"Horses" is a broad topic that encompasses various aspects of equine biology, behavior, and management. This category includes studies on the anatomy, physiology, and genetics of horses, as well as their behavior, nutrition, and care. Research in this area may also cover the historical and cultural significance of horses, their roles in agriculture, sport, and therapy, and the challenges associated with their conservation and welfare. The page aggregates peer-reviewed research articles and scholarly studies that explore the multifaceted relationships between humans and horses, examining both scientific and socio-economic perspectives.
Krohn J, Ennen S, Hospes R et al. Use of a cervical stent for long-term treatment of pyometra in the mare: A report of three cases. Reprod Dom Anim 2019; 55: 1155–1159 DIE PYOMETRA DER STUTE IST EIN CHRONISCHER ENTZüNDUNGSZUSTAND DES ENDOMETRIUMS, DER HäUFIG MIT DER AKKUMULATION GROßER MENGEN AN SEKRET EINHERGEHT. PRäDISPONIERT SIND STUTEN MIT VERäNDERUNGEN DER ZERVIX, DURCH DIE DIE UTERINE CLEARANCE BEEINTRäCHTIGT WIRD. DIE HäUFIG UNSPEZIFISCHEN SYMPTOME UMFASSEN LEISTUNGSMANGEL, KONDITIONSVERLUST, SUBFEBRILE TEMPERATUR ODER KOLIKARTIGE SCHMERZEN. MANCHE TIERE PRäSENTIEREN SICH SYMP...
Hesselkilde EZ, Carstensen H, Flethøj M, Fenner M, Kruse DD, Sattler SM, Tfelt-Hansen J, Pehrson S, Braunstein TH, Carlson J, Platonov PG....Large animal models are important in atrial fibrillation (AF) research, as they can be used to study the pathophysiology of AF and new therapeutic approaches. Unlike other animal models, horses spontaneously develop AF and could therefore serve as a bona fide model in AF research. We therefore aimed to study the electrical, functional and structural remodelling caused by chronic AF in a horse model. Nine female horses were included in the study, with six horses tachypaced into self-sustained AF and three that served as a time-matched sham-operated control group. Acceleration in atrial fibrilla...
Beste KJ, Ortved KF, Rossignol F, Ducharme NG.To describe the use of a silicone-covered laser guide and diode laser for surgical correction of epiglottic entrapment and report postoperative outcomes in horses with epiglottic entrapment. Methods: Retrospective case series. Methods: Thoroughbred and standardbred racehorses (n = 29) with epiglottic entrapment. Methods: A silicone-covered laser guide was placed endoscopically to direct the diode laser cutting action during transection of the entrapping subepiglottic membrane and to act as a physical barrier between the membrane and the epiglottic cartilage. Postoperative complications and tra...
Kellon EM, Gustafson KM.Hyperinsulinemia associated with equine metabolic syndrome and pituitary pars intermedia dysfunction is a risk factor for laminitis. Research in other species has shown elevated body iron levels as both a predictor and consequence of insulin resistance. In humans, this is known as dysmetabolic hyperferritinemia. To explore the relationship between equine hyperinsulinemia and body iron levels. We reviewed case histories and laboratory results from an open access database maintained by the Equine Cushing's and Insulin Resistance Group Inc. (ECIR). We identified 33 horses with confirmed hyperinsu...
Pinna AE, Okada CTC, Ferreira CSC et al. Double ovarian tumor in the mare: case report. Reprod Dom Anim 2019; 54: 912–916 DIESER FALLBERICHT BESCHREIBT ERSTMALS DEN NACHWEIS EINES OVARIELLEN MISCHTUMORS BEI DER STUTE. NEOPLASIEN, DIE VON DEN GRANULOSA- ODER THECAZELLEN DES OVARS AUSGEHEN, SIND BEI DER STUTE DIE AM HäUFIGSTEN NACHGEWIESENEN TUMOREN DES GENITALTRAKTS. ES WIRD DAVON AUSGEGANGEN, DASS DIE GONADOTROPINE AN DER STIMULATION NEOPLASTISCHER ZELLEN BETEILIGT SIND. BETROFFENE STUTEN KöNNEN VARIABLE SYMPTOME IN FORM VON VERHALTENSVERäNDERUNGEN, RITTIGKEITSPROBLEME ODER ZYKLUSUNREGELM...
Gonzalez ML, Jacobs RD, Ely KM, Johnson SE.Postexercise skeletal muscle repair is dependent on the actions of satellite cells (SCs). The signal(s) responsible for activation of these normally quiescent cells in the horse remain unknown. The objective of the experiment was to determine whether submaximal exercise or tributyrin (TB) supplementation is sufficient to stimulate SC activation. Adult geldings were fed a control diet (n = 6) or a diet containing 0.45% TB (n = 6). After 30 d, the geldings performed a single bout of submaximal exercise. Middle gluteal muscle biopsies and blood were collected on days -1, 1, 3, and 5 relative to e...
Knight PK.This study analysed the race day veterinary reports from harness racing meetings controlled by the New South Wales Greyhound and Harness Racing Regulatory Authority between 1 September 2008 and 30 June 2009. The findings of all prerace and postrace examinations were analysed, and the frequency of observations was recorded. Chi-square testing was used to determine whether the incidence of abnormalities differed between age groups and tracks. A total of 542 meetings were conducted during the period of the study, with veterinary examinations conducted at 395 of these meetings. A total of 520 vete...
Denham J.Telomeres are genetically conserved nucleoprotein complexes located at the ends of chromosomes that preserve genomic stability. In large mammals, somatic cell telomeres shorten with age, owing to the end replication problem and lack of telomere-lengthening events (e.g. telomerase and ALT activity). Therefore, telomere length reflects cellular replicative reserve and mitotic potential. Environmental insults can accelerate telomere attrition in response to cell division and DNA damage. As such, telomere shortening is considered one of the major hallmarks of ageing. Much effort has been dedicate...
Elzinga SE, Betancourt A, Stewart JC, Altman MH, Barker VD, Muholland M, Bailey S, Brennan KM, Adams AA.Much of the equine population is obese and therefore predisposed to the development of additional health concerns such as equine metabolic syndrome (EMS). However, pharmacologic treatments for EMS are limited. Omega-3 fatty acid supplementation is a therapeutic strategy in humans with metabolic dysfunction that improves insulin sensitivity and reduces inflammation, but the effects of omega-3 fatty acid supplementation in horses with EMS are unclear. Therefore, in this pilot study, 10 mixed-sex and mixed-breed horses with EMS were fed a docosahexaenoic acid (DHA)-rich microalgae containing 16 ...
Gehlen H, Loschelder J, Walther M.Euthanasia represents a procedure with high responsibility for veterinarians in equine practice. The procedure should avoid pain and suffering for the horse and be carried out with the least possible stress for the patient and its owner. The presented study investigated the emotional impact of a horse's euthanasia procedure on the owner in order to enable development of future recommendations in improving the management of this procedure in horses. Methods: Questionnaires concerning euthanasia of a horse for horse owners and veterinarians, respectively were developed and sent by mail or publis...
The Journal of heredityOctober 20, 2019
Volume 110, Issue 7 769-781 doi: 10.1093/jhered/esz032
Han H, Bryan K, Shiraigol W, Bai D, Zhao Y, Bao W, Yang S, Zhang W, MacHugh DE, Dugarjaviin M, Hill EW.The Mongolian horse is one of the oldest extant horse populations and although domesticated, most animals are free-ranging and experience minimal human intervention. As an ancient population originating in one of the key domestication centers, the Mongolian horse may play a key role in understanding the origins and recent evolutionary history of horses. Here we describe an analysis of high-density genome-wide single-nucleotide polymorphism (SNP) data in 40 globally dispersed horse populations (n = 895). In particular, we have focused on new results from Chinese Mongolian horses (n = 100) that ...
Li X, Ni HB, Ren WX, Jiang J, Gong QL, Zhang XX.Toxoplasmosis, one of the most common zoonoses worldwide, is caused by Toxoplasma gondii. T. gondii can infect almost all warm-blooded animals, including humans. Horses are an intermediate host of T. gondii, representing a potential risk for humans. To determine the T. gondii seroprevalence in horses worldwide, a global meta-analysis was conducted. A total of 35 publications were obtained by searching the PubMed, ScienceDirect, Chinese Web of knowledge (CNKI) and Wanfang databases. A total of 12,354 horses were assessed, of which 1580 were positive for T. gondii. The pooled overall seroprevale...
Meister TL, Tegtmeyer B, Brüggemann Y, Sieme H, Feige K, Todt D, Stang A, Cavalleri JV, Steinmann E.An equine parvovirus-hepatitis (EqPV-H) has been recently identified in association with equine serum hepatitis, also known as Theiler's disease. The disease was first described by Arnold Theiler in 1918 and is often observed with parenteral use of blood products in equines. However, natural ways of viral circulation and potential risk factors for transmission still remain unknown. In this study, we investigated the occurrence of EqPV-H infections in Thoroughbred horses in northern and western Germany and aimed to identify potential risk factors associated with viral infections. A total of 392...
Girardi FM, da Fonseca LA, Ribeiro Filho JD, Souto PC, Ferreira DAC, Dornelas LRSM, Bento LD, de Carvalho Filho WP.Obesity in human and veterinary medicine is one of the most complex challenges within emerging diseases in the context of health. The problem of obesity in horses results in severe comorbidities; therefore, acute-phase proteins should be investigated for fluctuations increasing or decreasing by at least 25% in response to inflammation; these are candidates for future biomarkers and might provide new perspectives on early diagnosis and prognosis. Serum samples were analyzed in nine healthy animals (C) and nine obese animals (O). The proteins were separated by sodium dodecyl sulfate-polyacrylami...
Marycz K, Szłapka-Kosarzewska J, Geburek F, Kornicka-Garbowska K.Equine metabolic syndrome (EMS) is characterized by adiposity, insulin dysregulation and increased risk for laminitis. Increased levels of specific liver enzymes in the peripheral blood are typical findings in horses diagnosed with EMS. Current management of EMS is based on caloric restriction and increased physical activity. However, new potential treatment options are arising such as the transplantation of autologous adipose stem cells (ASC). However, cytophysiological properties of ASC derived from EMS horses are impaired which strongly limits their therapeutic potential. We hypothesized, t...
Klohonatz KM, Coleman SJ, Cameron AD, Hess AM, Reed KJ, Canovas A, Medrano JF, Islas-Trejo AD, Kalbfleisch T, Bouma GJ, Bruemmer JE.Maternal recognition of pregnancy (MRP) in the mare is not well defined. In a non-pregnant mare, prostaglandin F (PGF) is released on day 14 post-ovulation (PO) to cause luteal regression, resulting in loss of progesterone production. Equine MRP occurs prior to day 14 to halt PGF production. Studies have failed to identify a gene candidate for MRP, so attention has turned to small, non-coding RNAs. The objective of this study was to evaluate small RNA (<200 nucleotides) content in endometrium during MRP. Mares were used in a cross-over design with each having a pregnant and non-mated cycle. Ea...
Knödlseder JM, Fell SF, Straubinger RK.A total of 143 horses were included in a study to test a commercial vaccine against Lyme borreliosis. The vaccine contained three different antigens (outer surface protein A, OspA) to prevent the infection with spirochetes - B.burgdorferi sensu stricto, B. afzelii and B. garinii. Horses in Group A (49 animals) received two vaccinations on days 0 and 14 and a booster on day 365, whereas 50 horses in Group B received an additional booster vaccination on day 180. Group C (44 animals) was not immunized. Total antibody levels and specific OspA antibody responses were assessed quantitatively and qua...
Aurich C, Müller-Herbst S, Reineking W, Müller E, Wohlsein P, Gunreben B, Aurich J.Warmblood fragile foal syndrome (WFFS) is a monogenetic defect with autosomal recessive inheritance. The WFFS homozygosity is non-compatible with extra-uterine life. Although as many as 15% of Warmblood horses are WFFS carriers, there has been little veterinary focus on this condition. The aim of this study was to determine outcomes and symptoms of clinical signs and pathological abnormalities during pregnancies when there were WFFS homozygous foetuses. Diagnostic material of 15 abortion or stillbirth cases with suspected diagnosis of WFFS was available for this study. Additionally, there were...
Fitzgerald DM, Pollitt CC, Walsh DM, Sillence MN, de Laat MA.The oral glucose test (OGT) is a useful tool for diagnosing insulin dysregulation (ID) and is somewhat repeatable in ponies under consistent management. This study aimed to determine whether the insulin and incretin responses to an OGT in ponies differed after short-term access to fertilised pasture, compared to unfertilised pasture, by using a randomised, repeated measures study design. Sixteen mixed-breed ponies were classified as severely insulin-dysregulated (SD; post-prandial insulin ≥80 μIU/mL) or not severely insulin-dysregulated (NSD; post-prandial insulin < 80 μIU/mL) using an O...
Leschke DH, Muir GS, Hodgson JK, Coyle M, Horn R, Bertin FR.Diseases associated with insulin dysregulation (ID), such as equine metabolic syndrome and pituitary pars intermedia dysfunction, are of interest to practitioners because of their association with laminitis. Accurate insulin concentration assessment is critical in diagnosing and managing these diseases. Objective: To determine the effect of time, temperature, and collection tube type on insulin concentrations in horses at risk of ID. Methods: Eight adult horses with body condition score >6/9. Methods: In this prospective study, subjects underwent an infeed oral glucose test 2 hours before...
Rivas VN, Aleman M, Peterson JA, Dahlgren AR, Hales EN, Finno CJ.Juvenile idiopathic epilepsy (JIE) is an inherited disease characterized by recurrent seizures during the first year of life in Egyptian Arabian horses. Definitive diagnosis requires an electroencephalogram (EEG) performed by a veterinary specialist. A recent study has suggested that a 19 base-pair deletion, along with a triple-C insertion, in intron five of twelve (∆19InsCCC; chr20:29542397-29542425: GTTCAGGGGACCACATGGCTCTCTATAGA>TATCTTAAGACCC) of the () gene is associated with JIE. To confirm this association, a new sample set consisting of nine EEG-phenotyped affected and nine unaffec...
Isgren CM, Salem SE, Singer ER, Wylie CE, Lipreri G, Graham RJTY, Bladon B, Boswell JC, Fiske-Jackson AR, Mair TS, Rubio-Martínez LM.Previous studies investigating factors associated with survival following endoscopic treatment of contamination/sepsis of the calcaneal bursa are limited. Objective: To investigate the factors associated with survival in horses with contamination/sepsis of the calcaneal bursae treated endoscopically and to describe the bacterial isolates involved in the synovial infections. Methods: Retrospective analysis of clinical records. Methods: Medical records from 128 horses with contamination/sepsis of the calcaneal bursae treated by endoscopic lavage at seven equine hospitals were reviewed. A follow-...
Kydd JH, Hannant D, Robinson RS, Bryant N, Osterrieder N.Equid herpesvirus-1 (EHV-1) causes respiratory and neurological disease and late gestation abortion in pregnant mares. Current vaccines contain either inactivated or live EHV-1, but fail to provide complete clinical or virological protection, namely prevention of nasopharyngeal shedding and cell-associated viraemia. Thus, the development of novel products, such as modified live virus (MLV) vaccines which stimulate virus-specific, humoral and cell mediated immune responses more effectively remains a priority. Two groups of weaned foals (n = 6 each group) were used in a longitudinal, prospec...
Chen JW, Stefanovski D, Haughan J, Jiang Z, Boston R, Soma LR, Robinson MA.Extracorporeal shockwave therapy (ESWT) can potentially mask painful injuries in equine athletes. Tests to detect whether a horse has received ESWT prior to competition are needed. Extracorporeal shockwave therapy is known to affect inflammatory mediators in other species, and if these mediators are altered in the horse, these could serve as biomarkers of ESWT. Objective: To test the hypothesis that a single application of ESWT will alter the circulating protein concentrations of 10 inflammatory mediators in horse plasma. Methods: Prospective repeated measures experimental study. Methods: Elev...
Orellana-Guerrero D, Renaudin C, Edwards L, Rose E, Aleman M, Moore PF, Dujovne G.Placentitis has been reported as the most important cause of equine abortions, stillbirths, and perinatal deaths in horses. Most cases are caused by bacteria and less commonly by fungal elements. The aim of this report is to describe the clinical presentation of a fungal placentitis caused by Aspergillus terrerus. A 5-year-old thoroughbred maiden mare at the 217th day of gestation presented with some classic signs of placentitis (premature udder development and milk dripping). All ultrasonographic findings were consistent with a live fetus and a severe placentitis. On vaginal examination, pur...
Yao C.The kinetoplastid protozoan Leishmania spp. cause leishmaniasis, which clinically exhibit mainly as a cutaneous, mucocutanous or visceral form depending upon the parasite species in humans. The disease is widespread geographically, leading to 20 000 annual deaths. Here, leishmaniases in both humans and animals, reservoirs and sand fly vectors on the Caribbean islands are reviewed. Autochthonous human infections by Leishmania spp. were found in the Dominican Republic, Guadeloupe and Martinique as well as Trinidad and Tobago; canine infections were found in St. Kitts and Grenada; and equine infe...
Álvarez-Narváez S, Giguère S, Anastasi E, Hearn J, Scortti M, Vázquez-Boland JA.Antibiotic use has been linked to changes in the population structure of human pathogens and the clonal expansion of multidrug-resistant (MDR) strains among healthcare- and community-acquired infections. Here we present a compelling example in a veterinary pathogen, , the causative agent of a severe pulmonary infection affecting foals worldwide. We show that the (46) gene responsible for emerging macrolide resistance among equine isolates in the United States is part of a 6.9-kb transposable element, Tn, actively mobilized by an IS family transposase. Tn is carried on an 87-kb conjugative pla...
Fernandes CB, Ball BA, Loux SC, Boakari YL, Scoggin KE, El-Sheikh Ali H, Cogliati B, Esteller-Vico A.Anatomical and molecular changes in the cervical barrier in women are a fundamental part of the pathogenesis of pregnancy loss associated with chorioamnionitis. However, there is little information regarding changes in the cervix associated with ascending infection in pregnant mares. To better characterize morphological and molecular changes in the cervix during placentitis, we examined full thickness histology and mRNA expression for a number of inflammatory and endocrine factors in the mucosa and stroma of the cervix of mares (n = 5) after experimental induction of placentitis via transc...
Nemoto M, Schofield W, Cullinane A.The objective of this study was to investigate the presence of equine coronavirus (ECoV) in clinical samples submitted to a diagnostic laboratory in Ireland. A total of 424 clinical samples were examined from equids with enteric disease in 24 Irish counties between 2011 and 2015. A real-time reverse transcription polymerase chain reaction was used to detect ECoV RNA. Nucleocapsid, spike and the region from the p4.7 to p12.7 genes of positive samples were sequenced, and sequence and phylogenetic analyses were conducted. Five samples (1.2%) collected in 2011 and 2013 tested positive for ECoV. Po...
Altan E, Li Y, Sabino-Santos G, Sawaswong V, Barnum S, Pusterla N, Deng X, Delwart E.Metagenomics was used to identify viral sequences in the plasma and CSF (cerobrospinal fluid) of 13 horses with unexplained neurological signs and in the plasma and respiratory swabs of 14 horses with unexplained respiratory signs. Equine hepacivirus and two copiparvoviruses (horse parvovirus-CSF and a novel parvovirus) were detected in plasma from neurological cases. Plasma from horses with respiratory signs contained the same two copiparvoviruses plus equine pegivirus D and respiratory swabs contained equine herpes virus 2 and 5. Based on genetic distances the novel copiparvovirus qualified ...
Vallance SA, Case JT, Entwistle RC, Kinde H, Barr BC, Moore J, Anderson ML, Arthur RM, Stover SM.To determine if scapular fractures occur in racehorses with distinctive characteristics. Objective: To test the hypothesis that Thoroughbred (TB) and Quarter Horse (QH) racehorses with a scapular fracture have similar characteristics that are different from those of their respective racetrack populations. Methods: Necropsy findings, case details, last race information and career earnings for TB and QH racehorses that had a scapular fracture in California between 1990 and 2008 were retrospectively compared between breeds. Horse signalment, career earnings, career starts and race characteristics...
Liepman RS, Dembek KA, Slovis NM, Reed SM, Toribio RE.Serum immunoglobulin (IgG) assessment in neonatal foals is considered standard care in equine hospitals to determine immunity and overall health. However, cut-off values of IgG to predict complete or partial failure of transfer of passive immunity (FTPI) were developed 30 years ago and are largely empirical with little prospective or statistical data to support their use or association with outcome. Objective: To critically evaluate the traditional cut-off values of IgG in the assessment of FTPI (IgG 8 g/l as adequate transfer of passive immunity (ATPI). Odds of nonsurvival increased in propo...
Couëtil LL, Rosenthal FS, Simpson CM.The purpose of this study was to assess whether our method of inducing forced expiration detects small airway obstruction in horses. Parameters derived from forced expiratory flow-volume (FEFV) curves were compared with lung mechanics data obtained during spontaneous breathing in nine healthy horses, in three after histamine challenge, and in two with chronic obstructive pulmonary disease (COPD) pre- and posttherapy with prednisone. Parameters measured in the healthy horses included forced vital capacity (FVC = 41.6 +/- 5.8 liters; means +/- SD) and forced expiratory flow (FEF) at various perc...
Verheyen T, Decloedt A, De Clercq D, van Loon G.Atypical myopathy (AM) is an acute, fatal rhabdomyolysis in grazing horses that mainly affects skeletal muscles. Postmortem examinations have shown that myocardial damage also occurs. Limited information is available on the effect of AM on cardiac function in affected and surviving horses. Objective: To describe electrocardiographic and echocardiographic changes associated with AM in the acute stage of the disease and after follow-up. Methods: Horses (n = 12) diagnosed with AM in which cardiac ultrasound examination and ECG recording were available. Methods: All horses underwent clinical exami...
Rush BR, Raub ES, Thomsen MM, Davis EG, Matson CJ, Hakala JE.To evaluate clinical response, pulmonary function, and adrenal gland response to incremental doses of beclomethasone dipropionate in horses with recurrent airway obstruction. Methods: Crossover trial. Methods: 8 horses with recurrent airway obstruction. Methods: Horses randomly assigned to 4 groups were treated twice daily via aerosol administration of placebo or 500, 1,000, or 1,500 micrograms of beclomethasone dipropionate in a crossover design with a 10-day minimum washout period. Subjective assessment of airway obstruction, serum cortisol concentration, and maximum change in pleural pressu...
Padalino B, Rogers CW, Guiver D, Bridges JP, Riley CB.Transport-related problem behaviors (TRPBs) are common in horses and can cause injury to both the horses and their handlers. This study aimed to identify possible risk factors for TRPBs to inform approaches to mitigate TRPBs incidence and enhance horse welfare. An online cross-sectional survey was conducted to explore the prevalence of TRPBs and their association with human-, training- and transport management-related factors in New Zealand. The survey generated 1124 valid responses that were analyzed using descriptive statistics, and logistic regression analyses. Having at least one horse wit...
Faleiros RR, Johnson PJ, Nuovo GJ, Messer NT, Black SJ, Belknap JK.While there is evidence of laminar leukocyte infiltration in black walnut extract (BWE)-induced laminitis, there is no such evidence for carbohydrate overload (CHO) laminitis. Objective: To assess presence of leukocytes and signs of epidermal stress/injury in the laminar tissue from horses with CHO-induced laminitis. Methods: Twenty-four adult horses. Methods: Immunohistochemistry for myeloid cell markers calprotectin (CP) and monocyte-specific marker (CD163) was performed on laminar sections obtained from 2 groups of horses in the CHO model: the developmental time point (DTP) group (n = 6) an...
Layman QD, Rezabek GB, Ramachandran A, Love BC, Confer AW.Several Actinobacillus spp. are common commensal bacteria of the oral cavity, gastrointestinal tract, and reproductive tract of horses and can cause disease in both foals and adults. The current retrospective study was designed to review Actinobacillus spp. isolated from clinical samples or necropsies of 99 horses during 1999-2011. The cases consisted of 43 foals (2 years of age), 2 aborted fetuses, and 11 with unspecified ages. Clinical history, signs, bacterial species isolated, and associated lesions were documented. Actinobacillus spp. were isolated 111 times. The most common isolates were...
Fazio F, Gugliandolo E, Nava V, Piccione G, Giannetto C, Licata P.The objective of this study was to evaluate the levels and the potential bioaccumulation of vanadium (V), chromium (Cr), cobalt (Co), copper (Cu), zinc (Zn), cadmium (Cd), lead (Pb), and bismuth (Bi) in horses from the industrial risk area of Sicily (Italy). Different biological substrates (whole blood, serum; tail and mane) and samples of hay, concentrate and water provided to the horses were processed by means of Thermo Scientific iCAP-Q ICP-MS spectrometer for mineral concentration. One-way analysis of variance (ANOVA) was applied to show the differences in various trace elements in the bio...
Rogers CW, Firth EC, McIlwraith CW, Barneveld A, Goodship AE, Kawcak CE, Smith RK, van Weeren PR.No data exist on the effects of conditioning exercise at foal age on workload and subsequent clinical injury rate during their 2- and 3-year-old racing careers. Objective: To investigate the effects of subjecting TB foals to conditioning exercise prior to the start of race training on: the workload required to reach a level of fitness sufficient to compete; and the prevalence of orthopaedic injury during the first 2 seasons of their racing careers. Methods: Twenty 18-month-old TBs, 12 subjected to conditioning exercise at foal age (CONDEX) and 8 exercised spontaneously at pasture only (PASTEX)...
Jaworska J, Janowski T.Retained fetal membranes (RFM) is a prevalent postpartum disease in mares. During parturition, various proinflammatory cytokines are released in the placenta, which further facilitates uterine contractions, expulsion of the fetus and fetal membranes. We hypothesized that an altered inflammatory response in mares results in retained fetal membranes. Samples of the endometrium and the allantochorion were collected from 15 mares with RFM and from 29 control mares within 2 h of foal delivery. Next, the mRNA expression of IL-1β, IL-6 and TNFα proteins was analyzed by Real Time PCR and Western b...
Weishaupt MA, Waldern NM, Amport C, Ramseier LC, Wiestner T.To enhance expressiveness of forelimb movement and improve the four-beat rhythm of the tölt, Icelandic horses are commonly ridden with excessively high and long hooves. The aim of this study was to objectively assess the effect of shoeing on intra- and inter-limb coordination and limb movement consistency (inter-stride variability) at walk, tölt and trot. Thirteen sound and fit Icelandic horses accustomed to exercise with a rider on a treadmill were assessed with long and high hooves commonly used for competition (S(H)) and with the hooves trimmed according to the standards of normal shoeing...
Duru S.The aim of this study was to evaluate genetic variability in the Turkish Arab horse population using pedigree information. This study is the first detailed pedigree analysis of the breed in Turkey. Pedigree data were collected from the National Studbook. The pedigree data for 23 668 horses, born between 1904 and 2014, were used in the analysis. From this data set, a reference population (RP) of 14 838 animals symbolising the last generation was defined. Demographic parameters, the inbreeding level (F), the average relatedness (AR), the effective population size (N e), the effective number of f...
Trumble TN, Brown MP, Merritt KA, Billinghurst RC.Validate use of a commercially available immunoassay for measurement of bone alkaline phosphatase (BAP) in equine serum and synovial fluid (SF), and investigate the effects of osteochondral (OC) injury in horses on BAP concentrations in serum and SF. Methods: SF was collected from 37 joints of 34 Thoroughbred (TB) racehorses undergoing arthroscopic surgery for the removal of OC fragments from either the carpal joints (n=18) or the metacarpo-/metatarsophalangeal (MP) joints (n=19). SF was also obtained from 52 joints of 16 normal TB horses, collected bilaterally from carpal joints of 10 horses ...
Patton JF, Balasuriya UB, Hedges JF, Schweidler TM, Hullinger PJ, MacLachlan NJ.An avirulent, novel variant of equine arteritis virus (EAV; CA95G) was isolated from the semen of a persistently infected Standardbred stallion. The CA95G virus caused subclinical infection and seroconversion in susceptible horses, and virus was isolated only once from blood and nasal secretions collected from 6 experimentally infected horses. Sequence analysis of genes encoding the known EAV structural proteins shows that this highly attenuated strain of EAV is genetically similar to virulent field strains of EAV and, in particular, to a strain of EAV that was isolated during an outbreak of e...
Sides RH, Kirkpatrick R, Renner E, Gough K, Katz LM, Evans DL, Bayly WM.The need for a horse to be ridden while wearing a measurement device that allows unrestricted ventilation and gas exchange has hampered accurate measurement of its maximal oxygen consumption (V̇O max) under field conditions. Objective: Design and validate a facemask with the potential to measure V̇O max accurately in the field. Methods: Experiment with 6 × 6 Latin square design. Methods: Two variations of a mask and associated electronic control module (ECM) were designed to enable breath-by-breath measurement of airflows through two 7.8 cm diameter pneumotachometers located 7.5 cm in front...
Cohen ND, Slovis NM, Giguère S, Baker S, Chaffin MK, Bernstein LR.Macrolide-resistant isolates of Rhodococcus equi are emerging, prompting the search for clinically effective alternative antimicrobials. Objective: The proportion of foals with ultrasonographic evidence of pneumonia presumed to be caused by R. equi that had a successful outcome when administered gallium maltolate (GaM) PO would not be more than 10% inferior (ie, lower) than that of foals receiving standard treatment. Methods: Fifty-four foals with subclinical pulmonary abscesses among 509 foals at 6 breeding farms in Kentucky. Methods: Controlled, randomized, prospective noninferiority study. ...
Maeda Y, Oikawa MA.Shipping Fever is a transport associated syndrome seen in equids and bovines transported during long distances. The microbial profile and clinical signs vary between species, and in horses it is characterized by pharyngeal commensal bacteria and aerosolized particulate matter invading the lower airway due to compromised mucocillary clearance mechanisms during transports. This leads to pyrexia, pulmonary parenchymal disease, inappetence, and in severe cases pleuropneumonia. It has been shown that the incidence of transport-related pyrexia in horses increases with travel time and distance, howev...
Borgsteede FH, van Beek G.The prevalence of metazoan parasites in the stomach and small intestine was investigated in 70 horses slaughtered in the period February 1994-July 1994. Most horses were young (1.5-3 years) and in good condition. Trichostrongylus axei was the most prevalent parasite species in the stomach (51.4%), followed by Gasterophilus intestinalis (41.4%) and Habronema spp. (4.3%). In the small intestine, Parascaris equorum (28.6%) and Paranoplocephala mamillana (1.4%) were found. The mean worm burden of T. axei was 957 (max. 8502), of G. intestinalis 21 (max. 84), of Habronema spp. 3 (max. 5), and of P. ...
Mustikka MP, Grönthal TSC, Pietilä EM.To retrospectively describe laboratory findings, treatment, and outcome associated with equine infectious keratitis in Finland. Unassigned: Medical records of horses diagnosed with infectious keratitis in University of Helsinki Equine Hospital from January 2007 to June 2018 were reviewed. Results: Forty-seven cases were included. Keratomycosis was diagnosed in 27 eyes and bacterial keratitis in 20 eyes. Aspergillus flavus was the most frequent fungal isolate (9/17, 53%), followed by Cylindrocarpon sp. (3/17, 18%) and Aspergillus fumigatus (2/17, 12%). Susceptibility was tested for 10/11 Asperg...
Bartolomé E, Menéndez-Buxadera A, Molina A, Valera M.To obtain a sport horse that excels in the highest levels of competition, breeders must take into account certain genetic and environmental factors that could influence the sport horse's performance, such as the rider-horse interaction (RHI). The main aim of this study was to describe this interaction in a genetic model by modelling it in relation to the horse's age. A total of 31,129 sport results from Spanish Sport Horses were used from a total of 1,101 animals evaluated, and these were grouped in three age levels and had been ridden by 606 different riders. Only riders who had ridden more t...
Dacre IT, Kempson S, Dixon PM.Morphological examinations were performed on 100 normal equine cheek teeth (CT) of 1-12 years dental age (i.e. time since eruption), using gross examination, dissection microscopy, computerised axial tomography, and decalcified and undecalcified histology. The CT in Triadan 07-10 positions consistently had five pulp horns, but the 06 CT had an additional pulp horn more rostrally. Mandibular and maxillary Triadan 11s had six and seven pulp horns, respectively. Sections of CT taken 2-6mm below the occlusal surface (variation due to normal undulating occlusal surface) showed the presence of pulp ...
Liu LL, Fang C, Liu WJ.The utility of high-density single nucleotide polymorphism (SNP) data help to accurately identify genomic regions that have undergone positive selection. In this study, the Affymetrix Equine 670 K high-density SNP array was used to genotype Kazakh and Yili horse population. After quality control, 370,227 autosomal SNPs were used to detect selection signatures by using global fixation index (F) and cross-population extended haplotype homozygosity (XP-EHH). The database of Ensemble, Genecards, and NCBI were used to make gene annotation and functional analysis. The results showed that there wer...
Muir WW, Skarda RT, Milne DW.An evaluation and comparison of thermodilution technique with dye dilution technique was made in the computation of cardiac output in 39 conscious adult horses (av body wt, 450 kg). Estimation of cardiac output by thermodilution was found to compare favorably with values obtained from dye dilution when a volume of 30 to 40 ml at a temperature of 0 C was used. Difficulties in obtaining accurate thermodilution curves in the horse seem predominantly associated with errors in mixing and observation.
Hinshaw VS, Naeve CW, Webster RG, Douglas A, Skehel JJ, Bryans J.Influenza outbreaks involving viruses of the H3N8 subtype (equine 2) often occur in vaccinated horses. For this reason, a series of influenza viruses of the H3N8 subtype were examined to determine if antigenic variation could be detected in isolates during the period 1963-81. Antigenic analyses with post-infection ferret sera and monoclonal antibodies showed that the haemagglutinins of recent isolates were antigenically distinguishable from the prototype A/eq/Miami/1/63 and that antigenically distinguishable groups of equine 2 viruses co-circulate in the horse population. Based on these studie...
Adreani CM, Li ZB, Lehar M, Southwood LL, Habecker PL, Flint PW, Parente EJ.The myosin heavy chain (MHC) composition of a given muscle determines the contractile properties and, therefore, the fiber type distribution of the muscle. MHC isoform expression in the laryngeal muscle is modulated by neural input and function, and it represents the cellular level changes that occur with denervation and reinnervation of skeletal muscle. The objective of this study was to evaluate the pattern of MHC isoform expression in laryngeal muscle harvested from normal cadavers and cadavers with naturally occurring left laryngeal hemiplegia secondary to recurrent laryngeal neuropathy. L...
Mircica E, Clutton RE, Kyles KW, Blissitt KJ.To identify the incidence of adverse effects caused by morphine 100-170 micro g kg-1 administration during surgery in horses. Methods: Retrospective case record analysis (1996-2000). Methods: Eighty-four healthy (ASA 1 or 2) horses, mean age 5.5 +/- 3.1 (SD) years (2 months to 16 years), mean weight 524 +/- 14 kg (100-950). Methods: Physiological data and evidence of complications were collected from the anaesthetic records of all animals anaesthetized with romifidine, ketamine, diazepam and halothane and undergoing laryngeal surgery or orchiectomy at the Royal (Dick) School of Veterinary Stud...
Martens RJ, Mealey K, Cohen ND, Harrington JR, Chaffin MK, Taylor RJ, Bernstein LR.To determine the pharmacokinetics of gallium maltolate (GaM) after intragastric administration in healthy foals. Methods: 6 healthy neonatal foals. Methods: Each foal received GaM (20 mg/kg) by intragastric administration. Blood samples were obtained before (time 0) and at 0.25, 0.5, 1, 2, 4, 8, 12, 24, 36, and 48 hours after GaM administration for determination of serum gallium concentrations by use of inductively coupled plasma mass spectroscopy. Results: Mean +/- SD pharmacokinetic variables were as follows: peak serum gallium concentration, 1,079 +/- 311 ng/mL; time to peak serum concentra...