Analyze Diet

Topic:Diagnosis

Diagnosis in horses involves the systematic identification of diseases and conditions affecting equine health. This process relies on a combination of clinical evaluations, laboratory tests, imaging techniques, and other diagnostic tools to assess the health status of horses. Veterinarians utilize these methods to identify symptoms, determine the underlying causes of health issues, and formulate appropriate treatment plans. Diagnostic procedures in equine medicine can include blood tests, ultrasound, radiography, endoscopy, and more specialized tests such as genetic screening or advanced imaging modalities like MRI and CT scans. This page aggregates peer-reviewed research studies and scholarly articles that explore various diagnostic techniques, their applications, and advancements in the field of equine veterinary medicine.
Atrial premature depolarisations five days post electrical cardioversion are related to atrial fibrillation recurrence risk in horses.
Equine veterinary journal    October 24, 2019   Volume 52, Issue 3 374-378 doi: 10.1111/evj.13186
Vernemmen I, De Clercq D, Decloedt A, Vera L, Van Steenkiste G, van Loon G.The number of atrial premature depolarisations (APDs) is a known risk factor for atrial fibrillation (AF) recurrence in humans. Objective: To evaluate if the number of APDs over a 24-h period 5 days post cardioversion predicts AF recurrence within 1 year in horses, taking the multifactorial nature of AF into account. Methods: Retrospective case series. Methods: Eighty horses met these inclusion criteria: first AF episode, no AF recurrence within 5 days post cardioversion, cardioversion by transvenous electrical cardioversion (TVEC), 24-h ECG recording and echocardiographic examination 5 da...
Influence of digital hypothermia on lamellar events related to IL-6/gp130 signalling in equine sepsis-related laminitis.
Equine veterinary journal    October 24, 2019   Volume 52, Issue 3 441-448 doi: 10.1111/evj.13184
Dern K, Burns TA, Watts MR, van Eps AW, Belknap JK.Interleukin-6 (IL-6) is consistently increased in the digital lamellae in different studies of sepsis-related laminitis (SRL). IL-6 signalling through the gp130 receptor activates similar signalling (i.e. mTORC1-related signalling) previously reported to be activated in models of endocrinopathic laminitis. Objective: To assess the activation state of signalling proteins downstream of IL-6/gp130 receptor complex activation in an experimental model of SRL. Methods: Randomised experimental study. Methods: Lamellar phospho-(P) protein concentrations downstream of the IL-6/gp130 receptors were asse...
Plasma adrenocorticotropic hormone concentration in horses decreases after freezing for 60 days. Haffner JC, Neal DL, Hoffman RM, Grubbs ST.We investigated the stability of adrenocorticotropic hormone (ACTH) in plasma after freezing for different lengths of time. The plasma ACTH concentrations of 12 horses were measured on day 0 (baseline) and over time, after stimulation with thyrotropin-releasing hormone. Samples were stored at -80°C for 3, 7, 30, 60, and 90 d, or at -20°C for 3, 7, 30, and 60 d, or between ice packs at -20°C for 3 and 7 d prior to determination of ACTH concentration. ACTH concentrations were compared to baseline (non-frozen day 0 plasma) for each storage method using a mixed model with repeated measure...
Antigen array for serological diagnosis and novel allergen identification in severe equine asthma.
Scientific reports    October 23, 2019   Volume 9, Issue 1 15170 doi: 10.1038/s41598-019-51820-7
White SJ, Moore-Colyer M, Marti E, Hannant D, Gerber V, Coüetil L, Richard EA, Alcocer M.Severe equine asthma (sEA), which closely resembles human asthma, is a debilitating and performance-limiting allergic respiratory disorder which affects 14% of horses in the Northern Hemisphere and is associated with increased allergen-specific immunoglobulin E (IgE) against a range of environmental proteins. A comprehensive microarray platform was developed to enable the simultaneous detection of allergen-specific equine IgE in serum against a wide range of putative allergenic proteins. The microarray revealed a plethora of novel pollen, bacteria, mould and arthropod proteins significant in t...
Paving the way for more precise diagnosis of EcPV2-associated equine penile lesions.
BMC veterinary research    October 22, 2019   Volume 15, Issue 1 356 doi: 10.1186/s12917-019-2097-0
Ramsauer AS, Wachoski-Dark GL, Fraefel C, Tobler K, Brandt S, Knight CG, Favrot C, Grest P.There is growing evidence that equine papillomavirus type 2 (EcPV2) infection is causally associated with the development of equine genital squamous cell carcinomas (SCCs). Early stages of disease present clinically as plaques or wart-like lesions which can gradually progress to tumoural lesions. Histologically these lesions are inconsistently described as benign hyperplasia, papilloma, penile intraepithelial neoplasia (PIN), carcinoma in situ (CIS) or SCC. Guidelines for histological classification of early SCC precursor lesions are not precisely defined, leading to potential misdiagnosis. Th...
Factors Associated With Survival and Return to Function Following Synovial Infections in Horses.
Frontiers in veterinary science    October 22, 2019   Volume 6 367 doi: 10.3389/fvets.2019.00367
Crosby DE, Labens R, Hughes KJ, Nielsen S, Hilbert BJ.Synovial infections (SI) are common in horses of all ages and can be associated with high rates of morbidity and mortality. Identifying factors influencing survival and return to function may be useful for management of affected individuals and determination of prognosis. The objectives of this study were to identify factors associated with survival and return to function of horses and foals with SI presented to an equine hospital. This study is a retrospective case series. Data were collected from medical records of all horses with SI that were presented to a single equine hospital between Ap...
High intake of sugars and starch, low number of meals and low roughage intake are associated with Equine Gastric Ulcer Syndrome in a Belgian cohort.
Journal of animal physiology and animal nutrition    October 22, 2019   Volume 105 Suppl 2 18-23 doi: 10.1111/jpn.13215
Galinelli N, Wambacq W, Broeckx BJG, Hesta M.Equine gastric ulcer syndrome (EGUS) is a pathological condition affecting the glandular and squamous regions of the stomach. It is characterized by non-specific clinical signs, behavioural changes or can also be found without any overt clinical manifestations. Nutritional factors such as intermittent feeding, high sugars and starch intake, large amounts of straw as forage and prolonged time without access to forage have all been associated with an increased risk of equine squamous gastric disease (ESGD). The aim of this study was to investigate which nutritional practices are commonly seen in...
Ganglioglioma of the Right Cerebrothalamus in a 7-Year-Old Quarter Horse Cross Gelding.
Frontiers in veterinary science    October 22, 2019   Volume 6 356 doi: 10.3389/fvets.2019.00356
Easton-Jones C, Woolard K, Mohr FC, Roy MA, Aleman M.Intracranial neoplasia in horses is rare compared to other species. Detailed information such as neurological, electroencephalographic, and histopathological examination of horses with intracranial neoplasia associated with seizures is scarce in the literature. Furthermore, ganglioglioma has not been reported in the horse. A 7-year-old Quarter horse cross Paint gelding was examined due to recurrent seizure-like episodes of 1-year duration. The seizures had been increasing in frequency and length, occurring up to 20 times a day at the time of presentation. Neurological examination revealed inte...
[Ovarian Mixed Tumor in a Mare].
Tierarztliche Praxis. Ausgabe G, Grosstiere/Nutztiere    October 21, 2019   Volume 47, Issue 5 328 doi: 10.1055/a-1004-9889
Pinna AE, Okada CTC, Ferreira CSC et al. Double ovarian tumor in the mare: case report. Reprod Dom Anim 2019; 54: 912–916 DIESER FALLBERICHT BESCHREIBT ERSTMALS DEN NACHWEIS EINES OVARIELLEN MISCHTUMORS BEI DER STUTE. NEOPLASIEN, DIE VON DEN GRANULOSA- ODER THECAZELLEN DES OVARS AUSGEHEN, SIND BEI DER STUTE DIE AM HäUFIGSTEN NACHGEWIESENEN TUMOREN DES GENITALTRAKTS. ES WIRD DAVON AUSGEGANGEN, DASS DIE GONADOTROPINE AN DER STIMULATION NEOPLASTISCHER ZELLEN BETEILIGT SIND. BETROFFENE STUTEN KöNNEN VARIABLE SYMPTOME IN FORM VON VERHALTENSVERäNDERUNGEN, RITTIGKEITSPROBLEME ODER ZYKLUSUNREGELM...
Results of racetrack examinations of Standardbred horses at race meetings in New South Wales.
Australian veterinary journal    October 21, 2019   Volume 97, Issue 12 509-514 doi: 10.1111/avj.12882
Knight PK.This study analysed the race day veterinary reports from harness racing meetings controlled by the New South Wales Greyhound and Harness Racing Regulatory Authority between 1 September 2008 and 30 June 2009. The findings of all prerace and postrace examinations were analysed, and the frequency of observations was recorded. Chi-square testing was used to determine whether the incidence of abnormalities differed between age groups and tracks. A total of 542 meetings were conducted during the period of the study, with veterinary examinations conducted at 395 of these meetings. A total of 520 vete...
[Immunoglobulin concentration in equine colostrum and blood of newborn foals as well as clinically relevant IgG evaluation methods – An overview].
Tierarztliche Praxis. Ausgabe G, Grosstiere/Nutztiere    October 21, 2019   Volume 47, Issue 5 298-307 doi: 10.1055/a-1005-0004
Sievert M, Krohn J, Wehrend A.Due to the special structure of the equine placenta, foals depend on an adequate intake of high-quality colostrum post natum in order to ensure the development of passive immunity. The quality of the colostrum is determined, among other things, by the IgG content. This may be evaluated in the colostrum by direct and indirect methods (density and refractive index). The density of the colostrum is measured by a colostrometer and should amount to at least 1060 g/l. Refractometry is suitable for assessing the relative density or refractive index. Good equine colostrum has a Brix value of at leas...
Possible dysmetabolic hyperferritinemia in hyperinsulinemic horses.
Open veterinary journal    October 21, 2019   Volume 9, Issue 4 287-293 doi: 10.4314/ovj.v9i4.2
Kellon EM, Gustafson KM.Hyperinsulinemia associated with equine metabolic syndrome and pituitary pars intermedia dysfunction is a risk factor for laminitis. Research in other species has shown elevated body iron levels as both a predictor and consequence of insulin resistance. In humans, this is known as dysmetabolic hyperferritinemia. To explore the relationship between equine hyperinsulinemia and body iron levels. We reviewed case histories and laboratory results from an open access database maintained by the Equine Cushing's and Insulin Resistance Group Inc. (ECIR). We identified 33 horses with confirmed hyperinsu...
Equine Rhinitis A Virus Infection in Thoroughbred Racehorses-A Putative Role in Poor Performance?
Viruses    October 18, 2019   Volume 11, Issue 10 doi: 10.3390/v11100963
Back H, Weld J, Walsh C, Cullinane A.The aim of this study was to identify respiratory viruses circulating amongst elite racehorses in a training yard by serological testing of serial samples and to determine their impact on health status and ability to race. A six-month longitudinal study was conducted in 30 Thoroughbred racehorses (21 two-year-olds, five three-year-olds and four four-year-olds) during the Flat racing season. Sera were tested for the presence of antibodies against equine herpesvirus 1 and 4 (EHV-1 and EHV-4) and equine rhinitis viruses A and B (ERAV and ERBV) by complement fixation (CF) and equine arteritis viru...
Non-Coding RNA Sequencing of Equine Endometrium During Maternal Recognition of Pregnancy.
Genes    October 18, 2019   Volume 10, Issue 10 821 doi: 10.3390/genes10100821
Klohonatz KM, Coleman SJ, Cameron AD, Hess AM, Reed KJ, Canovas A, Medrano JF, Islas-Trejo AD, Kalbfleisch T, Bouma GJ, Bruemmer JE.Maternal recognition of pregnancy (MRP) in the mare is not well defined. In a non-pregnant mare, prostaglandin F (PGF) is released on day 14 post-ovulation (PO) to cause luteal regression, resulting in loss of progesterone production. Equine MRP occurs prior to day 14 to halt PGF production. Studies have failed to identify a gene candidate for MRP, so attention has turned to small, non-coding RNAs. The objective of this study was to evaluate small RNA (<200 nucleotides) content in endometrium during MRP. Mares were used in a cross-over design with each having a pregnant and non-mated cycle....
Characterization of abortion, stillbirth and non-viable foals homozygous for the Warmblood Fragile Foal Syndrome.
Animal reproduction science    October 17, 2019   Volume 211 106202 doi: 10.1016/j.anireprosci.2019.106202
Aurich C, Müller-Herbst S, Reineking W, Müller E, Wohlsein P, Gunreben B, Aurich J.Warmblood fragile foal syndrome (WFFS) is a monogenetic defect with autosomal recessive inheritance. The WFFS homozygosity is non-compatible with extra-uterine life. Although as many as 15% of Warmblood horses are WFFS carriers, there has been little veterinary focus on this condition. The aim of this study was to determine outcomes and symptoms of clinical signs and pathological abnormalities during pregnancies when there were WFFS homozygous foetuses. Diagnostic material of 15 abortion or stillbirth cases with suspected diagnosis of WFFS was available for this study. Additionally, there were...
Ultrasonographic assessment of normal jugular veins in Standardbred horses.
BMC veterinary research    October 16, 2019   Volume 15, Issue 1 343 doi: 10.1186/s12917-019-2104-5
Pasolini MP, Spinella G, Del Prete C, Valentini S, Coluccia P, Auletta L, Greco M, Meomartino L.Ultrasonography (US) is the recommended imaging technique to evaluate jugular veins. This prospective randomized clinical study was designed to collect a series of B-mode US measurements of manually distended jugular veins in healthy Italian Standardbreds and to find possible correlations between ultrasound measurements and animal morphometric characteristics. Forty-two horses, eight males and 34 females (range 3-22 years; bodyweight 494.4 ± 41.7 kg), were included in the study. The diameters and wall thicknesses of both jugular veins were measured at three different sites of the neck...
TRIM39-RPP21 Variants (∆19InsCCC) Are Not Associated with Juvenile Idiopathic Epilepsy in Egyptian Arabian Horses.
Genes    October 16, 2019   Volume 10, Issue 10 816 doi: 10.3390/genes10100816
Rivas VN, Aleman M, Peterson JA, Dahlgren AR, Hales EN, Finno CJ.Juvenile idiopathic epilepsy (JIE) is an inherited disease characterized by recurrent seizures during the first year of life in Egyptian Arabian horses. Definitive diagnosis requires an electroencephalogram (EEG) performed by a veterinary specialist. A recent study has suggested that a 19 base-pair deletion, along with a triple-C insertion, in intron five of twelve (∆19InsCCC; chr20:29542397-29542425: GTTCAGGGGACCACATGGCTCTCTATAGA>TATCTTAAGACCC) of the () gene is associated with JIE. To confirm this association, a new sample set consisting of nine EEG-phenotyped affected and nine unaffec...
Immunoreactive insulin stability in horses at risk of insulin dysregulation.
Journal of veterinary internal medicine    October 16, 2019   Volume 33, Issue 6 2746-2751 doi: 10.1111/jvim.15629
Leschke DH, Muir GS, Hodgson JK, Coyle M, Horn R, Bertin FR.Diseases associated with insulin dysregulation (ID), such as equine metabolic syndrome and pituitary pars intermedia dysfunction, are of interest to practitioners because of their association with laminitis. Accurate insulin concentration assessment is critical in diagnosing and managing these diseases. Objective: To determine the effect of time, temperature, and collection tube type on insulin concentrations in horses at risk of ID. Methods: Eight adult horses with body condition score >6/9. Methods: In this prospective study, subjects underwent an infeed oral glucose test 2 hours before...
The effect of different grazing conditions on the insulin and incretin response to the oral glucose test in ponies.
BMC veterinary research    October 16, 2019   Volume 15, Issue 1 345 doi: 10.1186/s12917-019-2088-1
Fitzgerald DM, Pollitt CC, Walsh DM, Sillence MN, de Laat MA.The oral glucose test (OGT) is a useful tool for diagnosing insulin dysregulation (ID) and is somewhat repeatable in ponies under consistent management. This study aimed to determine whether the insulin and incretin responses to an OGT in ponies differed after short-term access to fertilised pasture, compared to unfertilised pasture, by using a randomised, repeated measures study design. Sixteen mixed-breed ponies were classified as severely insulin-dysregulated (SD; post-prandial insulin ≥80 μIU/mL) or not severely insulin-dysregulated (NSD; post-prandial insulin < 80 μIU/mL) using a...
Horses for courses: an approach to the qualification of clinical trial sites and investigators in ATMPs.
Drug discovery today    October 16, 2019   Volume 25, Issue 2 265-268 doi: 10.1016/j.drudis.2019.10.003
Hildebrandt M.The advanced therapy medicinal products (ATMPs) landscape is entirely different from classical drug development. Academia has been the major source of ATMP development, and academic hospitals act as trial sites for the clinical testing of ATMPs, including early academic-led trials as well as industry-sponsored trials that pursue the full developmental pathway to market authorization. The recent breakthrough developments in some ATMPs, such as genetically engineered immune cells, have confronted academic hospitals with a substantial amount of public demand, competitive pressure, and costs. At t...
Fungal Placentitis Caused by Aspergillus terreus in a Mare: Case Report.
Journal of equine veterinary science    October 15, 2019   Volume 83 102799 doi: 10.1016/j.jevs.2019.102799
Orellana-Guerrero D, Renaudin C, Edwards L, Rose E, Aleman M, Moore PF, Dujovne G.Placentitis has been reported as the most important cause of equine abortions, stillbirths, and perinatal deaths in horses. Most cases are caused by bacteria and less commonly by fungal elements. The aim of this report is to describe the clinical presentation of a fungal placentitis caused by Aspergillus terrerus. A 5-year-old thoroughbred maiden mare at the 217th day of gestation presented with some classic signs of placentitis (premature udder development and milk dripping). All ultrasonographic findings were consistent with a live fetus and a severe placentitis. On vaginal examination, pur...
The First Detection of Equine Coronavirus in Adult Horses and Foals in Ireland.
Viruses    October 14, 2019   Volume 11, Issue 10 946 doi: 10.3390/v11100946
Nemoto M, Schofield W, Cullinane A.The objective of this study was to investigate the presence of equine coronavirus (ECoV) in clinical samples submitted to a diagnostic laboratory in Ireland. A total of 424 clinical samples were examined from equids with enteric disease in 24 Irish counties between 2011 and 2015. A real-time reverse transcription polymerase chain reaction was used to detect ECoV RNA. Nucleocapsid, spike and the region from the p4.7 to p12.7 genes of positive samples were sequenced, and sequence and phylogenetic analyses were conducted. Five samples (1.2%) collected in 2011 and 2013 tested positive for ECoV. Po...
Viruses in Horses with Neurologic and Respiratory Diseases.
Viruses    October 14, 2019   Volume 11, Issue 10 942 doi: 10.3390/v11100942
Altan E, Li Y, Sabino-Santos G, Sawaswong V, Barnum S, Pusterla N, Deng X, Delwart E.Metagenomics was used to identify viral sequences in the plasma and CSF (cerobrospinal fluid) of 13 horses with unexplained neurological signs and in the plasma and respiratory swabs of 14 horses with unexplained respiratory signs. Equine hepacivirus and two copiparvoviruses (horse parvovirus-CSF and a novel parvovirus) were detected in plasma from neurological cases. Plasma from horses with respiratory signs contained the same two copiparvoviruses plus equine pegivirus D and respiratory swabs contained equine herpes virus 2 and 5. Based on genetic distances the novel copiparvovirus qualified ...
Thermal, mechanical and electrical stimuli in antinociceptive studies in standing horses: an update.
Veterinary anaesthesia and analgesia    October 13, 2019   Volume 47, Issue 1 15-27 doi: 10.1016/j.vaa.2019.09.003
Gozalo-Marcilla M, Luna SPL, Gasthuys F, Schauvliege S.To perform a literature review of the thermal and mechanical antinociceptive devices used in pharmacological studies in standing horses published after 2011 (2012-2019). To complete a full literature review about electrical stimulation used for evaluation in similar studies. Methods: PubMed, Google Scholar and Web of Science. Conclusions: A high level of standardization has been reached in antinociceptive studies in standing horses using thermal and mechanical stimuli in most recent years. Commercially available testing devices to deliver thermal, mechanical and electrical stimuli, with observ...
Preliminary insight into horse owners’ perceptions of, and attitudes towards, exotic diseases in the United Kingdom.
BMC veterinary research    October 12, 2019   Volume 15, Issue 1 338 doi: 10.1186/s12917-019-2120-5
Spence KL, Cardwell JM, Slater J, Rosanowski SM.The potential for an exotic disease incursion is a significant concern for the United Kingdom (UK) equine industry. Horse owners' perceptions of, and attitudes towards, exotic diseases can influence decisions to adopt disease preparedness strategies. The objectives of this study were to describe horse owners' 1) perceptions of the term 'exotic disease', and 2) attitudes towards their risk of being affected by an exotic disease. In order to address these objectives, qualitative content analysis was undertaken on data collected using two open-ended survey questions. Results: Horse owners (n =â€...
Multiple excisions of an equine sarcoid and the repercussions.
The Canadian veterinary journal = La revue veterinaire canadienne    October 11, 2019   Volume 60, Issue 10 1115-1117 
Melinyshyn H.A 13-year-old Morgan crossbred mare was presented in May 2018 with a 10-cm mass on the medial aspect of the left hind fetlock. In September and November 2018 and June 2019 the mass was incompletely excised and continued to grow. A diagnosis of spindle cell tumor, consistent with equine sarcoid, was made based on histopathology from the last excision. . Une jument Morgan croisée âgée de 13 ans a été présentée en mai 2018 avec une masse de 10 cm sur l’aspect médial du boulet arrière gauche. En septembre et novembre 2018 ainsi qu’en juin 2019, la masse avait été excisée de manièr...
Sacrococcygeal luxation and complete tail amputation following a tail pull injury in a horse.
The Canadian veterinary journal = La revue veterinaire canadienne    October 11, 2019   Volume 60, Issue 10 1094-1098 
Riddell LP, Yoshimura S, MacKay AV, Wilson DG.A 17-year-old Quarter horse mare was presented because of traumatic luxation of the fifth sacral and first coccygeal vertebrae resulting in loss of sensation, motor function, and perfusion of the tail. The case was complicated by an associated tail head hematoma. Due to the severity of the injury, tail amputation was performed at the level of the luxation. Tail amputations in horses at the sacrococcygeal junction following a suspected tail pull injury are infrequently reported in the literature. . Une jument Quarter horse âgée de 17 ans fut présentée pour cause de luxation traumatique de l...
Clinical aspects and diagnosis of leishmaniasis in equids: a systematic review and meta-analysis. Limeira CH, Alves CJ, Azevedo SS, Santos CSAB, Melo MA, Soares RR, Barnabé NNDC, Rodrigues GQ.Leishmaniases are a group of diseases of zoonotic importance caused by over 20 species of protozoa of the genus Leishmania, in which domestic dogs are considered to be the main reservoir for the disease. However, the involvement of other vertebrates as reservoirs for these parasites has also been investigated. Therefore, the objective of the present study was to carry out a systematic review with meta-analysis on occurrences of leishmaniasis in equids. The case reports described animals with cutaneous symptoms of leishmaniasis (papules, nodules, ulcers or crusts) that regressed spontaneously, ...
Comparative Review of Asthma in Farmers and Horses.
Current allergy and asthma reports    October 10, 2019   Volume 19, Issue 11 50 doi: 10.1007/s11882-019-0882-2
Sheats MK, Davis KU, Poole JA.Farmers are routinely exposed to organic dusts and aeroallergens that can have adverse respiratory health effects including asthma. Horses are farm-reared large animals with similar exposures and can develop equine asthma syndrome (EAS). This review aims to compare the etiology, pathophysiology, and immunology of asthma in horses compared to farmers and highlights the horse as a potential translational animal model for organic dust-induced asthma in humans. Severe EAS shares many clinical and pathological features with various phenotypes of human asthma including allergic, non-allergic, late o...
Culture-independent and dependent evaluation of the equine paranasal sinus microbiota in health and disease.
Equine veterinary journal    October 10, 2019   Volume 52, Issue 3 455-463 doi: 10.1111/evj.13168
Beste KJ, Lawhon SD, Chamoun-Emanuelli AM, Duff AH, Coleman MC, Griffin CE, Hardy J, Whitfield-Cargile CM.Horses with bacterial sinusitis frequently undergo empirical treatment with antimicrobials, however, in some cases bacterial culture of the affected sinus is used to direct therapy. Data regarding which organisms are part of the commensal microbiota of the equine sinus are lacking making it difficult to interpret culture results and guide empiric antimicrobial selection. Objective: Our objectives were to describe the bacterial and fungal microbiota of the paranasal sinuses in clinically normal horses using culture-dependent and independent approaches and to compare the bacterial culture and su...