The study of diseases in horses encompasses a wide range of conditions affecting equine health, including infectious diseases, metabolic disorders, and genetic abnormalities. These diseases can impact various systems within the horse, such as respiratory, gastrointestinal, and musculoskeletal systems, and can lead to significant health challenges. Research in this area focuses on understanding the pathophysiology, diagnosis, prevention, and treatment of equine diseases. Common diseases studied include equine influenza, equine herpesvirus, and laminitis. This page provides access to peer-reviewed research studies and scholarly articles that explore the etiology, clinical presentation, and management strategies of diseases in horses, contributing to the advancement of equine veterinary medicine.
Rivas VN, Aleman M, Peterson JA, Dahlgren AR, Hales EN, Finno CJ.Juvenile idiopathic epilepsy (JIE) is an inherited disease characterized by recurrent seizures during the first year of life in Egyptian Arabian horses. Definitive diagnosis requires an electroencephalogram (EEG) performed by a veterinary specialist. A recent study has suggested that a 19 base-pair deletion, along with a triple-C insertion, in intron five of twelve (∆19InsCCC; chr20:29542397-29542425: GTTCAGGGGACCACATGGCTCTCTATAGA>TATCTTAAGACCC) of the () gene is associated with JIE. To confirm this association, a new sample set consisting of nine EEG-phenotyped affected and nine unaffec...
Kydd JH, Hannant D, Robinson RS, Bryant N, Osterrieder N.Equid herpesvirus-1 (EHV-1) causes respiratory and neurological disease and late gestation abortion in pregnant mares. Current vaccines contain either inactivated or live EHV-1, but fail to provide complete clinical or virological protection, namely prevention of nasopharyngeal shedding and cell-associated viraemia. Thus, the development of novel products, such as modified live virus (MLV) vaccines which stimulate virus-specific, humoral and cell mediated immune responses more effectively remains a priority. Two groups of weaned foals (n = 6 each group) were used in a longitudinal, prospec...
Álvarez-Narváez S, Giguère S, Anastasi E, Hearn J, Scortti M, Vázquez-Boland JA.Antibiotic use has been linked to changes in the population structure of human pathogens and the clonal expansion of multidrug-resistant (MDR) strains among healthcare- and community-acquired infections. Here we present a compelling example in a veterinary pathogen, , the causative agent of a severe pulmonary infection affecting foals worldwide. We show that the (46) gene responsible for emerging macrolide resistance among equine isolates in the United States is part of a 6.9-kb transposable element, Tn, actively mobilized by an IS family transposase. Tn is carried on an 87-kb conjugative pla...
Orellana-Guerrero D, Renaudin C, Edwards L, Rose E, Aleman M, Moore PF, Dujovne G.Placentitis has been reported as the most important cause of equine abortions, stillbirths, and perinatal deaths in horses. Most cases are caused by bacteria and less commonly by fungal elements. The aim of this report is to describe the clinical presentation of a fungal placentitis caused by Aspergillus terrerus. A 5-year-old thoroughbred maiden mare at the 217th day of gestation presented with some classic signs of placentitis (premature udder development and milk dripping). All ultrasonographic findings were consistent with a live fetus and a severe placentitis. On vaginal examination, pur...
Fernandes CB, Ball BA, Loux SC, Boakari YL, Scoggin KE, El-Sheikh Ali H, Cogliati B, Esteller-Vico A.Anatomical and molecular changes in the cervical barrier in women are a fundamental part of the pathogenesis of pregnancy loss associated with chorioamnionitis. However, there is little information regarding changes in the cervix associated with ascending infection in pregnant mares. To better characterize morphological and molecular changes in the cervix during placentitis, we examined full thickness histology and mRNA expression for a number of inflammatory and endocrine factors in the mucosa and stroma of the cervix of mares (n = 5) after experimental induction of placentitis via transc...
Nemoto M, Schofield W, Cullinane A.The objective of this study was to investigate the presence of equine coronavirus (ECoV) in clinical samples submitted to a diagnostic laboratory in Ireland. A total of 424 clinical samples were examined from equids with enteric disease in 24 Irish counties between 2011 and 2015. A real-time reverse transcription polymerase chain reaction was used to detect ECoV RNA. Nucleocapsid, spike and the region from the p4.7 to p12.7 genes of positive samples were sequenced, and sequence and phylogenetic analyses were conducted. Five samples (1.2%) collected in 2011 and 2013 tested positive for ECoV. Po...
Altan E, Li Y, Sabino-Santos G, Sawaswong V, Barnum S, Pusterla N, Deng X, Delwart E.Metagenomics was used to identify viral sequences in the plasma and CSF (cerobrospinal fluid) of 13 horses with unexplained neurological signs and in the plasma and respiratory swabs of 14 horses with unexplained respiratory signs. Equine hepacivirus and two copiparvoviruses (horse parvovirus-CSF and a novel parvovirus) were detected in plasma from neurological cases. Plasma from horses with respiratory signs contained the same two copiparvoviruses plus equine pegivirus D and respiratory swabs contained equine herpes virus 2 and 5. Based on genetic distances the novel copiparvovirus qualified ...
Spence KL, Cardwell JM, Slater J, Rosanowski SM.The potential for an exotic disease incursion is a significant concern for the United Kingdom (UK) equine industry. Horse owners' perceptions of, and attitudes towards, exotic diseases can influence decisions to adopt disease preparedness strategies. The objectives of this study were to describe horse owners' 1) perceptions of the term 'exotic disease', and 2) attitudes towards their risk of being affected by an exotic disease. In order to address these objectives, qualitative content analysis was undertaken on data collected using two open-ended survey questions. Results: Horse owners (n =...
Bourély C, Cazeau G, Jarrige N, Jouy E, Haenni M, Lupo A, Madec JY, Leblond A, Gay E.To examine the relevance of co-resistance to amoxicillin and tetracycline as an indicator of multidrug resistance (MDR) in animal health. Methods: isolates collected between 2012 and 2016 by the French surveillance network for antimicrobial resistance in diseased animals (RESAPATH) were analyzed. The proportions of MDR isolates and the proportions of isolates presenting co-resistance to amoxicillin and tetracycline were calculated for seven animal species (cattle, horse, dog, swine, poultry, duck, and turkey). The degree of agreement between these two proportions was estimated by calculating ...
Bellone RR, Ocampo NR, Hughes SS, Le V, Arthur R, Finno CJ, Penedo MCT.Catastrophic fractures are among the most common cause of fatalities in racehorses. Several factors, including genetics, likely contribute to increased risk for fatal injuries. A variant in the procollagen-lysine, 2-oxoglutarate 5-dioxygenase1 gene (PLOD1 c.2032G>A) was shown to cause Warmblood fragile foal syndrome type 1 (WFFS), a fatal recessive defect of the connective tissue. Screening of multiple horse breeds identified the presence of the WFFS allele in the Thoroughbred. PLOD1 is involved in cross-linking of collagen fibrils and thus could potentially increase the risk of catastrophic b...
Burden FA, Bell N.The domestic donkey is a unique equid species with specific nutritional requirements. This article examines the importance of feeding strategies that mimic the donkey's natural environment using poor nutritional quality fibers and access to browsing materials. The relationship between nutrition and health is examined and practical approaches to the healthy and sick donkey are discussed.
Thiemann AK, Sullivan RJE.A review of common gastrointestinal disorders of donkeys and mules is presented. Clinically relevant aspects of donkey behavior, anatomy, and physiology are highlighted. Diagnosis, management, and treatment of conditions affecting the gastrointestinal tract from stomach to rectum, including liver and pancreas, are discussed.
Wernery U, Rodriguez Caveney M, Wernery R, Raghavan R, Laroucau K, Syriac G, Thomas SM, John J, Joseph M, Jose S, Joseph S, Woo P.Six horses were challenged experimentally with a strain of Burkholderia pseudomallei isolated from a fatal case of the infection in a dromedary camel years earlier in the Emirate of Dubai. Three horses were inoculated subcutaneously and in 3 the bacterium was administered by the oral route. Four of the horses became serologically positive based on reactions to one or more of the OIE described tests for glanders. B. pseudomallei was re-isolated from the 4 serological positive horses. Only one of the subcutaneously infected horses, developed fever for 3 days. The white blood cell values and the ...
Bosco-Lauth AM, Bowen RA.West Nile virus (WNV) (Flaviviridae: Flavivirus) was discovered in Africa more than 80 yr ago and became recognized as an avian pathogen and a cause of neurologic disease in horses largely during periodic incursions into Europe. Introduction of WNV into North America stimulated great anxiety, particularly in the equine industry, but also for pet owners and livestock producers concerned about the effect of WNV on other domestic animals. Numerous subsequent studies of naturally occurring and experimentally induced disease greatly expanded our understanding of the host range and clinical conseque...
Slenter IJM, Hermans H, Ensink JM, Willems DS, Veraa S, Grinwis GCM, Boevé MH.To describe ultrasonography as a diagnostic method of in vivo Descemet's membrane detachment (DMD) in horses. Methods: Seven horses (three Icelandic horses, two Dutch Warmblood horses, one Appaloosa, and one Welsh Pony), presenting with moderate-to-severe focal or diffuse corneal edema, in whom DMD was suspected on ultrasonographic examination and confirmed with histopathology, were studied. Methods: A retrospective analysis of case records of horses with suspected DMD was performed. Results: Median age at presentation was 14 years (range 11-24). Clinical signs in eyes with DMD were unilatera...
To evaluate the etiology of skeletal changes noted in equid vertebrae from a 19- century context near Belgrade, Serbia. A vertebral column consisting of 15 fused thoracic vertebrae (T2-T16), with right ribs fused to T4 and T5 and small remnants of ribs articulating with T4, T5 and T6 on the left side were accidentally recovered during industrial exploitation of sand. The specimen was subjected to morphological analysis and collagen fingerprinting by mass spectrometry for species identification. In order to determine the absolute temporal context, radiocarbon dating was employed. Pathological c...
Manso-Díaz G, Bolt DM, López-Sanromán J.Ultrasonographic visualisation of the mesenteric vasculature of the large colon (LC) from the right side of the abdomen in cases of displacement and volvulus has been described. However, the LC can move freely within the abdomen and its mesentery can potentially contact both sides of the abdominal wall. Methods: Thirty-four horses presented with LC-related colic that had visible LC mesenteric vasculature visible on abdominal ultrasound were included. A control group was made including horses with confirmed small intestinal-related colic. The objective of this study was to evaluate the visibili...
Pechacek D, Hwangbo M, Moreland R, Liu M, Ramsey J. 4s is a Gram-negative bacterium found in the equine intestinal ecosystem alongside diverse other coliform bacteria and bacteriophages. This announcement describes the complete genome of the T7-like 4s podophage Penshu1. From its 39,263-bp genome, 54 protein-encoding genes and a 179-bp terminal repeat were predicted.
Singer-Berk MH, Knickelbein KE, Lounsberry ZT, Crausaz M, Vig S, Joshi N, Britton M, Settles ML, Reilly CM, Bentley E, Nunnery C, Dwyer A....Squamous cell carcinoma (SCC) is the most common periocular cancer in horses and the second most common tumor of the horse overall. A missense mutation in damage-specific DNA-binding protein 2 (DDB2, c.1012 C>T, p.Thr338Met) was previously found to be strongly associated with ocular SCC in Haflinger and Belgian horses, explaining 76% of cases across both breeds. To determine if this same variant in DDB2 contributes to risk for ocular SCC in the Arabian, Appaloosa, and Percheron breeds and to determine if the variant contributes to risk for oral or urogenital SCC, histologically confirmed SCC c...
Scholtzek AD, Hanke D, Walther B, Eichhorn I, Stöckle SD, Klein KS, Gehlen H, Lübke-Becker A, Schwarz S, Feßler AT.The detection of borderline oxacillin-resistant (BORSA) represents a challenge to both, veterinary and human laboratories. Between 2015 and 2017, 19 equine with elevated minimal inhibitory concentrations for oxacillin were detected in routine diagnostics. The aim of this study was to characterize these isolates to identify factors possibly associated with the BORSA phenotype. All were subjected to antimicrobial susceptibility testing and whole genome sequencing (WGS). A quantifiable β-lactamase activity assay was performed for a representative subset of 13 isolates. The WGS data analysis o...
Tyrrell JD, Qurollo BA, Tornquist SJ, Schlaich KG, Kelsey J, Chandrashekar R, Breitschwerdt EB.Certain vector-borne organisms serve as etiological agents of equine disease. After previously identifying a new Ehrlichia species in horses from Mérida, we aimed to determine the infection frequency and screen for a wide range of vector-borne organisms from 93 tick-exposed, Ehrlichia seropositive horses in this region. PCR assays were performed to identify infection by organisms within the following genera: Anaplasma, Babesia, Bartonella, Ehrlichia, Leishmania, Mycoplasma, Neorickettsia, Rickettsia and Theileria. Overall, 90/93 horses (96.8%) were infected with one or more vector-borne organ...
Di Rubbo A, McNabb L, Klein R, White JR, Colling A, Dimitrov DS, Broder CC, Middleton D, Lunt RA.Maintenance of Hendra virus (HeV) in pteropid bat populations has been associated with spillover events in horses, humans and dogs. Experimental studies have demonstrated infections for several other species including guinea pigs, cats and ferrets. The criteria of a sensitive and specific serological test that is effective for a range of species, but which does not require use of live virus, has not been satisfactorily addressed by currently available tests. We have evaluated the use of two HeV neutralizing monoclonal antibodies (mAbs) in a blocking format enzyme-linked immunosorbent assay (bE...
Börjesson S, Greko C, Myrenås M, Landén A, Nilsson O, Pedersen K.The aim of this study was to investigate the occurrence of the newly described transferable colistin resistance gene mcr-9 in extended-spectrum β-lactamase (ESBL)-producing clinical Enterobacteriaceae isolates from horses in Sweden. A total of 56 whole-genome sequenced ESBL-producing Enterobacteriaceae isolates from horses were subjected to in silico detection of antimicrobial resistance genes and identification of plasmid replicons types. The colistin minimum inhibitory concentration (MIC) for mcr-positive isolates was determined by broth microdilution. Relatedness between Enterobacteriaceae...
León B, Jiménez C, González R, Ramirez-Carvajal L.The first complete coding sequence of the Venezuelan equine encephalitis virus IE, isolated from a Costa Rican mare with severe encephalitis, was confirmed by histological and viral whole-genome analyses. The isolated virus grouped in the Pacific cluster.
Long AE, Javsicas LH, Stokol T, Felippe MJB, Frimberger AE.A 17-year-old Friesian gelding was examined at a referral hospital because of a 1-month history of mild exercise intolerance and marked lymphocytosis. Physical examination revealed no peripheral lymphadenopathy or other abnormalities. Results of an abdominal palpation examination per rectum and thoracic and abdominal ultrasonographic examinations were unremarkable. B-cell chronic lymphocytic leukemia (CLL) was diagnosed on the basis of severe lymphocytosis and positive expression of the B-cell marker CD20 by lymphocytes in the bone marrow and peripheral blood. Treatment with prednisolone (2 mg...
Farah Haziqah MT, Nur Hikmah AM, Mat Hasan H, Hamdan A, Nik Him NAII.An investigation was undertaken for screening and isolating nematophagous-fungi from the faecal samples of various grazing animals and soils in Malaysia. Total of 111 faeces and 50 soil samples were collected and the samples were cultured on 2% water agar plates. The growth of nematophagous-fungi was stimulated by sprinkling-baiting technique. The conidia of suspected nematophagous-fungi were inoculated on 2% water agar plates. All isolated were maintained on 2% cornmeal agar plates. Verticillium spp., Fusarium spp. and Arthrobotrys spp. were identified from the faecal and soil samples. 62.5% ...
Bueno I, Pearce P, Dunowska M. To estimate the frequency of infection with equine herpesvirus type-1 (EHV-1) among horses from the central North Island of New Zealand, including the frequency of detection of the D genotype. Samples of retropharyngeal lymph nodes (RLN) and submandibular lymph nodes (SLN) were dissected from the heads of 63 horses that were humanely killed for various unrelated reasons between March and November 2015. DNA extracted from these tissues was subjected to enrichment for EHV-1 sequences by hybridisation with biotin-labelled EHV-1 specific probe, followed by recovery of EHV-1 sequences on streptavi...
Jin S, Issel CJ, Montelaro RC.We recently reported a highly protective attenuated live virus vaccine for equine infectious anemia virus (EIAV) based on a proviral construct (EIAVUKDeltaS2) with a genetically engineered mutation in the viral S2 gene that eliminates expression of this accessory protein. While the EIAVUKDeltaS2 vaccine provides protection from detectable infection by experimental challenge with highly virulent virus, the potential for commercial application of this vaccine is complicated by the fact that horses inoculated with the EIAVUKDeltaS2 vaccine strain become seropositive in various reference diagnosti...
Monzon CM, Mancebo OA, Russo AM.An ELISA test was used to determine the persistence of antibody levels in horses following treatment for Trypanosoma evansi. In 17 horses with T. evansi from two farms treated and cured with quinapyramine sulphate, ELISA antibody levels fell progressively post-treatment, but remained with positive results for 22.6 months in one horse, 12.8 months in a second, 4.1 months in another four and 2.3 months in three, whilst the rest became negative at 2.3 months. In two horses that suffered a post-treatment infection relapse the decrease in ELISA levels was only temporary, and a new increase in antib...
Dunkel B, Johns IC.To discuss controversies surrounding antimicrobial use in critically ill horses. Methods: PubMed searches from 1970-present for terms including, but not limited to: "horse," "foal," "antimicrobial," "prophylaxis," "infection," "surgery," "sepsis," and "antimicrobial resistance." Results: Increasing bacterial antimicrobial resistance has changed first-line antimicrobial choices and prompted shortening of the duration of prophylactic and therapeutic treatment. The need to decrease bacterial resistance development to critically important antimicrobials has been highlighted. Results: Veterinary me...
O'Brien TJ, Hollinshead F, Goodrich LR.Osteoarthritis (OA) is a common joint disease affecting humans and horses, resulting in significant morbidity, financial expense, and loss of athletic use. While the pathogenesis is incompletely understood, inflammation is considered crucial in the development and progression of the disease. Mesenchymal stromal cells (MSCs) have received increasing scientific attention for their anti-inflammatory, immunomodulatory, and pro-regenerative effects. However, there are concerns about their ability to become a commercially available therapeutic. Extracellular vesicles (EVs) are now recognized to play...
Anderson JR, Johnson E, Jenkins R, Jacobsen S, Green D, Walters M, Bundgaard L, Hausmans BAC, van den Akker G, Welting TJM, Chabronova A, Kharaz YA....Extracellular vesicles (EVs) contribute to osteoarthritis pathogenesis through their release into joint tissues and synovial fluid. Synovial fluid-derived EVs have the potential to be direct biomarkers in the causal pathway of disease but also enable understanding of their role in disease progression. Utilizing a temporal model of osteoarthritis, we defined the changes in matched synovial fluid and plasma-derived EV small non-coding RNA and protein cargo using sequencing and mass spectrometry. Data exploration included time series clustering, factor analysis and gene enrichment interrogation. ...
Osterrieder K, Dorman DC, Burgess BA, Goehring LS, Gross P, Neinast C, Pusterla N, Hussey GS, Lunn DP.Equine herpes virus type 1 (EHV-1) infection in horses is associated with respiratory and neurologic disease, abortion, and neonatal death. Objective: Vaccines decrease the occurrence of clinical disease in EHV-1-infected horses. Methods: A systematic review was performed searching multiple databases to identify relevant studies. Selection criteria were original peer-reviewed research reports that investigated the in vivo use of vaccines for the prevention of disease caused by EHV-1 in domesticated horses. Main outcomes of interest included pyrexia, abortion, neurologic disease, viremia, and n...
Jose-Cunilleras E, Kohn CW, Hillier A, Saville WJ, Lorch G.To compare responses to a variety of intradermally injected allergens among healthy horses and horses with chronic obstructive pulmonary disease (COPD), recurrent urticaria (RU), and atopic dermatitis-insect hypersensitivity (allergic dermatitis [AD]). Methods: Case-control study. Methods: 86 horses. Methods: Results of intradermal testing for horses with COPD, RU, or AD were compared with results for healthy horses. Results: Compared with healthy horses, horses with COPD, RU, and AD were significantly more likely to have positive (> or = 3+) reactions to intradermal allergens (molds, weeds, t...
Cantón GJ, Navarro MA, Asin J, Chu P, Henderson EE, Mete A, Uzal FA.Reproductive failure represents an important cause of economic loss for the equine industry. We reviewed the cases of equine abortion and stillbirth submitted to the California Animal Health and Food Safety Laboratory System, University of California-Davis from 1990 to 2022. A total of 1,774 cases were reviewed. A confirmed cause of abortion was determined in 29.2% of the cases. Abortion or stillbirth was attributed to infectious agents in 18.7% of the cases, with Streptococcus spp., equine herpesvirus 1, and Leptospira spp. being the most prevalent. Noninfectious causes of abortion were estab...
LeBlanc MM, Tran T, Baldwin JL, Pritchard EL.Effects of farm management, breed, mare age, gestation duration, and climatologic factors on colostral specific gravity, colostral IgG concentration, and foal serum IgG concentration were evaluated. Climatologic variables measured were daily maximal, minimal, and mean air temperature, precipitation, average relative humidity, and total solar radiation. Presuckle, postpartum colostrum samples were collected from 140 Standardbred, 94 Thoroughbred, and 59 Arabian mares from January through June during 1985 and 1986. Thoroughbred (farm A, n = 61; farm B, n = 33) and Arabian (farm C, n = 45; farm D...
Halldórdsóttir S, Larsen HJ.A survey of summer eczema was conducted on 391 Icelandic horses in Norway. The study showed a prevalence of summer eczema of 17.6 per cent in the horses investigated. Icelandic horses born in Norway where shown to be less affected with summer eczema than imported horses, 8.2 per cent and 26.9 per cent respectively (P less than 0.001). There was no difference in the prevalence of summer eczema relative to gender or colour of the horse. The number of horses affected with summer eczema rose with increasing age and the number of years which had elapsed since importation. On average, Icelandic hors...
Mendoza L, Villalobos J, Calleja CE, Solis A.Two vaccines to treat phythiosis insidiosi in horses were evaluated in 71 Costa Rican horses between 1982 to 1988. One vaccine used a cell-mass (CMV) as antigen and the other a soluble concentrated antigen (SCAV). Both vaccines cured horses infected with Pythium insidiosum (p value approximately 14%). The age of lesions prior to vaccination was important in the response of the horses to immunotherapy. All horses with lesions 0.5 months or less in duration were cured regardless of the vaccine used. Horses with lesions two or more months old did not respond to either vaccine. The age of the hors...
Büttgen L, Geibel J, Simianer H, Pook T.Osteochondrosis dissecans (OCD) is a degenerative disease of the cartilage leading to osseous fragments in the joints. It is important in horse breeding both from an animal welfare and an economic perspective. To study adequate breeding strategies to reduce OCD prevalence, a lifelike simulation of the breeding program of German Warmblood horses was performed with the R package MoBPS. We simulated complex breeding schemes of riding horses with different selection steps and realistic age structure, mimicking the German situation. As an example, osseous fragments in fetlock and hock joints were c...
Ringger NC, Giguère S, Morresey PR, Yang C, Shaw G.Neonatal hypoxic-ischemic encephalopathy (NHIE) is a disease affecting newborn foals for which there is no antemortem diagnostic test. Objective: Ubiquitin C-terminal hydrolase 1 (UCHL1) and the phosphorylated axonal forms of neurofilament H (pNF-H) are markers of brain injury in foals with NHIE. Methods: Thirty-three foals with a clinical diagnosis consistent with NHIE and 17 healthy foals. Methods: Retrospective study. Concentrations of UCHL1 and pNF-H in plasma were measured by ELISA. The performance of the assays for the diagnosis of NHIE was assessed by receiver operating characteristic c...
Strand E, Fjordbakk CT, Holcombe SJ, Risberg A, Chalmers HJ.Dynamic laryngeal collapse (DLC) associated with poll flexion is a newly diagnosed upper respiratory tract obstructive disorder that causes poor racing performance. Objective: To determine if Norwegian Coldblooded Trotters (NCTs) affected with DLC associated with poll flexion differ from normal, elite NCTs based on simple airway mechanics measurements. Methods: Five normal elite NCTs and 6 NCTs diagnosed previously with DLC underwent treadmill videoendoscopy while tracheal pressures were measured continuously. Alternating head positions were used such that horses were exercised with free head ...
Rushton JO, Kolodziejek J, Tichy A, Nell B, Nowotny N.A herd of Lipizzaners (n=266) in three locations [Federal stud Piber (Styria), Heldenberg (Lower Austria) and the Spanish Riding School Vienna (Vienna)] were examined for ocular diseases and tested for herpesviruses (HVs) in PBMCs, nasal- and conjunctival swabs. In 167 (62.8%) horses equid herpesvirus-2 (EHV-2) nucleic acid was identified in at least one of the investigated samples, and 136 (51.1%) horses were positive for equid herpesvirus-5 (EHV-5) nucleic acid in at least one of the samples. One hundred and five (39.5%) of the horses mentioned above were identified with EHV-2/EHV-5 double i...
Steinman A, Navon-Venezia S.Antimicrobial resistance (AMR) is an increasingly recognized global public health threat to the modern health-care system that could hamper the control and treatment of infectious diseases [...].
González-Medina S, Montesso F, Chang YM, Hyde C, Piercy RJ.Several pasture management strategies have been proposed to avoid hypoglycin A (HGA) intoxication in horses, but their efficacy has never been investigated. Objective: To evaluate the effect of mowing and herbicidal spraying on HGA content of sycamore seedlings and the presence of HGA in seeds and seedlings processed within haylage and silage. Methods: Experimental study. Methods: Groups of seedlings were mowed (n = 6), sprayed with a dimethylamine-based (n = 2) or a picolinic acid-based herbicide (n = 1). Seedlings were collected before intervention, and at 48 h, 1 and 2 weeks after. ...
Copy number variation (CNV) has been proved to be widespread in human, animal and plant genomes. Together with single nucleotide polymorphisms (SNPs), CVNs play a key role in genetic diversity. In this study, genome-wide detection of CNVs was performed based on SNP data from 24 Criollo Argentino horses genotyped with the GGP Equine70k array. Overall, 165 CNVs meeting stringent quality control criteria were identified and then aggregated into 87 CNV regions (CNVRs), representing a horse genome coverage of 13.69 Mb. Functional analysis of CNVRs allowed the identification of 337 genes implicate...