Genetics in horses encompasses the study of hereditary traits and the genetic makeup that influences various characteristics and health conditions in equine populations. This field involves the analysis of genes and their functions, inheritance patterns, and the impact of genetic variations on traits such as coat color, performance ability, and susceptibility to diseases. Research in equine genetics employs techniques such as genome mapping, sequencing, and genetic testing to identify specific genes and mutations associated with these traits. This page gathers peer-reviewed research studies and scholarly articles that explore the genetic basis of equine traits, the methodologies used in genetic research, and the implications for breeding, health management, and conservation of horse breeds.
Pereira B, Dorado J, Diaz-Jimenez M, Consuegra C, Ortiz I, Gosalvez J, Hidalgo M.The acquisition of equine oocyte developmental capacity is ensured by the follicular environment, such as granulosa cells, which could reflect the meiotic development potential of immature oocytes. This study evaluated the relationship between DNA fragmentation of granulosa cells, using the chromatin dispersion test, and equine oocyte meiotic development after in vitro maturation. Granulosa cells and cumulus-oocytes complexes (n = 50) were recovered from slaughterhouse-derived ovaries. Oocytes were in vitro matured, stained and evaluated under fluorescence microscopy. Maturation rates were c...
Tanaka J, Leeb T, Rushton J, Famula TR, Mack M, Jagannathan V, Flury C, Bachmann I, Eberth J, McDonnell SM, Penedo MCT, Bellone RR.Mushroom is a unique coat color phenotype in Shetland Ponies characterized by the dilution of the chestnut coat color to a sepia tone and is hypothesized to be a recessive trait. A genome wide association study (GWAS), utilizing the Affymetrix 670K array (MNEc670k) and a single locus mixed linear model analysis (EMMAX), identified a locus on ECA7 for further investigation ( = 2.08 × 10). This locus contained a 3 Mb run of homozygosity in the 12 mushroom ponies tested. Analysis of high throughput Illumina sequencing data from one mushroom Shetland pony compared to 87 genomes from horses of var...
Klohonatz KM, Coleman SJ, Cameron AD, Hess AM, Reed KJ, Canovas A, Medrano JF, Islas-Trejo AD, Kalbfleisch T, Bouma GJ, Bruemmer JE.Maternal recognition of pregnancy (MRP) in the mare is not well defined. In a non-pregnant mare, prostaglandin F (PGF) is released on day 14 post-ovulation (PO) to cause luteal regression, resulting in loss of progesterone production. Equine MRP occurs prior to day 14 to halt PGF production. Studies have failed to identify a gene candidate for MRP, so attention has turned to small, non-coding RNAs. The objective of this study was to evaluate small RNA (<200 nucleotides) content in endometrium during MRP. Mares were used in a cross-over design with each having a pregnant and non-mated cycle. Ea...
Aurich C, Müller-Herbst S, Reineking W, Müller E, Wohlsein P, Gunreben B, Aurich J.Warmblood fragile foal syndrome (WFFS) is a monogenetic defect with autosomal recessive inheritance. The WFFS homozygosity is non-compatible with extra-uterine life. Although as many as 15% of Warmblood horses are WFFS carriers, there has been little veterinary focus on this condition. The aim of this study was to determine outcomes and symptoms of clinical signs and pathological abnormalities during pregnancies when there were WFFS homozygous foetuses. Diagnostic material of 15 abortion or stillbirth cases with suspected diagnosis of WFFS was available for this study. Additionally, there were...
Rivas VN, Aleman M, Peterson JA, Dahlgren AR, Hales EN, Finno CJ.Juvenile idiopathic epilepsy (JIE) is an inherited disease characterized by recurrent seizures during the first year of life in Egyptian Arabian horses. Definitive diagnosis requires an electroencephalogram (EEG) performed by a veterinary specialist. A recent study has suggested that a 19 base-pair deletion, along with a triple-C insertion, in intron five of twelve (∆19InsCCC; chr20:29542397-29542425: GTTCAGGGGACCACATGGCTCTCTATAGA>TATCTTAAGACCC) of the () gene is associated with JIE. To confirm this association, a new sample set consisting of nine EEG-phenotyped affected and nine unaffec...
Hybridization has been widely practiced in plant and animal breeding as a means to enhance the quality and fitness of the organisms. In domestic equids, this hybrid vigor takes the form of improved physical and physiological characteristics, notably for strength or endurance. Because the offspring of horse and donkey is generally sterile, this widely recognized vigor is expressed in the first generation (F1). However, in the absence of recombination between the two parental genomes, F1 hybrids can be expected to be phenotypically intermediate between their parents which could potentially restr...
Álvarez-Narváez S, Giguère S, Anastasi E, Hearn J, Scortti M, Vázquez-Boland JA.Antibiotic use has been linked to changes in the population structure of human pathogens and the clonal expansion of multidrug-resistant (MDR) strains among healthcare- and community-acquired infections. Here we present a compelling example in a veterinary pathogen, , the causative agent of a severe pulmonary infection affecting foals worldwide. We show that the (46) gene responsible for emerging macrolide resistance among equine isolates in the United States is part of a 6.9-kb transposable element, Tn, actively mobilized by an IS family transposase. Tn is carried on an 87-kb conjugative pla...
Nemoto M, Schofield W, Cullinane A.The objective of this study was to investigate the presence of equine coronavirus (ECoV) in clinical samples submitted to a diagnostic laboratory in Ireland. A total of 424 clinical samples were examined from equids with enteric disease in 24 Irish counties between 2011 and 2015. A real-time reverse transcription polymerase chain reaction was used to detect ECoV RNA. Nucleocapsid, spike and the region from the p4.7 to p12.7 genes of positive samples were sequenced, and sequence and phylogenetic analyses were conducted. Five samples (1.2%) collected in 2011 and 2013 tested positive for ECoV. Po...
Tozaki T, Kusano K, Ishikawa Y, Kushiro A, Nomura M, Kikuchi M, Kakoi H, Hirota K, Miyake T, Hill EW, Nagata S.Fractures are medical conditions that compromise the athletic potential of horses and/or the safety of jockeys. Therefore, the reduction of fracture risk is an important horse and human welfare issue. The present study used molecular genetic approaches to determine the effect of genetic risk for fracture at four candidate SNPs spanning the myostatin (MSTN) gene on horse chromosome 18. Among the 3706 Japanese Thoroughbred racehorses, 1089 (29.4%) had experienced fractures in their athletic life, indicating the common occurrence of this injury in Thoroughbreds. In the case/control association st...
Gonzalez-Castro RA, Amoroso-Sanches F, Stokes JE, Graham JK, Carnevale EM.Oocyte activation is initiated when a fertilising spermatozoon delivers sperm-borne oocyte-activating factor(s) into the oocyte cytoplasm. Candidates for oocyte activation include two proteins, phospholipase Cζ1 (PLCZ1) and postacrosomal WW-binding protein (PAWP; also known as WBP2 N-terminal like (WBP2NL)). We localised PLCZ1 and WBP2NL/PAWP in stallion spermatozoa and investigated the PLCZ1 content and sperm parameters as well as cleavage after intracytoplasmic sperm injection (ICSI). PLCZ1 was identified as 71-kDa protein in the acrosomal and postacrosomal regions, midpiece and principal p...
Sheats MK, Davis KU, Poole JA.Farmers are routinely exposed to organic dusts and aeroallergens that can have adverse respiratory health effects including asthma. Horses are farm-reared large animals with similar exposures and can develop equine asthma syndrome (EAS). This review aims to compare the etiology, pathophysiology, and immunology of asthma in horses compared to farmers and highlights the horse as a potential translational animal model for organic dust-induced asthma in humans. Severe EAS shares many clinical and pathological features with various phenotypes of human asthma including allergic, non-allergic, late o...
Beste KJ, Lawhon SD, Chamoun-Emanuelli AM, Duff AH, Coleman MC, Griffin CE, Hardy J, Whitfield-Cargile CM.Horses with bacterial sinusitis frequently undergo empirical treatment with antimicrobials, however, in some cases bacterial culture of the affected sinus is used to direct therapy. Data regarding which organisms are part of the commensal microbiota of the equine sinus are lacking making it difficult to interpret culture results and guide empiric antimicrobial selection. Objective: Our objectives were to describe the bacterial and fungal microbiota of the paranasal sinuses in clinically normal horses using culture-dependent and independent approaches and to compare the bacterial culture and su...
Lindenberg F, Krych L, Kot W, Fielden J, Frøkiær H, van Galen G, Nielsen DS, Hansen AK.Shortly after birth the mammalian gut is colonized, by a transient microbiota, highly susceptible to environment and diet, that eventually stabilizes and becomes the resident gut microbiota. In a window of opportunity during the colonization, oral tolerance is established towards resident bacteria. In this study, the development of the equine gut microbiota was investigated in ten foals from parturition until post weaning. We found great differences in the core species of the gut microbiota composition between time-matched samples on Day 7 and 20 post-partum. Between day 20 and Day 50 post-par...
Traversari J, Aepli H, Knutti B, Lüttgenau J, Bruckmaier RM, Bollwein H.The anti-Müllerian hormone (AMH) plays an inhibitory role during folliculogenesis by regulating the number of follicles entering the growing pool. Antral follicle counts (AFC) are highly correlated with serum AMH concentrations and both appear to be related to the ovarian reserve in several species. Few data on AMH and AFC in mares exist, especially with regard to fertility. Therefore, the objective of the current study was to investigate the interrelationship between antral follicle count, serum AMH concentrations and fertility outcome in mares. One hundred and twenty-seven mares were enroll...
Damasceno Teixeira TV, Fry RC, McKinnon A, Fry KL, Kelly JM, Verma PJ, Burden C, Salamone DF, Gambini A.Epigenetic perturbations during the reprogramming process have been described as the primary cause of the low efficiency of somatic cell nuclear transfer (SCNT). In this study, we tested three strategies targeting nuclear reprogramming to investigate effects on equine SCNT. First, we evaluated the effect of treating somatic cells with chetomin, a fungal secondary metabolite reported to inhibit the trimethylation on histone 3 lysine 9 (H3K9 me3). Second, caffeine was added to the culture medium during the enucleation of oocytes and before activation of reconstructed embryos as a protein phospha...
Olguin-Perglione C, Vissani MA, Alamos F, Tordoya MS, Barrandeguy M.Equine influenza is an important cause of respiratory disease of horses worldwide. The equine influenza virus (EIV) undergoes antigenic drift through the accumulation of amino acid substitutions in the viral proteins, which may lead to vaccine breakdown. Objective: To describe the epidemiological findings and the molecular characteristics of the EIV detected during the multifocal outbreak that occurred in Argentina between March and July 2018 and evidence a vaccine breakdown. Methods: Observational, descriptive study. Methods: Virus was detected in nasopharyngeal swabs using real-time reverse ...
Sutton G, Garvey M, Cullinane A, Jourdan M, Fortier C, Moreau P, Foursin M, Gryspeerdt A, Maisonnier V, Marcillaud-Pitel C, Legrand L, Paillot R....Equine herpesvirus 1 (EHV-1) is an Alphaherpesvirus infecting not only horses but also other equid and non-equid mammals. It can cause respiratory distress, stillbirth and neonatal death, abortion, and neurological disease. The different forms of disease induced by EHV-1 infection can have dramatic consequences on the equine industry, and thus the virus represents a great challenge for the equine and scientific community. This report describes the progress of a major EHV-1 outbreak that took place in Normandy in 2009, during which the three forms of disease were observed. A collection of EHV-1...
Bellone RR, Ocampo NR, Hughes SS, Le V, Arthur R, Finno CJ, Penedo MCT.Catastrophic fractures are among the most common cause of fatalities in racehorses. Several factors, including genetics, likely contribute to increased risk for fatal injuries. A variant in the procollagen-lysine, 2-oxoglutarate 5-dioxygenase1 gene (PLOD1 c.2032G>A) was shown to cause Warmblood fragile foal syndrome type 1 (WFFS), a fatal recessive defect of the connective tissue. Screening of multiple horse breeds identified the presence of the WFFS allele in the Thoroughbred. PLOD1 is involved in cross-linking of collagen fibrils and thus could potentially increase the risk of catastrophic b...
Walewska E, Wołodko K, Skarzynski D, Ferreira-Dias G, Galvão A.The regulation of corpus luteus (CL) luteolysis is a complex process involving a myriad of factors. Previously, we have shown the involvement of Nodal in functional luteolysis in mares. Presently, we ask the extent of which Nodal mediation of luteolysis is done through regulation of angioregression. We demonstrated the interaction between Nodal and hypoxia-inducible factor 1 α (HIF1α) and thrombospondin 1/thrombospondin receptor (TSP1/CD36) systems, could mediate angioregression during luteolysis. First, we demonstrated the inhibitory effect of Nodal on the vascular marker platelet/endotheli...
Raudsepp T, Finno CJ, Bellone RR, Petersen JL.The horse reference genome from the Thoroughbred mare Twilight has been available for a decade and, together with advances in genomics technologies, has led to unparalleled developments in equine genomics. At the core of this progress is the continuing improvement of the quality, contiguity and completeness of the reference genome, and its functional annotation. Recent achievements include the release of the next version of the reference genome (EquCab3.0) and generation of a reference sequence for the Y chromosome. Horse satellite-free centromeres provide unique models for mammalian centromer...
Comparini L, Podestà A, Russo C, Cecchi F."The Club Foot" (or "Mismatched Foot") is an acquired or congenital flexural deformity of the distal interphalangeal joint, caused by a shortening of the musculotendinous unit of the deep digital flexor tendon. The aim of this research was to detect the incidence of the disorder in Arabian Pureblood horses, attempting to understand its causes and to analyze a possible role of inbreeding in its expression. In this breed, in fact, the pathology is widespread because in the environment of origin, the rocky desert, a hard and almost goat's hoof is not disabling so the selection against this disord...
Kemper AM, Drnevich J, McCue ME, McCoy AM.Skeletogenesis is complex and incompletely understood. Derangement of this process likely underlies developmental skeletal pathologies. Examination of tissue-specific gene expression may help elucidate novel skeletal developmental pathways that could contribute to disease risk. Our aim was to identify and functionally annotate differentially expressed genes in equine neonatal and adult articular cartilage (AC) and subchondral bone (SCB). RNA was sequenced from healthy AC and SCB from the fetlock, hock, and stifle joints of 6 foals (≤4 weeks of age) and six adults (8-12 years of age). There w...
Greiser T, Sieme H, Martinsson G, Distl O.Objectives of the present study were to estimate genetic parameters for frozen-thawed semen traits of 271 fertile German Warmblood stallions and genetic correlations with raw semen quality traits. Semen samples were collected from stallions utilized for semen collection and artificial insemination (AI) on the Lower Saxon National Stud Celle and the North Rhine-Westphalian National Stud Warendorf. Semen quality variables were analyzed in 63,972 raw (gel-free volume, concentration, progressive motility, number of sperm) and 3681 frozen-thawed samples (motility, DNA fragmentation index (DFI), non...
Velie BD, Smith PM, Fjordbakk CT, Solé M, Jäderkvist Fegraeus K, Rosengren MK, Røed KH, Ihler CF, Lindgren G, Strand E.Dynamic laryngeal collapse (DLC) associated with poll flexion is the most common disorder of the upper respiratory tract (URT) in the Norwegian-Swedish Coldblooded Trotter (NSCT). The disorder, which has also been diagnosed in other breeds of trotters and gaited horses, appears to be related to anatomic phenotypes and only occurs during poll flexion when the horse is exercised 'on the bit'. Objective: Identify genomic regions associated with DLC in the NSCT by combining a rigorous phenotyping protocol with genomic data from a high-density equine genotyping array. Methods: Prospective case/cont...
Verkade ME, Back W, Birch HL.Throughout the ages, human subjects have selected horse breeds for their locomotor capacities. Concurrently, tissue properties may have diversified because of specific requirements of different disciplines. Objective: The aim of this study was to compare the biomechanical properties of tendons with different functions between equine breeds traditionally selected for racing or sport. Methods: This study used ex vivo tendons and compared the mechanical properties of the common digital extensor tendon (CDET) and superficial digital flexor tendon (SDFT) between racehorses (Thoroughbred [TB]) and s...
To evaluate the etiology of skeletal changes noted in equid vertebrae from a 19- century context near Belgrade, Serbia. A vertebral column consisting of 15 fused thoracic vertebrae (T2-T16), with right ribs fused to T4 and T5 and small remnants of ribs articulating with T4, T5 and T6 on the left side were accidentally recovered during industrial exploitation of sand. The specimen was subjected to morphological analysis and collagen fingerprinting by mass spectrometry for species identification. In order to determine the absolute temporal context, radiocarbon dating was employed. Pathological c...
Pechacek D, Hwangbo M, Moreland R, Liu M, Ramsey J. 4s is a Gram-negative bacterium found in the equine intestinal ecosystem alongside diverse other coliform bacteria and bacteriophages. This announcement describes the complete genome of the T7-like 4s podophage Penshu1. From its 39,263-bp genome, 54 protein-encoding genes and a 179-bp terminal repeat were predicted.
Greiser T, Sieme H, Martinsson G, Distl O.The objectives of the present study were to analyze systematic effects on semen quality traits from fresh and frozen-thawed semen collected in and outside season. A total of 4,681 reports on semen traits of 121 stallions representing Arabian, Thoroughbred, Quarter Horse and four warmblood breeds used for artificial insemination at the Lower Saxon National stud Celle were edited for analysis of gel-free volume, sperm concentration, total number of sperm and total number of motile sperm in fresh semen and in frozen-thawed semen progressive motility, DNA fragmentation index and non-viable sperm. ...
Pusterla N, Mapes S, Wilson WD.The objective of this study was to detect and characterise the biovar of equine herpesvirus type 1 (EHV-1) from submandibular lymph nodes (SMLNs) and trigeminal ganglia from 153 equids undergoing routine postmortem examination for various medical and surgical reasons. A combination of nucleic acid precipitation and preamplification steps was used to increase the analytical sensitivity of the analysis. The presence of latent EHV-1 was determined when tissue samples were PCR-positive for the glycoprotein B (gB) gene and the DNA polymerase (ORF 30) gene of EHV-1 in the absence of detectable late ...
Heidelberger M.Data accumulated over many years are brought together on cross-reactions of 46 among the more than 80 pneumococcal serological types, with the idea of correlating cross-reactions with the structures of the relevant type-specific capsular polysaccharides, insofar as these have been determined. The precipitin reaction was carried out with the polysaccharides and antibodies raised in horses, rabbits, and a mule. Quantitative values (micrograms of antibody nitrogen per milliliter of antiserum at 0 to 1 degree C) are given in many instances and discussed, together with arbitrary qualitative data, i...
Crichton RR, Millar JA, Cumming RL, Bryce CF.1. Ferritin was isolated from human and horse spleen and liver, and apoferritin prepared therefrom. 2. The electrophoretic mobilities of the four apoferritins were determined on polyacrylamide gels and on cellulose acetate strips, and all found to be equal. 3. Homologous ferritins share reactions of identity in immunodiffusion experiments, whereas heterologous ferritins show only partial identity. 4. The subunit molecular weight of each of the apoferritins was determined by polyacrylamide-gel electrophoresis in sodium dodecyl sulphate and by chromatography on agarose columns in 6m-guanidine-HC...
Knott LE, Fonseca-Martinez BA, O'Connor AM, Goodrich LR, McIlwraith CW, Colbath AC.To evaluate the use of mesenchymal stem cells (MSCs), autologous conditioned serum (ACS), platelet-rich plasma (PRP), and autologous protein solution (APS) for the treatment of equine musculoskeletal disease by diplomates of the American College of Veterinary Surgery (ACVS), and American College of Veterinary Sports Medicine and Rehabilitation (ACVSMR). Methods: Cross-sectional study. Methods: Diplomates (n = 423). Methods: An email link was sent to ACVS and ACVMR diplomates. A survey contained 59 questions regarding demographics, as well as indications, frequency, adverse effects, and limit...
Boucheikhchoukh M, Mechouk N, Benakhla A, Raoult D, Parola P.The sheep ked, Melophagus ovinus, and the forest fly, Hippobosca equina, are parasitic dipteran insects of veterinary importance. As hematophagous insects, they might be considered as potential vectors of diseases which may be transmissible to humans and animals. The purpose of this study was to present initial primary data about these two species in Algeria. To do so, we conducted a molecular survey to detect the presence of bacterial DNA in flies collected in Algeria. A total of 712 flies including, 683 Melophagus ovinus and 29 Hippobosca equina were collected from two regions in northeaster...
Gabner S, Ertl R, Velde K, Renner M, Jenner F, Egerbacher M, Hlavaty J.A combination of tissue engineering methods employing mesenchymal stem cells (MSCs) together with gene transfer takes advantage of innovative strategies and highlights a new approach for targeting osteoarthritis (OA) and other cartilage defects. Furthermore, the development of systems allowing tunable transgene expression as regulated by natural disease-induced substances is highly desirable. Bone marrow-derived equine MSCs were transduced with a lentiviral vector expressing interleukin-1 receptor antagonist (IL-1Ra) gene under the control of an inducible nuclear factor-kappa B-responsive prom...
Hashimoto-Hill S, Alenghat T.Domestic animals represent important resources for understanding shared mechanisms underlying complex natural diseases that arise due to both genetic and environmental factors. Intestinal inflammation, particularly inflammatory bowel disease (IBD), is a significant health challenge in humans and domestic animals. While the etiology of IBD is multifactorial, imbalance of symbiotic gut microbiota has been hypothesized to play a central role in disease pathophysiology. Advances in genomic sequencing and analytical pipelines have enabled researchers to decipher the composition of the intestinal mi...
Trapp S, von Einem J, Hofmann H, Köstler J, Wild J, Wagner R, Beer M, Osterrieder N.Key problems using viral vectors for vaccination and gene therapy are antivector immunity, low transduction efficiencies, acute toxicity, and limited capacity to package foreign genetic information. It could be demonstrated that animal and human cells were efficiently transduced with equine herpesvirus 1 (EHV-1) reconstituted from viral DNA maintained and manipulated in Escherichia coli. Between 13 and 23% of primary human CD3+, CD4+, CD8+, CD11b+, and CD19+ cells and more than 70% of CD4+ MT4 cells or various human tumor cell lines (MeWo, Huh7, HeLa, 293T, or H1299) could be transduced with o...
Passaniti A, Roth TF.Ferritin was purified from chicken liver by two different methods: gel filtration on controlled-pore glass beads, and immunoaffinity chromatography employing a chicken ferritin-specific monoclonal antibody that did not cross-react with horse spleen ferritin. This antibody recognizes intact ferritin and an oligomeric 240 kDa form of the molecule after protein transfer to nitrocellulose, but not the 22 kDa chicken ferritin subunit. Chicken liver ferritin purified by these methods exhibited reduced migration on non-denaturing polyacrylamide gels compared with horse spleen ferritin. These results ...
Inácio SV, Widmer G, de Brito RL, Zucatto AS, de Aquino MC, Oliveira BC, Nakamura AA, Neto LD, Carvalho JG, Gomes JF, Meireles MV, Bresciani KD.The present study focuses on Cryptosporidium infections of foals in Brazil. A total of 92 animals of different breeds from 11 farms in the vicinity of Araçatuba in the state of São Paulo, were examined. According to PCR targeting the 18S rRNA gene, Cryptosporidium sp. DNA was detected in 21.7% (20/92) of foals. Good quality 18S rRNA, actin, HSP70 and gp60 genes nPCR amplicons were obtained from five fecal samples. PCR amplification and sequencing of a fragment of the GP60 sporozoite surface glycoprotein gene revealed C. parvum genotypes IIaA18G3R1, IIaA15G2R1. Interestingly, we also detected...
Antczak DF, Bailey E, Barger B, Guerin G, Lazary S, McClure J, Mottironi VD, Symons R, Templeton J, Varewyck H.The Third International Workshop on Lymphocyte Alloantigens of the Horse was held on 25-27 April 1984 in Kennett Square, Pennsylvania. Twelve laboratories from five countries participated. The principal purpose of this Workshop was to determine the phenotypic and gene frequencies of the 10 equine lymphocyte antigens (ELA) and a non-ELA lymphocyte antigen, ELY-2.1, in several breeds of horse. A total of 86 alloantisera characterized in previous workshops were tested against lymphocytes from 1179 horses. In addition, several experimental antisera were also tested against the same panel of lympho...
Olguin-Perglione C, Vissani MA, Alamos F, Tordoya MS, Barrandeguy M.Equine influenza is an important cause of respiratory disease of horses worldwide. The equine influenza virus (EIV) undergoes antigenic drift through the accumulation of amino acid substitutions in the viral proteins, which may lead to vaccine breakdown. Objective: To describe the epidemiological findings and the molecular characteristics of the EIV detected during the multifocal outbreak that occurred in Argentina between March and July 2018 and evidence a vaccine breakdown. Methods: Observational, descriptive study. Methods: Virus was detected in nasopharyngeal swabs using real-time reverse ...
Silva MLCR, Auguste AJ, Terzian ACB, Vedovello D, Riet-Correa F, Macário VMK, Mourão MPG, Ullmann LS, Araújo JP, Weaver SC, Nogueira ML.Madariaga virus (MADV), the new species designation for the South American isolates of eastern equine encephalitis virus (EEEV), is genetically divergent and substantially different in ecology and pathogenesis from North American EEEV strains. We isolated and characterized a MADV isolate obtained from a horse in Brazil. Our results support previous phylogenetic studies showing there are three genetically distinct MADV lineages. The MADV isolate from Paraíba State belongs to the South American lineage III and is closely related to Peruvian, Colombian and Venezuelan isolates.
Liu Q, Meli ML, Zhang Y, Meili T, Stirn M, Riond B, Weibel B, Hofmann-Lehmann R.A reverse line blot (RLB) hybridization assay was adapted and applied for equine blood samples collected at the animal hospital of the University of Zurich to determine the presence of piroplasms in horses in Switzerland. A total of 100 equine blood samples were included in the study. The V4 hypervariable region of the 18S rRNA gene was amplified by polymerase chain reaction and analyzed using the RLB assay. Samples from seven horses hybridized to a Theileria/Babesia genus-specific and a Theileria genus-specific probe. Of these, two hybridized also to the Theileria equi-specific probe. The oth...
Blikslager AT, Yin C, Cochran AM, Wooten JG, Pettigrew A, Belknap JK.Recent reports indicate increased amounts of mRNA from inflammation-related genes in the prodromal stage of laminitis. Objective: Cyclooxygenase-1 (COX-1) and cyclooxygenase-2 (COX-2) undergo distinct patterns of expression in equine laminae in the developmental stage (DEV) and acute clinical stage (LAM) of laminitis. Methods: Horses selected from an outbred population were placed into 1 of 4 groups: DEV (n = 5), CON-3h (control group for DEV, n = 5), LAM (n = 5) and CON-10h (control group for LAM, n = 5). Methods: Laminar and skin samples were obtained from (1) animals either undergoing leuko...
Waters M, Raju D, Garmory HS, Popoff MR, Sarker MR.Recent epidemiological studies suggested that cpb2-positive Clostridium perfringens isolates are associated with gastrointestinal (GI) diseases in horses. These putative relationships, indicated by PCR genotyping, were tested in the present study by further genotyping and phenotyping of 23 cpb2-positive C. perfringens isolates from horses with GI disease (referred to hereafter as horse GI disease isolates). Our beta2-toxin (CPB2) Western blot analyses demonstrated that all of the tested isolates were unable to produce detectable levels of CPB2. However, Southern blot and nucleotide sequencing ...
Gérard N, Delpuech T, Oxvig C, Overgaard MT, Monget P.In the ovary of mammalian species, terminal follicular growth is accompanied by a decrease in intrafollicular levels of IGF-binding protein-2 (IGFBP-2) and IGFBP-4. The decrease in IGFBP-4 levels is essentially due to an increase in proteolytic cleavage by intrafollicular pregnancy-associated plasma protein-A (PAPP-A) in growing healthy follicles. The decrease in IGFBP-2 levels is partly due to a decrease in mRNA expression by follicular cells. In addition, we have recently shown that IGFBP-2 is also proteolytically cleaved by PAPP-A in bovine and porcine growing follicles. In the present work...
Sheats MK, Davis KU, Poole JA.Farmers are routinely exposed to organic dusts and aeroallergens that can have adverse respiratory health effects including asthma. Horses are farm-reared large animals with similar exposures and can develop equine asthma syndrome (EAS). This review aims to compare the etiology, pathophysiology, and immunology of asthma in horses compared to farmers and highlights the horse as a potential translational animal model for organic dust-induced asthma in humans. Severe EAS shares many clinical and pathological features with various phenotypes of human asthma including allergic, non-allergic, late o...
García BM, Moran AM, Fernández LG, Ferrusola CO, Rodriguez AM, Bolaños JM, da Silva CM, Martínez HR, Tapia JA, Peña FJ.Cryopreservation introduces extreme temperature and osmolality changes that impart lethal and sublethal effects on spermatozoa. Additionally, there is evidence that the osmotic stress induced by cryopreservation causes oxidative stress to spermatozoa. The main sources of reactive oxygen species in mammalian sperm are the mitochondria. In view of this, the aim of our study was to test whether or not osmotic stress was able to induce mitochondrial damage and to explore the osmotic tolerance of the mitochondria of stallion spermatozoa. Ejaculates from 7 stallions were subjected to osmolalities ra...
Favaro PF, Fernandes WR, Reischak D, Brandão PE, Silva SOS, Richtzenhain LJ.Equine influenza is one of the major respiratory infectious diseases in horses. An equine influenza virus outbreak was identified in vaccinated and unvaccinated horses in a veterinary school hospital in São Paulo, SP, Brazil, in September 2015. The twelve equine influenza viruses isolated belonged to Florida Clade 1. The hemagglutinin and neuraminidase amino acid sequences were compared with the recent isolates from North and South America and the World Organisation for Animal Health recommended Florida Clade 1 vaccine strain. The hemagglutinin amino acid sequences had nine substitutions, com...
Abe N, Matsubara K.The Cryptosporidium horse genotype, a zoonotic protozoan parasite first found in a Prezewalski wild horse, has not been found in any other mammal but calves, horses, and humans. Hedgehogs, popular exotic pet animals in Japan, are a reservoir of two zoonotic Cryptosporidum: C. parvum and C. erinacei (previously known as the hedgehog genotype). Recently, after finding Cryptosporidium infection in a four-toed hedgehog (Atelerix albiventris), we identified the isolate genetically as the Cryptosporidium horse genotype. Its subtype (VIbA13) was the same as that of an isolate from a pet shop employee...
Santos DW, Madeira de Carvalho LM, Molento MB.Cyathostomins comprise around 50 parasite species of equids, offering a great challenge regarding their individual identification. The objective of our work was to improve identification of infective third stage larvae (L3) with a morphological key supplemented with detailed scientific illustrations based on our research and available literature. The highlighted features were; the number, arrangement, and shape of intestinal cells (IC), general features and the total body length of the eight different Cyathostomin sensu latum types (Type A, B, C, D, E, F, G, H), Gyalocephalus capitatus, and Po...
Hemphill DD, McIlwraith CW, Samulski RJ, Goodrich LR.Adeno-associated virus (AAV) receptors range from heparan sulfate proteoglycan to sialic acid moieties present on cell surfaces. Abundance of the glycan profiles is greatly influenced by animal species, cell type, and culture conditions. The objective of this study was to determine whether AAV serotypes' transduction efficiencies specifically in the equine monolayer culture model are an accurate representation of transduction efficiencies in tissue explants, a model more closely related to in vivo transduction. It was found that AAV 2 and 2.5 transduced cells more efficiently in explants than ...
The Journal of heredityMay 1, 1984
Volume 75, Issue 3 220-224 doi: 10.1093/oxfordjournals.jhered.a109916
Cothran EG, MacCluer JW, Weitkamp LR, Pfennig DW, Boyce AJ.The relationship between inbreeding and both conception and foaling rates in Standardbred horses (trotters and pacers) was examined for 1194 breeding years. There was a statistically significant (P less than 0.05) trend for conception and foaling rates to decrease with increased inbreeding; however, this relationship accounted for less than 2 percent of the variation. Additionally, the relationship between reproductive performance and inbreeding was not consistent between trotters and pacers. For trotters (F = 0.103) there was a trend for an increase in conception and foaling rates with increa...