Disease diagnosis in horses involves the identification and characterization of illnesses through various diagnostic methods and tools. This process is essential for effective veterinary care and management of equine health. Techniques used in diagnosing diseases in horses include clinical examinations, laboratory tests, imaging modalities such as ultrasonography and radiography, and molecular diagnostics. Blood tests are frequently utilized to assess parameters such as complete blood count and biochemical profiles, which can indicate underlying health issues. Additionally, advancements in genetic testing and biomarker identification have enhanced the ability to detect specific diseases early. This page aggregates peer-reviewed research studies and scholarly articles that explore diagnostic methodologies, their applications, and their impact on equine health management.
The UK has never experienced an outbreak of African horse sickness but, as Matthew Robin of the Fyrnwy Equine Clinic explains, there is still a risk of a case occurring.
Vernemmen I, De Clercq D, Decloedt A, Vera L, Van Steenkiste G, van Loon G.The number of atrial premature depolarisations (APDs) is a known risk factor for atrial fibrillation (AF) recurrence in humans. Objective: To evaluate if the number of APDs over a 24-h period 5Â days post cardioversion predicts AF recurrence within 1Â year in horses, taking the multifactorial nature of AF into account. Methods: Retrospective case series. Methods: Eighty horses met these inclusion criteria: first AF episode, no AF recurrence within 5Â days post cardioversion, cardioversion by transvenous electrical cardioversion (TVEC), 24-h ECG recording and echocardiographic examination 5Â da...
Dern K, Burns TA, Watts MR, van Eps AW, Belknap JK.Interleukin-6 (IL-6) is consistently increased in the digital lamellae in different studies of sepsis-related laminitis (SRL). IL-6 signalling through the gp130 receptor activates similar signalling (i.e. mTORC1-related signalling) previously reported to be activated in models of endocrinopathic laminitis. Objective: To assess the activation state of signalling proteins downstream of IL-6/gp130 receptor complex activation in an experimental model of SRL. Methods: Randomised experimental study. Methods: Lamellar phospho-(P) protein concentrations downstream of the IL-6/gp130 receptors were asse...
Haffner JC, Neal DL, Hoffman RM, Grubbs ST.We investigated the stability of adrenocorticotropic hormone (ACTH) in plasma after freezing for different lengths of time. The plasma ACTH concentrations of 12 horses were measured on day 0 (baseline) and over time, after stimulation with thyrotropin-releasing hormone. Samples were stored at -80°C for 3, 7, 30, 60, and 90 d, or at -20°C for 3, 7, 30, and 60 d, or between ice packs at -20°C for 3 and 7 d prior to determination of ACTH concentration. ACTH concentrations were compared to baseline (non-frozen day 0 plasma) for each storage method using a mixed model with repeated measure...
White SJ, Moore-Colyer M, Marti E, Hannant D, Gerber V, Coüetil L, Richard EA, Alcocer M.Severe equine asthma (sEA), which closely resembles human asthma, is a debilitating and performance-limiting allergic respiratory disorder which affects 14% of horses in the Northern Hemisphere and is associated with increased allergen-specific immunoglobulin E (IgE) against a range of environmental proteins. A comprehensive microarray platform was developed to enable the simultaneous detection of allergen-specific equine IgE in serum against a wide range of putative allergenic proteins. The microarray revealed a plethora of novel pollen, bacteria, mould and arthropod proteins significant in t...
Ramsauer AS, Wachoski-Dark GL, Fraefel C, Tobler K, Brandt S, Knight CG, Favrot C, Grest P.There is growing evidence that equine papillomavirus type 2 (EcPV2) infection is causally associated with the development of equine genital squamous cell carcinomas (SCCs). Early stages of disease present clinically as plaques or wart-like lesions which can gradually progress to tumoural lesions. Histologically these lesions are inconsistently described as benign hyperplasia, papilloma, penile intraepithelial neoplasia (PIN), carcinoma in situ (CIS) or SCC. Guidelines for histological classification of early SCC precursor lesions are not precisely defined, leading to potential misdiagnosis. Th...
Crosby DE, Labens R, Hughes KJ, Nielsen S, Hilbert BJ.Synovial infections (SI) are common in horses of all ages and can be associated with high rates of morbidity and mortality. Identifying factors influencing survival and return to function may be useful for management of affected individuals and determination of prognosis. The objectives of this study were to identify factors associated with survival and return to function of horses and foals with SI presented to an equine hospital. This study is a retrospective case series. Data were collected from medical records of all horses with SI that were presented to a single equine hospital between Ap...
Bernstock JD, Ostby S, Fox B, Sotoudeh H, Janssen A, Kang YJ, Chen J, Prattipati V, Elsayed G, Chagoya G, Yamashita D, Friedman GK, Nabors B, Huh WK....Leptomeningeal metastasis is extremely rare in patients with ovarian cancer, but should be considered in patients presenting with neurologic deficits such as cauda equine syndrome. Given its poor prognosis and lack of data currently on management, additional studies are needed to optimize treatment regimens and improve outcomes.
Galinelli N, Wambacq W, Broeckx BJG, Hesta M.Equine gastric ulcer syndrome (EGUS) is a pathological condition affecting the glandular and squamous regions of the stomach. It is characterized by non-specific clinical signs, behavioural changes or can also be found without any overt clinical manifestations. Nutritional factors such as intermittent feeding, high sugars and starch intake, large amounts of straw as forage and prolonged time without access to forage have all been associated with an increased risk of equine squamous gastric disease (ESGD). The aim of this study was to investigate which nutritional practices are commonly seen in...
Easton-Jones C, Woolard K, Mohr FC, Roy MA, Aleman M.Intracranial neoplasia in horses is rare compared to other species. Detailed information such as neurological, electroencephalographic, and histopathological examination of horses with intracranial neoplasia associated with seizures is scarce in the literature. Furthermore, ganglioglioma has not been reported in the horse. A 7-year-old Quarter horse cross Paint gelding was examined due to recurrent seizure-like episodes of 1-year duration. The seizures had been increasing in frequency and length, occurring up to 20 times a day at the time of presentation. Neurological examination revealed inte...
Dahmani M, Davoust B, Sambou M, Bassene H, Scandola P, Ameur T, Raoult D, Fenollar F, Mediannikov O.Our study aimed to assess the diversity of the species of Anaplasmataceae in Senegal that infect animals and ticks in three areas: near Keur Momar Sarr (northern region), Dielmo and Diop (Sine Saloum, central region of Senegal), and in Casamance (southern region of Senegal). Methods: A total of 204 ticks and 433 blood samples were collected from ruminants, horses, donkeys and dogs. Ticks were identified morphologically and by molecular characterization targeting the 12S rRNA gene. Molecular characterization of species of Anaplasmataceae infecting Senegalese ticks and animals was conducted usin...
Pinna AE, Okada CTC, Ferreira CSC et al. Double ovarian tumor in the mare: case report. Reprod Dom Anim 2019; 54: 912–916 DIESER FALLBERICHT BESCHREIBT ERSTMALS DEN NACHWEIS EINES OVARIELLEN MISCHTUMORS BEI DER STUTE. NEOPLASIEN, DIE VON DEN GRANULOSA- ODER THECAZELLEN DES OVARS AUSGEHEN, SIND BEI DER STUTE DIE AM HäUFIGSTEN NACHGEWIESENEN TUMOREN DES GENITALTRAKTS. ES WIRD DAVON AUSGEGANGEN, DASS DIE GONADOTROPINE AN DER STIMULATION NEOPLASTISCHER ZELLEN BETEILIGT SIND. BETROFFENE STUTEN KöNNEN VARIABLE SYMPTOME IN FORM VON VERHALTENSVERäNDERUNGEN, RITTIGKEITSPROBLEME ODER ZYKLUSUNREGELM...
Knight PK.This study analysed the race day veterinary reports from harness racing meetings controlled by the New South Wales Greyhound and Harness Racing Regulatory Authority between 1 September 2008 and 30 June 2009. The findings of all prerace and postrace examinations were analysed, and the frequency of observations was recorded. Chi-square testing was used to determine whether the incidence of abnormalities differed between age groups and tracks. A total of 542 meetings were conducted during the period of the study, with veterinary examinations conducted at 395 of these meetings. A total of 520 vete...
Sievert M, Krohn J, Wehrend A.Due to the special structure of the equine placenta, foals depend on an adequate intake of high-quality colostrum post natum in order to ensure the development of passive immunity. The quality of the colostrum is determined, among other things, by the IgG content. This may be evaluated in the colostrum by direct and indirect methods (density and refractive index). The density of the colostrum is measured by a colostrometer and should amount to at least 1060 g/l. Refractometry is suitable for assessing the relative density or refractive index. Good equine colostrum has a Brix value of at leas...
Kellon EM, Gustafson KM.Hyperinsulinemia associated with equine metabolic syndrome and pituitary pars intermedia dysfunction is a risk factor for laminitis. Research in other species has shown elevated body iron levels as both a predictor and consequence of insulin resistance. In humans, this is known as dysmetabolic hyperferritinemia. To explore the relationship between equine hyperinsulinemia and body iron levels. We reviewed case histories and laboratory results from an open access database maintained by the Equine Cushing's and Insulin Resistance Group Inc. (ECIR). We identified 33 horses with confirmed hyperinsu...
Krohn J, Ennen S, Hospes R et al. Use of a cervical stent for long-term treatment of pyometra in the mare: A report of three cases. Reprod Dom Anim 2019; 55: 1155–1159 DIE PYOMETRA DER STUTE IST EIN CHRONISCHER ENTZüNDUNGSZUSTAND DES ENDOMETRIUMS, DER HäUFIG MIT DER AKKUMULATION GROßER MENGEN AN SEKRET EINHERGEHT. PRäDISPONIERT SIND STUTEN MIT VERäNDERUNGEN DER ZERVIX, DURCH DIE DIE UTERINE CLEARANCE BEEINTRäCHTIGT WIRD. DIE HäUFIG UNSPEZIFISCHEN SYMPTOME UMFASSEN LEISTUNGSMANGEL, KONDITIONSVERLUST, SUBFEBRILE TEMPERATUR ODER KOLIKARTIGE SCHMERZEN. MANCHE TIERE PRäSENTIEREN SICH SYMP...
Back H, Weld J, Walsh C, Cullinane A.The aim of this study was to identify respiratory viruses circulating amongst elite racehorses in a training yard by serological testing of serial samples and to determine their impact on health status and ability to race. A six-month longitudinal study was conducted in 30 Thoroughbred racehorses (21 two-year-olds, five three-year-olds and four four-year-olds) during the Flat racing season. Sera were tested for the presence of antibodies against equine herpesvirus 1 and 4 (EHV-1 and EHV-4) and equine rhinitis viruses A and B (ERAV and ERBV) by complement fixation (CF) and equine arteritis viru...
Klohonatz KM, Coleman SJ, Cameron AD, Hess AM, Reed KJ, Canovas A, Medrano JF, Islas-Trejo AD, Kalbfleisch T, Bouma GJ, Bruemmer JE.Maternal recognition of pregnancy (MRP) in the mare is not well defined. In a non-pregnant mare, prostaglandin F (PGF) is released on day 14 post-ovulation (PO) to cause luteal regression, resulting in loss of progesterone production. Equine MRP occurs prior to day 14 to halt PGF production. Studies have failed to identify a gene candidate for MRP, so attention has turned to small, non-coding RNAs. The objective of this study was to evaluate small RNA (<200 nucleotides) content in endometrium during MRP. Mares were used in a cross-over design with each having a pregnant and non-mated cycle. Ea...
Padalino B, Rosanowski SM, Di Bella C, Lacinio R, Rubino GTR.This study aimed to document the prevalence of chronic equine piroplasmosis (EP) in poorly performing Standardbred racehorses and to explore associations between the disease and sex, age, and hematological parameters. Blood was collected between 2004 and 2018; blood cell counts were performed using a cell counter analyzer, biochemical parameters using a photometer, and serum proteins using agarose gel electrophoresis. Blood smears were prepared, colored with a modified Giemsa, and an experienced technician identified the presence of protozoa. The horses were categorized into piroplasmosis posi...
Aurich C, Müller-Herbst S, Reineking W, Müller E, Wohlsein P, Gunreben B, Aurich J.Warmblood fragile foal syndrome (WFFS) is a monogenetic defect with autosomal recessive inheritance. The WFFS homozygosity is non-compatible with extra-uterine life. Although as many as 15% of Warmblood horses are WFFS carriers, there has been little veterinary focus on this condition. The aim of this study was to determine outcomes and symptoms of clinical signs and pathological abnormalities during pregnancies when there were WFFS homozygous foetuses. Diagnostic material of 15 abortion or stillbirth cases with suspected diagnosis of WFFS was available for this study. Additionally, there were...
Rivas VN, Aleman M, Peterson JA, Dahlgren AR, Hales EN, Finno CJ.Juvenile idiopathic epilepsy (JIE) is an inherited disease characterized by recurrent seizures during the first year of life in Egyptian Arabian horses. Definitive diagnosis requires an electroencephalogram (EEG) performed by a veterinary specialist. A recent study has suggested that a 19 base-pair deletion, along with a triple-C insertion, in intron five of twelve (∆19InsCCC; chr20:29542397-29542425: GTTCAGGGGACCACATGGCTCTCTATAGA>TATCTTAAGACCC) of the () gene is associated with JIE. To confirm this association, a new sample set consisting of nine EEG-phenotyped affected and nine unaffec...
Pasolini MP, Spinella G, Del Prete C, Valentini S, Coluccia P, Auletta L, Greco M, Meomartino L.Ultrasonography (US) is the recommended imaging technique to evaluate jugular veins. This prospective randomized clinical study was designed to collect a series of B-mode US measurements of manually distended jugular veins in healthy Italian Standardbreds and to find possible correlations between ultrasound measurements and animal morphometric characteristics. Forty-two horses, eight males and 34 females (range 3-22 years; bodyweight 494.4 ± 41.7 kg), were included in the study. The diameters and wall thicknesses of both jugular veins were measured at three different sites of the neck...
Leschke DH, Muir GS, Hodgson JK, Coyle M, Horn R, Bertin FR.Diseases associated with insulin dysregulation (ID), such as equine metabolic syndrome and pituitary pars intermedia dysfunction, are of interest to practitioners because of their association with laminitis. Accurate insulin concentration assessment is critical in diagnosing and managing these diseases. Objective: To determine the effect of time, temperature, and collection tube type on insulin concentrations in horses at risk of ID. Methods: Eight adult horses with body condition score >6/9. Methods: In this prospective study, subjects underwent an infeed oral glucose test 2 hours before...
Fitzgerald DM, Pollitt CC, Walsh DM, Sillence MN, de Laat MA.The oral glucose test (OGT) is a useful tool for diagnosing insulin dysregulation (ID) and is somewhat repeatable in ponies under consistent management. This study aimed to determine whether the insulin and incretin responses to an OGT in ponies differed after short-term access to fertilised pasture, compared to unfertilised pasture, by using a randomised, repeated measures study design. Sixteen mixed-breed ponies were classified as severely insulin-dysregulated (SD; post-prandial insulin ≥80 μIU/mL) or not severely insulin-dysregulated (NSD; post-prandial insulin < 80 μIU/mL) using an O...
Hildebrandt M.The advanced therapy medicinal products (ATMPs) landscape is entirely different from classical drug development. Academia has been the major source of ATMP development, and academic hospitals act as trial sites for the clinical testing of ATMPs, including early academic-led trials as well as industry-sponsored trials that pursue the full developmental pathway to market authorization. The recent breakthrough developments in some ATMPs, such as genetically engineered immune cells, have confronted academic hospitals with a substantial amount of public demand, competitive pressure, and costs. At t...
Orellana-Guerrero D, Renaudin C, Edwards L, Rose E, Aleman M, Moore PF, Dujovne G.Placentitis has been reported as the most important cause of equine abortions, stillbirths, and perinatal deaths in horses. Most cases are caused by bacteria and less commonly by fungal elements. The aim of this report is to describe the clinical presentation of a fungal placentitis caused by Aspergillus terrerus. A 5-year-old thoroughbred maiden mare at the 217th day of gestation presented with some classic signs of placentitis (premature udder development and milk dripping). All ultrasonographic findings were consistent with a live fetus and a severe placentitis. On vaginal examination, pur...
Nemoto M, Schofield W, Cullinane A.The objective of this study was to investigate the presence of equine coronavirus (ECoV) in clinical samples submitted to a diagnostic laboratory in Ireland. A total of 424 clinical samples were examined from equids with enteric disease in 24 Irish counties between 2011 and 2015. A real-time reverse transcription polymerase chain reaction was used to detect ECoV RNA. Nucleocapsid, spike and the region from the p4.7 to p12.7 genes of positive samples were sequenced, and sequence and phylogenetic analyses were conducted. Five samples (1.2%) collected in 2011 and 2013 tested positive for ECoV. Po...
Altan E, Li Y, Sabino-Santos G, Sawaswong V, Barnum S, Pusterla N, Deng X, Delwart E.Metagenomics was used to identify viral sequences in the plasma and CSF (cerobrospinal fluid) of 13 horses with unexplained neurological signs and in the plasma and respiratory swabs of 14 horses with unexplained respiratory signs. Equine hepacivirus and two copiparvoviruses (horse parvovirus-CSF and a novel parvovirus) were detected in plasma from neurological cases. Plasma from horses with respiratory signs contained the same two copiparvoviruses plus equine pegivirus D and respiratory swabs contained equine herpes virus 2 and 5. Based on genetic distances the novel copiparvovirus qualified ...
Gozalo-Marcilla M, Luna SPL, Gasthuys F, Schauvliege S.To perform a literature review of the thermal and mechanical antinociceptive devices used in pharmacological studies in standing horses published after 2011 (2012-2019). To complete a full literature review about electrical stimulation used for evaluation in similar studies. Methods: PubMed, Google Scholar and Web of Science. Conclusions: A high level of standardization has been reached in antinociceptive studies in standing horses using thermal and mechanical stimuli in most recent years. Commercially available testing devices to deliver thermal, mechanical and electrical stimuli, with observ...
Spence KL, Cardwell JM, Slater J, Rosanowski SM.The potential for an exotic disease incursion is a significant concern for the United Kingdom (UK) equine industry. Horse owners' perceptions of, and attitudes towards, exotic diseases can influence decisions to adopt disease preparedness strategies. The objectives of this study were to describe horse owners' 1) perceptions of the term 'exotic disease', and 2) attitudes towards their risk of being affected by an exotic disease. In order to address these objectives, qualitative content analysis was undertaken on data collected using two open-ended survey questions. Results: Horse owners (n =â€...
Hassel DM, Hill AE, Rorabeck RA.Glucose homeostasis is dysregulated in critically ill humans resulting in hyperglycemia and decreased survival. Hyperglycemia is common in horses presenting with abdominal crisis, and this might be associated with a worse prognosis for survival. Objective: To determine if hyperglycemia in horses with acute abdominal disease is associated with increased odds of failure to survive to hospital discharge. Methods: Two hundred and twenty-eight adult horses with acute gastrointestinal disease. Methods: Observational retrospective study. Records of horses > 1 year of age presenting for treatment o...
Tóth F, Frank N, Elliott SB, Geor RJ, Boston RC.To evaluate the effects of endotoxin administered IV on glucose and insulin dynamics in horses. Methods: 16 healthy adult mares. Methods: Each week of a 2-week randomized crossover study, each horse received an IV injection (duration, 30 minutes) of Escherichia coli O55:B5 lipopolysaccharide (LPS) in 60 mL of sterile saline (0.9% NaCl) solution (20 ng/kg) or sterile saline solution alone (control treatment). Frequently sampled IV glucose tolerance test procedures were performed at 24 hours before (baseline) and 24 and 48 hours after injection; glucose and insulin dynamics were assessed via min...
Crowley J, Po E, Celi P, Muscatello G.Oxidative stress (OS) is most simply defined as an imbalance between oxidants and antioxidants. Oxidative stress has been suggested to play roles in various equine respiratory diseases and the significance of OS in the pathogenesis of Rhodococcus equi pneumonia is unknown. Objective: To measure and relate biomarkers of OS to lesions consistent with R. equi pneumonia. Methods: Case-control study. Methods: Various OS biomarkers were measured from blood and exhaled breath condensate (EBC) samples collected from 26 foals between 1 and 2 months of age (n = 12 cases and n = 14 controls) on 2 Thoro...
Kraus MS, Rishniw M, Divers TJ, Reef VB, Gelzer AR.Evaluate accuracy and utility of a smartphone-based ECG device compared to a standard base-apex lead ECG in horses. Methods: ECGs were acquired prospectively from 28 client-owned horses at 2 equine referral hospitals. Twenty-five pairs of 30-s ECG recordings were acquired simultaneously from 23 horses with a smartphone ECG device (a bi-polar single lead recorder coupled to a smartphone with an ECG application) and with a standard base-apex lead ECG; 2 horses provided two pairs of simultaneously acquired ECGs. In one horse, the ECGs pairs were recorded immediately sequentially. An additional 7 ...
Scheuerle MC, Stear MJ, Honeder A, Becher AM, Pfister K.The selective treatment of horses is used to decrease the number of anthelmintic treatments by only treating a proportion of animals in the population. One way to select animals for treatment is to identify low and high egg-shedders using faecal egg counts (FEC); then to treat only the high egg-shedders. The value of this method is enhanced if differences among individuals in the level of egg-shedding remain consistent over time. One way to assess the stability of the rankings of animals over time is to measure the repeatability which is defined as the variance between horses divided by the to...
Pirie RS, Jago RC, Hudson NP.Equine grass sickness (EGS; equine dysautonomia) is a polyneuronopathy affecting both the central and the peripheral nervous systems of horses. As the name implies, EGS almost exclusively affects grazing horses, resulting in the development of a characteristic array of clinical signs, most of which can be attributed to neuronal degeneration in the autonomic and enteric nervous systems. Varying disease severities occur, largely determined by the extent of neuronal degeneration in the myenteric and submucous plexuses of the enteric nervous system. Extensive neuronal degeneration, as seen in acut...
Coleman SJ, Zeng Z, Hestand MS, Liu J, Macleod JN.Sequencing of equine mRNA (RNA-seq) identified 428 putative transcripts which do not map to any previously annotated or predicted horse genes. Most of these encode the equine homologs of known protein-coding genes described in other species, yet the potential exists to identify novel and perhaps equine-specific gene structures. A set of 36 transcripts were prioritized for further study by filtering for levels of expression (depth of RNA-seq read coverage), distance from annotated features in the equine genome, the number of putative exons, and patterns of gene expression between tissues. From ...
Christley RM, French NP.The topology of the network of contacts between individuals has important effects on infectious disease dynamics within a population. Here we examine for the first time a network of contacts between training yards that occurred through racing. Objective: To explore the topology of this network and to consider the effects of the network on the potential for disease transmission. Methods: Race data from one week was analysed. Contacts were defined as occurring between trainers that raced horses in the same race and hence one trainer could contact another trainer several times. A connection was s...
Kalck KA.This article discusses types of inflammatory bowel disease in horses, including pathologic findings and proposed causes. The diagnosis of inflammatory bowel disease is presented in detail, including minimum database, rectal palpation, abdominal ultrasound, abdominocentesis, biopsy procedures, and absorption tests. Treatment recommendations and prognosis are also discussed.
Tulamo RM, Bramlage LR, Gabel AA.Infectious arthritis was induced experimentally in one tarsocrural joint of six horses by intra-articular injection of 1 ml Staphylococcus-saline suspension containing 9 x 10(4) to 3 x 10(6) organisms. The corresponding contralateral joint was injected with 1 ml of saline and served as a control. The progression of the induced infectious arthritis was assessed over a nine-day period by clinical examination and sequential synovial fluid analysis with pH and lactate measurements. Changes in synovial fluid were present before clinical signs of infectious arthritis were manifested. The diagnostic ...
Cordoni G, Williams A, Durham A, Florio D, Zanoni RG, La Ragione RM.Strangles is one of the most common equine infectious diseases with serious health, welfare and socio-economic impact. However, the detection of Streptococcus equi subspecies equi can be challenging and persistently infected carriers are common. Furthermore, the use of classical microbiology can result in an underestimation of the prevalence of the disease. The difficulties associated with the slow diagnosis of Strangles can result in rapid spread of the disease. Therefore, rapid and economical diagnostic tests are urgently required. Here, two multiplex assays, were developed and validated for...
von Teichman BF, Smit TK.The polyvalent African Horsesickness (AHS) attenuated live vaccine (ALV) produced by Onderstepoort Biological Products (OBP) Ltd., South Africa, has been associated with some safety concerns and alleged cases of vaccine failure or vaccine-induced disease. The risk of reassortment and reversion to virulence is a common concern associated with the use of ALVs, and a phenomenon reported for viruses with segmented RNA genomes. The purpose of this study was to determine whether or not reassortment of AHS vaccine strains could result in reassortants and reversion to virulence and therefore cause AHS...
Pihl TH, Scheepers E, Sanz M, Goddard A, Page P, Toft N, Andersen PH, Jacobsen S.The acute phase proteins (APP) serum amyloid A (SAA), haptoglobin, and fibrinogen are valuable blood biomarkers in equine inflammatory diseases, but knowledge of factors influencing their concentrations in blood and peritoneal fluid (PF) of horses with colic is needed. Objective: The objective of this study was to investigate the influence of demographics (age, sex, breed), disease process (simple obstruction, strangulating obstruction, inflammatory), disease location, disease duration, hypovolemia, and admission hospital on concentrations of APP, lactate and white blood cell counts (WBC) in h...
Pitzer JB, Kaufman PE, Tenbroeck SH, Maruniak JE.A species-specific multiplex polymerase chain reaction targeting the cytochrome b gene of cattle, horses, humans, and dogs was developed to determine the blood meal sources of stable flies, Stomoxys calcitrans (L.), collected from Florida equine facilities. Of 595 presumptive blood-fed stable flies analyzed, successful host amplification was obtained in 350, for a field host-detection efficiency of 58.8%. The majority of analyzed stable flies had fed on cattle (64.6%), followed by horses (24.3%), humans (9.5%), and dogs (1.6%). A survey of animal-enclosed pastures occurring within 3 km of stab...
Nemoto M, Morita Y, Niwa H, Bannai H, Tsujimura K, Yamanaka T, Kondo T.A reverse transcription loop-mediated isothermal amplification (RT-LAMP) assay was developed for the rapid detection of equine coronavirus (ECoV). This assay was conducted at 60 °C for 40 min. Specificity of the RT-LAMP assay was confirmed using several equine intestinal and respiratory pathogens in addition to ECoV. The novel assay failed to cross-react with the other pathogens tested, suggesting it is highly specific for ECoV. Using artificially synthesized ECoV RNA, the 50% detection limit of the RT-LAMP assay was 10(1.8)copies/reaction. This is a 50-fold greater sensitivity than conventio...
Dill SG, Correa MT, Erb HN, deLahunta A, Kallfelz FA, Waldron C.A case-control study was done to identify factors associated with the development of equine degenerative myeloencephalopathy (EDM). Questionnaires were mailed to the owners of 146 horses admitted to the New York State College of Veterinary Medicine between November 1978 and June 1987 and diagnosed as having EDM by histologic examination. Questionnaires also were sent to owners of 402 clinically normal horses admitted to the college during the same period. Data were compared between the EDM-affected and control groups (56 and 179 questionnaires returned, respectively). Risk factors identified i...
Hamond C, Pestana CP, Rocha-de-Souza CM, Cunha LE, Brandão FZ, Medeiros MA, Lilenbaum W.Leptospirosis is a zoonotic disease of global importance, and has a worldwide distribution. Equine leptospirosis is commonly manifested by recurrent uveitis, reproductive disorders, as abortions, embryonic absorption, stillbirth and the birth of weak foals. The aim of this study was to verify the presence of Leptospira sp or its DNA in genital tract of mares with reproductive problems. A total of 38 mares with reproductive problems were studied. All the mares were sampled for blood (for serology), urine (for culturing and qPCR), vaginal fluid-VF and endometrial biopsy-EB (for culturing, qPCR a...
Hurley DJ, Parks RJ, Reber AJ, Donovan DC, Okinaga T, Vandenplas ML, Peroni JF, Moore JN.Administration of black walnut heartwood extract (BWHE) via nasogastric tube induces acute laminitis in horses. However, the processes responsible for the development of laminitis, including laminitis induced with BWHE, remain unclear. The results of recent studies indicate that administration of BWHE initiates an inflammatory response in the laminar tissues and that this response may be due to extravasation of activated leukocytes from the circulation. This study examines the effects of BWHE administration on the dynamics of circulating neutrophils and monocytes, and the capacity of blood leu...
Unger-Torroledo L, Straub R, Lehmann AD, Graber F, Stahl C, Frey J, Gerber V, Hoppeler H, Baum O.The lethal toxin of Clostridium sordellii (TcsL) evokes severe, mostly fatal disease patterns like toxic shock syndrome in humans and animals. Since this large clostridial toxin-induced severe muscle damaging when injected intramuscularly into mice, we hypothesized that TcsL is also associated with equine atypical myopathy (EAM), a fatal myodystrophy of hitherto unknown etiology. Transmission electron microscopy revealed skeletal and heart muscles of EAM-affected horses to undergo degeneration ultrastructurally similar to the damage found in TcsL-treated mice. Performing immunohistochemistry, ...
Hodgkinson JE, Freeman KL, Lichtenfels JR, Palfreman S, Love S, Matthews JB.The efficacy of five daily fenbendazole (FBZ) treatments was tested against benzimidazole-resistant cyathostomins in naturally infected horses (n=13). Horses were treated with pyrantel embonate (PYR) to remove adult strongyles followed, 7 days later, by a 5-day course of FBZ. The PYR treatment produced an average faecal egg count reduction of 98%. All samples were negative by faecal egg count 7 days after the start of the FBZ treatment. Positive egg counts were observed from 28 days after the start of FBZ treatment and all horses displayed positive faecal egg counts by 77 days after treatment....
Madigan JE, Pusterla N.Equine granulocytic and monocytic ehrlichiosis caused by Ehrlichia equi and E. risticii, respectively, are seasonal diseases in horses that occur throughout the United States E. equi is transmitted by lxodes ticks and causes high fever, depression, anorexia, limb edema, petechiation, icterus, ataxia, and stiffness in gait. E. risticii, also known as the agent of Potomac horse fever, causes a febrile illness with a colitis of variable severity. Its occurrence is associated with aquatic habitats. The natural route of transmission is oral, through the ingestion of E. risticii infected trematode s...
Biswas B, Vemulapalli R, Dutta SK.Ehrlichia risticii, the causative agent of Potomac horse fever, has recently been isolated from many vaccinated horses with typical clinical signs of the disease. The heterogeneity of the E. risticii isolates obtained from the vaccinated horses necessitates the identification of the molecular basis of strain variations to elucidate the vaccine failure and to aid in the development of an efficient vaccine against this disease. As an attempt, two major cross-reacting surface antigen genes of 50- and 85-kDa antigens, present separately in strains 25-D (isolated in 1984) and 90-12 (isolated in 199...
Zhang J, Timoney PJ, Shuck KM, Seoul G, Go YY, Lu Z, Powell DG, Meade BJ, Balasuriya UB.In 2006-2007, equine viral arteritis (EVA) was confirmed for the first time in Quarter Horses in multiple states in the USA. The entire genome of an equine arteritis virus (EAV) isolate from the index premises in New Mexico was 12 731 nt in length and possessed a previously unrecorded unique 15 nt insertion in the nsp2-coding region in ORF1a and a 12 nt insertion in ORF3. Sequence analysis of additional isolates made during this disease occurrence revealed that all isolates from New Mexico, Utah, Kansas, Oklahoma and Idaho had 98.6-100.0 % (nsp2) and 97.8-100 % (ORF3) nucleotide identity and c...
Mealey RH, Leib SR, Pownder SL, McGuire TC.Equine infectious anemia virus (EIAV) is a lentivirus that causes persistent infection in horses. The appearance of antigenically distinct viral variants during recurrent viremic episodes is thought to be due to adaptive immune selection pressure. To test this hypothesis, we evaluated envelope SU cloned sequences from five severe combined immunodeficient (SCID) foals infected with EIAV. Within the SU hypervariable V3 region, 8.5% of the clones had amino acid changes, and 6.4% had amino acid changes within the known cytotoxic T lymphocyte (CTL) epitope Env-RW12. Of all the SU clones, only 3.1% ...
Bloch N, Breen M, Spradbrow PB.Seventy six formalin-fixed paraffin-embedded sarcoids from 62 Australian horses, collected over a ten year period, were examined for the presence of genomic sequences from bovine papillomavirus 1 and 2 (BPV1, BPV2) with the polymerase chain reaction (PCR). Sequences that could be amplified by primers specific for BPV1 and BPV2 were present in 56 of the 76 sarcoids (73%). A restriction site present in BPV1 and absent from BPV2 was detected in 28 of 34 amplified products that were treated with endonuclease.
De Cock HE, Affolter VK, Wisner ER, Ferraro GL, MacLachlan NJ.A condition characterized by progressive swelling, hyperkeratosis, and fibrosis of the distal limbs has been recognized in Shire, Clydesdale, and Belgian draft horses. This chronic progressive disease starts at an early age, progresses throughout the life of the horse, and often ends in disfigurement and disability of the limbs that inevitably leads to the horse's premature death. This study was undertaken to better characterize this disease. Results: Six affected horses were donated for diagnostic workup. A detailed clinical, radiologic, gross, and histologic description is given in this repo...
Pihl TH, Scheepers E, Sanz M, Goddard A, Page P, Toft N, Kjelgaard-Hansen M, Andersen PH, Jacobsen S.To investigate the diagnostic potential of the concentrations of acute-phase proteins serum amyloid A (SAA), haptoglobin (Hp), and fibrinogen in blood and peritoneal fluid (PF) for differentiating horses with inflammatory colic (entero-colitis and peritonitis) from those with surgical colic. Methods: Prospective observational multicenter study. Methods: Two university referral hospitals. Methods: Horses referred for severe acute abdominal pain to Hospital 1 (n = 148) or Hospital 2 (n = 78). Methods: Blood and PF samples collected at admission were used for acute-phase protein concentration...
Hewetson M, Cohen ND, Love S, Buddington RK, Holmes W, Innocent GT, Roussel AJ.A urine sucrose test has recently been reported to be a reliable method of detecting gastric ulcers in horses; however, technical difficulties associated with urine collection have limited the practical value of the test. The objective of this pilot study was to determine whether gastric sucrose permeability, as evaluated by serum sucrose concentration, could be used to detect gastric mucosal injury in horses. Twelve adult horses with naturally acquired gastric ulceration were studied. After a 20-hour nonfeeding period, each horse was dosed with 250 g of sucrose via nasogastric intubation. Blo...
Buczkowska J, Kozdrowski R, Nowak M, RaÅ› A, Mrowiec J.Equine endometrosis is a multifactorial disease considered to be a one of the most important causes of equine infertility, especially in older mares. This article reviews the current knowledge of equine endometrosis: pathogenesis, diagnosis, and optional treatment. Also describes the histomorphological and immunohistochemical characterization of endometrosis as well as potential etiological factors which may influence disease progression. Unfortunately, the etiology and pathogenesis of endometrosis still remains unclear, and consequently no effective treatment has been proposed so far. Therefo...
Kamber R, Farah Z, Rusch P, Hassig M.A major problem in camel productivity is the high mortality rate of camel calves in the first 3 months. The causes for mortality are mainly poor management practice and infectious diseases. The purpose of this research, carried out on a ranch in Kenya, was to determine the immunoglobulin G (IgG) concentration in camel colostrum as well as the extent of the calves' passive immunization by maternal antibodies. IgG concentration in colostrum and in the serum of the calf were measured during the first 3 d of life. Evaluation was carried out by comparing the respective values with those for horses ...