of human asthma including allergic, non-allergic, late o...
de Paula VB, Canola PA, Rivera GG, Z Filho D, Amaral GPD, Ferraz GC, Ferraudo AS, Canola JC.To investigate effects of postural changes and bladder distention on intrabladder pressure whilst estimating intra-abdominal pressure in horses. Two-year cohort study. Patients admitted for elective surgical procedures unrelated to gastrointestinal or genitourinary tract. School of Agricultural and Veterinarian Sciences, Jaboticabal, SP, Brazil. 20 adult horses, 11 males (stallions and geldings) and 9 females; between 3.5 and 12 years, weighing 350 to 500 kg. Intra-abdominal pressure was directly-recorded through abdominocentesis at the ventral midline with a fluid-filled system. Intrabladder ...
Dai F, Dalla Costa A, Bonfanti L, Caucci C, Di Martino G, Lucarelli R, Padalino B, Minero M.The present work aimed to evaluate the efficacy of a self-loading training using positive reinforcement on stress-related behaviors shown by meat horses during loading procedures into a truck. Thirty-two meat horses ( = 18; = 14; 6 month-old) were included in the study. All horses had limited interactions with the farmer and were not used to be restrained nor lead by halter. Horses were divided in two groups: Control Group (C; = 14) and Training Group (T; = 18). T horses were trained to self-load: in order to teach the horses to enter into the truck, a targeting training technique throughou...
Beste KJ, Lawhon SD, Chamoun-Emanuelli AM, Duff AH, Coleman MC, Griffin CE, Hardy J, Whitfield-Cargile CM.Horses with bacterial sinusitis frequently undergo empirical treatment with antimicrobials, however, in some cases bacterial culture of the affected sinus is used to direct therapy. Data regarding which organisms are part of the commensal microbiota of the equine sinus are lacking making it difficult to interpret culture results and guide empiric antimicrobial selection. Objective: Our objectives were to describe the bacterial and fungal microbiota of the paranasal sinuses in clinically normal horses using culture-dependent and independent approaches and to compare the bacterial culture and su...
Rahmani V, Häyrinen L, Kareinen I, Ruohoniemi M.The progression of equine odontoclastic tooth resorption and hypercementosis (EOTRH) has not been completely evaluated, and currently, the only effective treatment is extraction of severely affected teeth. We aim to describe how the disease relates to the history and clinical findings and to report on the outcome in individual horses. This case series comprises data collected from 20 horses (age 14-29 years old) with radiographic findings of EOTRH in their incisor and/or canine teeth. Most horses affected with EOTRH in this study were admitted for dental problems, but some for other complaints...
Malalana F, Ireland JL, Pinchbeck G, McGowan CM.Uveitis appears to be less prevalent in the UK compared with other parts of the world and studies characterising the disease in the UK are lacking. The objectives of this retrospective study were to describe acute and recurrent cases presenting for management of uveitis in a referral hospital on the North West of England and compare the signalment of horses presenting with uveitis with the equine hospital population during the same period. Methods: Medical records of horses presented to the referral Equine Hospital, University of Liverpool with signs of uveitis between 2008 and 2018 were revie...
Draper ACE, Cahalan SD, Goodwin D, Perkins J, Piercy RJ.Equine recurrent laryngeal neuropathy (RLN) is a naturally occurring model of length-dependent axonopathy characterized by asymmetrical degeneration of recurrent laryngeal nerve axons (RLn). Distal RLn degeneration is marked, but it is unclear whether degeneration extends to include cell bodies (consistent with a neuronopathy). With examiners blinded to RLN severity, brainstem location, and side, we examined correlations between RLN severity (assessed using left distal RLn myelinated axon count) and histopathological features (including chromatolysis and glial responses) in the nucleus ambiguu...
Cuervo-Arango J, Claes AN, Stout TAE.In recent years, the number of equine invitro-produced embryos (IVP) has increased markedly; as yet, there are few reports on what constitutes an 'ideal' recipient for an IVP embryo. This study retrospectively investigated the effects of recipient mare oestrous cycle characteristics on the likelihood of pregnancy after transfer of IVP (n=264) and invivo-derived embryos (n=262). IVP embryos tolerated only a narrow window of recipient mare 'synchrony', with transfer on Day 4 after ovulation resulting in a higher likelihood of ongoing pregnancy (69%) than transfer on Days 3, 5 or 6 (53.2%, 41.3% ...
Hinshaw VS, Naeve CW, Webster RG, Douglas A, Skehel JJ, Bryans J.Influenza outbreaks involving viruses of the H3N8 subtype (equine 2) often occur in vaccinated horses. For this reason, a series of influenza viruses of the H3N8 subtype were examined to determine if antigenic variation could be detected in isolates during the period 1963-81. Antigenic analyses with post-infection ferret sera and monoclonal antibodies showed that the haemagglutinins of recent isolates were antigenically distinguishable from the prototype A/eq/Miami/1/63 and that antigenically distinguishable groups of equine 2 viruses co-circulate in the horse population. Based on these studie...
Stewart F, Allen WR.The role of equine chorionic gonadotrophin (CG, formerly termed Pregnant Mare serum Gonadotrophin, PMSG) in maintaining equine pregnancy was investigated by examining the effects of this hormone on the maternal ovaries during early gestation and relating these findings to the receptor binding activities of CG in vitro. Measurement of plasma progestagen profiles in mares and donkeys carrying horse, donkey, mule ( female horse X male donkey) and hinny (female donkey X male horse) conceptuses confirmed that CG induced several secondary ovulations and thus maintained maternal progestagen concentra...
Adreani CM, Li ZB, Lehar M, Southwood LL, Habecker PL, Flint PW, Parente EJ.The myosin heavy chain (MHC) composition of a given muscle determines the contractile properties and, therefore, the fiber type distribution of the muscle. MHC isoform expression in the laryngeal muscle is modulated by neural input and function, and it represents the cellular level changes that occur with denervation and reinnervation of skeletal muscle. The objective of this study was to evaluate the pattern of MHC isoform expression in laryngeal muscle harvested from normal cadavers and cadavers with naturally occurring left laryngeal hemiplegia secondary to recurrent laryngeal neuropathy. L...
Maury W, Oaks JL, Bradley S.Previous cell infectivity studies have demonstrated that the lentivirus equine infectious anemia virus (EIAV) infects tissue macrophages in vivo and in vitro. In addition, some strains of EIAV replicate to high titer in vitro in equine fibroblasts and fibroblast cell lines. Here we report a new cell type, macrovascular endothelial cells, that is infectible with EIAV. We tested the ability of EIAV to infect purified endothelial cells isolated from equine umbilical cords and renal arteries. Infectivity was detected by cell supernatant reverse transcriptase positivity, EIAV antigen positivity wit...
Mircica E, Clutton RE, Kyles KW, Blissitt KJ.To identify the incidence of adverse effects caused by morphine 100-170 micro g kg-1 administration during surgery in horses. Methods: Retrospective case record analysis (1996-2000). Methods: Eighty-four healthy (ASA 1 or 2) horses, mean age 5.5 +/- 3.1 (SD) years (2 months to 16 years), mean weight 524 +/- 14 kg (100-950). Methods: Physiological data and evidence of complications were collected from the anaesthetic records of all animals anaesthetized with romifidine, ketamine, diazepam and halothane and undergoing laryngeal surgery or orchiectomy at the Royal (Dick) School of Veterinary Stud...
Parraga ME, Spier SJ, Thurmond M, Hirsh D.The purpose of this study was to evaluate the effects of probiotic administration on the prevalence of fecal shedding of Salmonella, the prevalence of postoperative diarrhea, the length of antimicrobial therapy, and the length of the hospitalization stay during the postoperative period in horses with colic. Two commercially available probiotics for horses were used in a double-blind prospective study of 200 horses undergoing surgery for colic. Probiotic or placebo was administered PO once a day for 7 days postoperatively, and fecal cultures for Salmonella were obtained daily for 10 days. After...
Marin F.Motion is key to health and wellbeing, something we are particularly aware of in times of lockdowns and restrictions on movement. Considering the motion of humans and animals as a biomarker of the performance of the neuro-musculoskeletal system, its analysis covers a large array of research fields, such as sports, equine science and clinical applications, but also innovative methods and workplace analysis. In this Special Issue of Sensors, we focused on human and animal motion-tracking using inertial sensors. Ten research and two review papers, mainly on human movement, but also on the locomot...
Meier A, de Laat M, Pollitt C, Walsh D, McGree J, Reiche DB, von Salis-Soglio M, Wells-Smith L, Mengeler U, Mesa Salas D, Droegemueller S, Sillence MN.Laminitis is a common equine disease characterized by foot pain, and is commonly diagnosed using a five-grade Obel system developed in 1948 using sepsis-related cases. However, endocrinopathic laminitis is now the most common form of the disease and clinical signs may be mild, or spread across two Obel grades. This paper describes a modified method which assigns scores to discreet clinical signs, providing a wider scale suitable for use in a research setting. Methods: The "modified Obel" method was developed using an iterative process. First, a prototype method was developed during the detaile...
The Journal of heredityNovember 5, 1997
Volume 88, Issue 5 355-357 doi: 10.1093/oxfordjournals.jhered.a023117
Short RV.Haldane's law states that in interspecific hybrids, it is the heterogametic sex that is likely to be absent, rare, or sterile. In mammals, there is increasing evidence to suggest that this may be due to the high mutation rate of male sex-determining genes on the Y chromosome. The mule, humanity's first successful attempt at genetic engineering, provides some support for this concept. Interspecific hybrids may also shed new light on the importance of the maternal transmission of mitochondrial DNA and the phenomenon of genomic imprinting.
Trela JM, Spriet M, Padgett KA, Galuppo LD, Vaughan B, Vidal MA.Intra-arterial (i.a.) and intravenous (i.v.) regional limb perfusions (RLP) through the median artery and cephalic vein, respectively, have been previously investigated for administration of mesenchymal stem cells (MSCs) to the equine distal limb. Limitations due to thrombosis of the arteries after i.a. RLP and poor distribution of MSCs to the foot with i.v. RLP were observed. These techniques need to be modified for clinical use. Objective: Evaluate the distribution, uptake and persistence of radiolabelled MSCs after i.a. injection through the median artery without a tourniquet and after i.v....
Prescott JF, Johnson JA, Markham RJ.Four month-old foals were infected orally with 75 mL of a suspension of 5.0 x 10(8)Corynebacterium equi per mL. Two foals were killed after ten days and had scanty number of C. equi in the caeco-colic lymph nodes. No C. equi were recovered from the other two foals, killed 20 days after infection. No gross pathological change was detected in these four foals, although mild microscopic lesions were seen in the ileum of one foal. Results of lymphocyte blastogenesis using peripheral blood lymphocytes and C. equi antigens showed, however, that lymphocytes became sensitized to C. equi following this...
Daniels SP, Proudman CJ.This study reports ivermectin and moxidectin egg reappearance periods (ERP) from UK horses with persistently positive faecal egg counts (FEC), defined as positive FEC within the ERP of an anthelmintic post-treatment, or with FECs that remained positive after the normal ERP post-anthelmintic treatment. A selected population of UK pleasure horses deemed at high risk of strongyle infection was studied. The earliest ERP recorded after ivermectin or moxidectin, using first positive FEC, was 5 weeks. From 16 premises where moxidectin was used, five had ERP ≥12 weeks using two further metrics. For ...
Riley CB, Bolton JR, Mills JN, Thomas JB.The clinical, radiographic and post-mortem findings in 6 horses with cryptococcal pneumonia and one horse with an abdominal cryptococcal granuloma are described. In pulmonary cryptococcosis, the lesions were either diffuse and multiple, with bilateral lung involvement, or localised mainly to the dorsocaudal region of one lung. The cases of diffuse multiple cryptococcosis were thought to be associated with haematogenous spread of the fungus after gastrointestinal infection and dissemination from regional lymph nodes. The localised form of the disease was thought to have been associated with inh...
Roth LS, Balkenius A, Kelber A.Arrhythmic mammals are active both during day and night if they are allowed. The arrhythmic horses are in possession of one of the largest terrestrial animal eyes and the purpose of this study is to reveal whether their eye is sensitive enough to see colours at night. During the day horses are known to have dichromatic colour vision. To disclose whether they can discriminate colours in dim light a behavioural dual choice experiment was performed. We started the training and testing at daylight intensities and the horses continued to choose correctly at a high frequency down to light intensitie...
Calamari L, Ferrari A, Bertin G.This study was conducted to determine the effects of either dietary Se source or dose on the Se status of horses. Twenty-five mature horses were blocked by BW and randomly allocated to 1 of 5 dietary treatments that comprised the same basal diet that differed only in Se source or dose. Treatments were as follows: negative control (0.085 mg of Se/kg of DM), 3 different dietary concentrations of supplemental organic Se (Se yeast; 0.2, 0.3, and 0.4 mg of total Se/kg of DM), and positive control (0.3 mg of total Se/kg of DM) supplemented with Na selenite. Horses initially received the control diet...
Mössner LD, Schmitz A, Theurillat R, Thormann W, Mevissen M.To identify and characterize cytochrome P450 enzymes (CYPs) responsible for the metabolism of racemic ketamine in 3 mammalian species in vitro by use of chemical inhibitors and antibodies. Methods: Human, canine, and equine liver microsomes and human single CYP3A4 and CYP2C9 and their canine orthologs. Methods: Chemical inhibitors selective for human CYP enzymes and anti-CYP antibodies were incubated with racemic ketamine and liver microsomes or specific CYPs. Ketamine N-demethylation to norketamine was determined via enantioselective capillary electrophoresis. Results: The general CYP inhibit...
Mair TS, Walmsley JP, Phillips TJ.The medical records of 45 horses treated for suspected squamous cell carcinoma of the penis and/or prepuce were reviewed. The age of 40 horses was known, and these had a mean age of 17.4 years. The duration of neoplasia was known for only 3 of the 45 horses. The results of histological evaluation of lesions, available for 35 horses, confirmed that the diseased tissue was squamous cell carcinoma. The location of gross neoplastic lesions was recorded for 43 horses; the glans penis was involved in 24 horses, the body of the penis or the inner lamina of the preputial fold in 27 horses, and the ext...
Putnam MR, Bransby DI, Schumacher J, Boosinger TR, Bush L, Shelby RA, Vaughan JT, Ball D, Brendemuehl JP.Effects of the endophyte Acremonium coenophialum in tall fescue on pregnant mares and foal viability were evaluated. Twenty-two mature pregnant mares were randomly chosen to graze either Kentucky-31 tall fescue that was free from A coenophialum (endophyte-free, EF) or tall fescue infected with A coenophialum (endophyte-present, EP) after the first 90 days of pregnancy through parturition. Concentrations of pyrrolizidine and ergopeptine alkaloids were significantly greater in EP grass, compared with EF pasture. Ten of 11 mares grazing EP pasture had obvious dystocia. Mean duration of gestation ...
Steffey EP, Pascoe PJ, Woliner MJ, Berryman ER.To quantitate dose- and time-related anesthetic-sparing effects of xylazine hydrochloride (XYL) during isoflurane-induced anesthesia in horses and to characterize selected physiologic responses of anesthetized horses to administration of XYL. Methods: 6 healthy adult horses. Methods: Horses were anesthetized 2 times to determine the minimum alveolar concentration (MAC) of isoflurane in O2 and to characterize the anesthetic-sparing effect (MAC reduction) after IV administration of XYL (0.5 and 1 mg/kg of body weight, random order). Selected measures of cardiopulmonary function, blood glucose co...
Moore BR, Hinchcliff KW.Heparin is used clinically in horses to treat hemostatic abnormalities associated with severe gastrointestinal disease, septicemia, and endotoxemia. The primary anticoagulant effect of heparin is through the suppression of thrombin-dependent amplification of the coagulation cascade, and inhibition of thrombin-mediated conversion of fibrinogen to fibrin. Heparin may be of benefit in preventing the complications associated with hypercoagulable states such as jugular vein thrombosis, laminitis, and organ failure. Heparin may also be beneficial in the prevention of intraabdominal adhesions after g...
Hendrickson DA.Minimally invasive surgery in the human was first identified in mid 900's. The procedure as is more commonly practiced now was first reported in 1912. There have been many advances and new techniques developed in the past 100 years. Equine laparoscopy, was first reported in the 1970's, and similarly has undergone much transformation in the last 40 years. It is now considered the standard of care in many surgical techniques such as cryptorchidectomy, ovariectomy, nephrosplenic space ablation, standing abdominal exploratory, and many other reproductive surgeries. This manuscript describes the hi...
Kersh KD, McClure SR, Van Sickle D, Evans RB.Extracorporeal shock wave therapy (ESWT) is being used to treat desmitis and tendonitis in horses. This paper compares the clinical, ultrasonographic and histological characteristics of ESWT treated collagenase induced superficial digital flexor tendon (SDFT) lesions, versus untreated controls. This blinded study utilizes six mature, healthy horses where bilateral forelimb SDFT lesions were induced. One forelimb was treated while the other served as an untreated control. Three shock wave treatments were administered at three week intervals. At weekly intervals, ultrasonograms were used to meas...
Barsnick RJ, Hurcombe SD, Smith PA, Slovis NM, Sprayberry KA, Saville WJ, Toribio RE.Endocrine dysregulation of hormones of energy metabolism is well documented in critically ill humans, but limited information exists in septic foals. The purpose of this study was to provide information on the hormonal response to energy metabolism in critically ill foals, focusing on insulin, glucagon, and leptin. Objective: Concentrations of insulin, glucagon, leptin, and triglycerides will be higher, whereas glucose concentration will be lower in septic foals than in healthy and sick nonseptic foals. The magnitude of these differences will be associated with severity of disease and nonsurvi...
Mathee N, Robert M, Higgerty SM, Fosgate GT, Rogers AL, d'Ablon X, Carstens A.In several veterinary institutions, adjustments of CT machines have been made that allow for imaging of the standing horse. The risk of general anesthesia is eliminated and the shorter scan completion time reduces cost to clients. The objective of this retrospective, analytical study was to evaluate the technique, imaging diagnoses, feasibility, and image artifacts of multi-slice helical CT of horses' distal limbs acquired under standing sedation. The CT images of 250 horses of various breeds, aged 3-23 years, that underwent standing distal limb CT were evaluated. Three observers assessed the ...
Driessen B, Nann L, Benton R, Boston R.To study whether hemodynamic function in horses, particularly mean arterial blood pressure (MAP), is better maintained with sevoflurane than isoflurane, thus requiring less pharmacological support. Methods: Prospective randomized clinical investigation. Animals Thirty-nine racehorses undergoing arthroscopy in lateral recumbency. Methods: Horses were assigned to receive either isoflurane (n = 20) or sevoflurane (n = 19) at 0.9-1.0 minimum alveolar concentration (MAC) for maintenance of anesthesia. Besides routine clinical monitoring, cardiac output (CO) was measured by lithium dilution. Hemodyn...
Persson SG.The purposes of this study were to elucidate the influences of age and sex on the heart rate (HR, bpm) and blood lactate (LA, mmol/l) related exercise tolerance parameters V2000 (tread ill velocity at HR 200), VLA4 (velocity at LA 4), W200 (power output at V2000), and WLA4 (power output at VLA4), and to establish reference values for these in normally performing Standardbred trotting race horses. A further aim was to improve the predictability of individual normal values by correlating them with the total red blood cell volume (CV) alone or in combination with the blood lactate response at V20...
Parker JE, Fubini SL, Todhunter RJ.Fifty-three of 648 horses (8.2%) treated surgically for acute gastrointestinal obstruction were subjected to repeat celiotomy. Forty horses (75%) recovered from anesthesia after repeat celiotomy, and 26 horses (49%) were discharged from the clinic. Excluding two horses lost to follow-up, 10 of 51 horses (20%) survived long term. Horses subjected to repeat celiotomy had a significantly lower long-term survival rate than horses subjected to a single celiotomy. Twenty-eight horses had mechanical obstructions, and 22 had functional obstructions at the second surgery. Significantly more horses with...