Analyze Diet

Topic:Disease

The study of diseases in horses encompasses a wide range of conditions affecting equine health, including infectious diseases, metabolic disorders, and genetic abnormalities. These diseases can impact various systems within the horse, such as respiratory, gastrointestinal, and musculoskeletal systems, and can lead to significant health challenges. Research in this area focuses on understanding the pathophysiology, diagnosis, prevention, and treatment of equine diseases. Common diseases studied include equine influenza, equine herpesvirus, and laminitis. This page provides access to peer-reviewed research studies and scholarly articles that explore the etiology, clinical presentation, and management strategies of diseases in horses, contributing to the advancement of equine veterinary medicine.
TRIM39-RPP21 Variants (∆19InsCCC) Are Not Associated with Juvenile Idiopathic Epilepsy in Egyptian Arabian Horses.
Genes    October 16, 2019   Volume 10, Issue 10 816 doi: 10.3390/genes10100816
Rivas VN, Aleman M, Peterson JA, Dahlgren AR, Hales EN, Finno CJ.Juvenile idiopathic epilepsy (JIE) is an inherited disease characterized by recurrent seizures during the first year of life in Egyptian Arabian horses. Definitive diagnosis requires an electroencephalogram (EEG) performed by a veterinary specialist. A recent study has suggested that a 19 base-pair deletion, along with a triple-C insertion, in intron five of twelve (∆19InsCCC; chr20:29542397-29542425: GTTCAGGGGACCACATGGCTCTCTATAGA>TATCTTAAGACCC) of the () gene is associated with JIE. To confirm this association, a new sample set consisting of nine EEG-phenotyped affected and nine unaffec...
Vaccination of foals with a modified live, equid herpesvirus-1 gM deletion mutant (RacHΔgM) confers partial protection against infection.
Vaccine    October 16, 2019   Volume 38, Issue 2 388-398 doi: 10.1016/j.vaccine.2019.09.106
Kydd JH, Hannant D, Robinson RS, Bryant N, Osterrieder N.Equid herpesvirus-1 (EHV-1) causes respiratory and neurological disease and late gestation abortion in pregnant mares. Current vaccines contain either inactivated or live EHV-1, but fail to provide complete clinical or virological protection, namely prevention of nasopharyngeal shedding and cell-associated viraemia. Thus, the development of novel products, such as modified live virus (MLV) vaccines which stimulate virus-specific, humoral and cell mediated immune responses more effectively remains a priority. Two groups of weaned foals (n = 6 each group) were used in a longitudinal, prospec...
Clonal Confinement of a Highly Mobile Resistance Element Driven by Combination Therapy in Rhodococcus equi.
mBio    October 15, 2019   Volume 10, Issue 5 e02260-19 doi: 10.1128/mBio.02260-19
Álvarez-Narváez S, Giguère S, Anastasi E, Hearn J, Scortti M, Vázquez-Boland JA.Antibiotic use has been linked to changes in the population structure of human pathogens and the clonal expansion of multidrug-resistant (MDR) strains among healthcare- and community-acquired infections. Here we present a compelling example in a veterinary pathogen, , the causative agent of a severe pulmonary infection affecting foals worldwide. We show that the (46) gene responsible for emerging macrolide resistance among equine isolates in the United States is part of a 6.9-kb transposable element, Tn, actively mobilized by an IS family transposase. Tn is carried on an 87-kb conjugative pla...
Fungal Placentitis Caused by Aspergillus terreus in a Mare: Case Report.
Journal of equine veterinary science    October 15, 2019   Volume 83 102799 doi: 10.1016/j.jevs.2019.102799
Orellana-Guerrero D, Renaudin C, Edwards L, Rose E, Aleman M, Moore PF, Dujovne G.Placentitis has been reported as the most important cause of equine abortions, stillbirths, and perinatal deaths in horses. Most cases are caused by bacteria and less commonly by fungal elements. The aim of this report is to describe the clinical presentation of a fungal placentitis caused by Aspergillus terrerus. A 5-year-old thoroughbred maiden mare at the 217th day of gestation presented with some classic signs of placentitis (premature udder development and milk dripping). All ultrasonographic findings were consistent with a live fetus and a severe placentitis. On vaginal examination, pur...
Uterine cervix as a fundamental part of the pathogenesis of pregnancy loss associated with ascending placentitis in mares.
Theriogenology    October 14, 2019   Volume 145 167-175 doi: 10.1016/j.theriogenology.2019.10.017
Fernandes CB, Ball BA, Loux SC, Boakari YL, Scoggin KE, El-Sheikh Ali H, Cogliati B, Esteller-Vico A.Anatomical and molecular changes in the cervical barrier in women are a fundamental part of the pathogenesis of pregnancy loss associated with chorioamnionitis. However, there is little information regarding changes in the cervix associated with ascending infection in pregnant mares. To better characterize morphological and molecular changes in the cervix during placentitis, we examined full thickness histology and mRNA expression for a number of inflammatory and endocrine factors in the mucosa and stroma of the cervix of mares (n = 5) after experimental induction of placentitis via transc...
The First Detection of Equine Coronavirus in Adult Horses and Foals in Ireland.
Viruses    October 14, 2019   Volume 11, Issue 10 946 doi: 10.3390/v11100946
Nemoto M, Schofield W, Cullinane A.The objective of this study was to investigate the presence of equine coronavirus (ECoV) in clinical samples submitted to a diagnostic laboratory in Ireland. A total of 424 clinical samples were examined from equids with enteric disease in 24 Irish counties between 2011 and 2015. A real-time reverse transcription polymerase chain reaction was used to detect ECoV RNA. Nucleocapsid, spike and the region from the p4.7 to p12.7 genes of positive samples were sequenced, and sequence and phylogenetic analyses were conducted. Five samples (1.2%) collected in 2011 and 2013 tested positive for ECoV. Po...
Viruses in Horses with Neurologic and Respiratory Diseases.
Viruses    October 14, 2019   Volume 11, Issue 10 942 doi: 10.3390/v11100942
Altan E, Li Y, Sabino-Santos G, Sawaswong V, Barnum S, Pusterla N, Deng X, Delwart E.Metagenomics was used to identify viral sequences in the plasma and CSF (cerobrospinal fluid) of 13 horses with unexplained neurological signs and in the plasma and respiratory swabs of 14 horses with unexplained respiratory signs. Equine hepacivirus and two copiparvoviruses (horse parvovirus-CSF and a novel parvovirus) were detected in plasma from neurological cases. Plasma from horses with respiratory signs contained the same two copiparvoviruses plus equine pegivirus D and respiratory swabs contained equine herpes virus 2 and 5. Based on genetic distances the novel copiparvovirus qualified ...
Preliminary insight into horse owners’ perceptions of, and attitudes towards, exotic diseases in the United Kingdom.
BMC veterinary research    October 12, 2019   Volume 15, Issue 1 338 doi: 10.1186/s12917-019-2120-5
Spence KL, Cardwell JM, Slater J, Rosanowski SM.The potential for an exotic disease incursion is a significant concern for the United Kingdom (UK) equine industry. Horse owners' perceptions of, and attitudes towards, exotic diseases can influence decisions to adopt disease preparedness strategies. The objectives of this study were to describe horse owners' 1) perceptions of the term 'exotic disease', and 2) attitudes towards their risk of being affected by an exotic disease. In order to address these objectives, qualitative content analysis was undertaken on data collected using two open-ended survey questions. Results: Horse owners (n =...
Co-resistance to Amoxicillin and Tetracycline as an Indicator of Multidrug Resistance in Escherichia coli Isolates From Animals.
Frontiers in microbiology    October 9, 2019   Volume 10 2288 doi: 10.3389/fmicb.2019.02288
Bourély C, Cazeau G, Jarrige N, Jouy E, Haenni M, Lupo A, Madec JY, Leblond A, Gay E.To examine the relevance of co-resistance to amoxicillin and tetracycline as an indicator of multidrug resistance (MDR) in animal health. Methods: isolates collected between 2012 and 2016 by the French surveillance network for antimicrobial resistance in diseased animals (RESAPATH) were analyzed. The proportions of MDR isolates and the proportions of isolates presenting co-resistance to amoxicillin and tetracycline were calculated for seven animal species (cattle, horse, dog, swine, poultry, duck, and turkey). The degree of agreement between these two proportions was estimated by calculating ...
Clinical insights: Antimicrobials in an age of resistance.
Equine veterinary journal    October 5, 2019   Volume 51, Issue 6 711-713 doi: 10.1111/evj.13151
Mercer MA, Davis JL.No abstract available
Warmblood fragile foal syndrome type 1 mutation (PLOD1 c.2032G>A) is not associated with catastrophic breakdown and has a low allele frequency in the Thoroughbred breed.
Equine veterinary journal    October 4, 2019   Volume 52, Issue 3 411-414 doi: 10.1111/evj.13182
Bellone RR, Ocampo NR, Hughes SS, Le V, Arthur R, Finno CJ, Penedo MCT.Catastrophic fractures are among the most common cause of fatalities in racehorses. Several factors, including genetics, likely contribute to increased risk for fatal injuries. A variant in the procollagen-lysine, 2-oxoglutarate 5-dioxygenase1 gene (PLOD1 c.2032G>A) was shown to cause Warmblood fragile foal syndrome type 1 (WFFS), a fatal recessive defect of the connective tissue. Screening of multiple horse breeds identified the presence of the WFFS allele in the Thoroughbred. PLOD1 is involved in cross-linking of collagen fibrils and thus could potentially increase the risk of catastrophic b...
Donkey Nutrition and Malnutrition.
The Veterinary clinics of North America. Equine practice    October 3, 2019   Volume 35, Issue 3 469-479 doi: 10.1016/j.cveq.2019.08.004
Burden FA, Bell N.The domestic donkey is a unique equid species with specific nutritional requirements. This article examines the importance of feeding strategies that mimic the donkey's natural environment using poor nutritional quality fibers and access to browsing materials. The relationship between nutrition and health is examined and practical approaches to the healthy and sick donkey are discussed.
Gastrointestinal Disorders of Donkeys and Mules.
The Veterinary clinics of North America. Equine practice    October 3, 2019   Volume 35, Issue 3 419-432 doi: 10.1016/j.cveq.2019.08.001
Thiemann AK, Sullivan RJE.A review of common gastrointestinal disorders of donkeys and mules is presented. Clinically relevant aspects of donkey behavior, anatomy, and physiology are highlighted. Diagnosis, management, and treatment of conditions affecting the gastrointestinal tract from stomach to rectum, including liver and pancreas, are discussed.
Evaluation of serological responses in horses challenged with Burkholderia pseudomallei using current diagnostic tests for glanders.
Veterinaria italiana    September 30, 2019   Volume 55, Issue 3 261-267 doi: 10.12834/VetIt.1701.9026.2
Wernery U, Rodriguez Caveney M, Wernery R, Raghavan R, Laroucau K, Syriac G, Thomas SM, John J, Joseph M, Jose S, Joseph S, Woo P.Six horses were challenged experimentally with a strain of Burkholderia pseudomallei isolated from a fatal case of the infection in a dromedary camel years earlier in the Emirate of Dubai. Three horses were inoculated subcutaneously and in 3 the bacterium was administered by the oral route. Four of the horses became serologically positive based on reactions to one or more of the OIE described tests for glanders. B. pseudomallei was re-isolated from the 4 serological positive horses. Only one of the subcutaneously infected horses, developed fever for 3 days. The white blood cell values and the ...
Letter to the Editor: Response to letter regarding: Prospective, randomised clinical trial of four different presurgical hand antiseptic techniques in equine surgery.
Equine veterinary journal    September 25, 2019   Volume 52, Issue 1 158-159 doi: 10.1111/evj.13167
Biermann NM, McClure JT, Doyle AJ.No abstract available
West Nile Virus: Veterinary Health and Vaccine Development.
Journal of medical entomology    September 25, 2019   Volume 56, Issue 6 1463-1466 doi: 10.1093/jme/tjz125
Bosco-Lauth AM, Bowen RA.West Nile virus (WNV) (Flaviviridae: Flavivirus) was discovered in Africa more than 80 yr ago and became recognized as an avian pathogen and a cause of neurologic disease in horses largely during periodic incursions into Europe. Introduction of WNV into North America stimulated great anxiety, particularly in the equine industry, but also for pet owners and livestock producers concerned about the effect of WNV on other domestic animals. Numerous subsequent studies of naturally occurring and experimentally induced disease greatly expanded our understanding of the host range and clinical conseque...
Letter to the Editor: Is it time to replace the term ‘endometrosis’?
Equine veterinary journal    September 23, 2019   Volume 52, Issue 1 160 doi: 10.1111/evj.13172
Khan FA, Chenier TS.No abstract available
Clinical, ultrasonographic, and histopathologic findings in seven horses with Descemet’s membrane detachment: A case series.
Veterinary ophthalmology    September 22, 2019   Volume 23, Issue 1 181-189 doi: 10.1111/vop.12710
Slenter IJM, Hermans H, Ensink JM, Willems DS, Veraa S, Grinwis GCM, Boevé MH.To describe ultrasonography as a diagnostic method of in vivo Descemet's membrane detachment (DMD) in horses. Methods: Seven horses (three Icelandic horses, two Dutch Warmblood horses, one Appaloosa, and one Welsh Pony), presenting with moderate-to-severe focal or diffuse corneal edema, in whom DMD was suspected on ultrasonographic examination and confirmed with histopathology, were studied. Methods: A retrospective analysis of case records of horses with suspected DMD was performed. Results: Median age at presentation was 14 years (range 11-24). Clinical signs in eyes with DMD were unilatera...
A case study of vertebral fusion in a 19th-century horse from Serbia.
International journal of paleopathology    September 21, 2019   Volume 27 17-23 doi: 10.1016/j.ijpp.2019.07.007
To evaluate the etiology of skeletal changes noted in equid vertebrae from a 19- century context near Belgrade, Serbia. A vertebral column consisting of 15 fused thoracic vertebrae (T2-T16), with right ribs fused to T4 and T5 and small remnants of ribs articulating with T4, T5 and T6 on the left side were accidentally recovered during industrial exploitation of sand. The specimen was subjected to morphological analysis and collagen fingerprinting by mass spectrometry for species identification. In order to determine the absolute temporal context, radiocarbon dating was employed. Pathological c...
Ultrasonographic visualisation of the mesenteric vasculature in horses with large colon colic.
The Veterinary record    September 20, 2019   Volume 186, Issue 15 491 doi: 10.1136/vr.105468
Manso-Díaz G, Bolt DM, López-Sanromán J.Ultrasonographic visualisation of the mesenteric vasculature of the large colon (LC) from the right side of the abdomen in cases of displacement and volvulus has been described. However, the LC can move freely within the abdomen and its mesentery can potentially contact both sides of the abdominal wall. Methods: Thirty-four horses presented with LC-related colic that had visible LC mesenteric vasculature visible on abdominal ultrasound were included. A control group was made including horses with confirmed small intestinal-related colic. The objective of this study was to evaluate the visibili...
Complete Genome Sequence of Escherichia coli Podophage Penshu1.
Microbiology resource announcements    September 19, 2019   Volume 8, Issue 38 e01055-19 doi: 10.1128/MRA.01055-19
Pechacek D, Hwangbo M, Moreland R, Liu M, Ramsey J. 4s is a Gram-negative bacterium found in the equine intestinal ecosystem alongside diverse other coliform bacteria and bacteriophages. This announcement describes the complete genome of the T7-like 4s podophage Penshu1. From its 39,263-bp genome, 54 protein-encoding genes and a 179-bp terminal repeat were predicted.
Additional Evidence for DDB2 T338M as a Genetic Risk Factor for Ocular Squamous Cell Carcinoma in Horses.
International journal of genomics    September 15, 2019   Volume 2019 3610965 doi: 10.1155/2019/3610965
Singer-Berk MH, Knickelbein KE, Lounsberry ZT, Crausaz M, Vig S, Joshi N, Britton M, Settles ML, Reilly CM, Bentley E, Nunnery C, Dwyer A....Squamous cell carcinoma (SCC) is the most common periocular cancer in horses and the second most common tumor of the horse overall. A missense mutation in damage-specific DNA-binding protein 2 (DDB2, c.1012 C>T, p.Thr338Met) was previously found to be strongly associated with ocular SCC in Haflinger and Belgian horses, explaining 76% of cases across both breeds. To determine if this same variant in DDB2 contributes to risk for ocular SCC in the Arabian, Appaloosa, and Percheron breeds and to determine if the variant contributes to risk for oral or urogenital SCC, histologically confirmed SCC c...
Molecular Characterization of Equine Staphylococcus aureus Isolates Exhibiting Reduced Oxacillin Susceptibility.
Toxins    September 13, 2019   Volume 11, Issue 9 535 doi: 10.3390/toxins11090535
Scholtzek AD, Hanke D, Walther B, Eichhorn I, Stöckle SD, Klein KS, Gehlen H, Lübke-Becker A, Schwarz S, Feßler AT.The detection of borderline oxacillin-resistant (BORSA) represents a challenge to both, veterinary and human laboratories. Between 2015 and 2017, 19 equine with elevated minimal inhibitory concentrations for oxacillin were detected in routine diagnostics. The aim of this study was to characterize these isolates to identify factors possibly associated with the BORSA phenotype. All were subjected to antimicrobial susceptibility testing and whole genome sequencing (WGS). A quantifiable β-lactamase activity assay was performed for a representative subset of 13 isolates. The WGS data analysis o...
Molecular identification of vector-borne organisms in Ehrlichia seropositive Nicaraguan horses and first report of Rickettsia felis infection in the horse.
Acta tropica    September 10, 2019   Volume 200 105170 doi: 10.1016/j.actatropica.2019.105170
Tyrrell JD, Qurollo BA, Tornquist SJ, Schlaich KG, Kelsey J, Chandrashekar R, Breitschwerdt EB.Certain vector-borne organisms serve as etiological agents of equine disease. After previously identifying a new Ehrlichia species in horses from Mérida, we aimed to determine the infection frequency and screen for a wide range of vector-borne organisms from 93 tick-exposed, Ehrlichia seropositive horses in this region. PCR assays were performed to identify infection by organisms within the following genera: Anaplasma, Babesia, Bartonella, Ehrlichia, Leishmania, Mycoplasma, Neorickettsia, Rickettsia and Theileria. Overall, 90/93 horses (96.8%) were infected with one or more vector-borne organ...
Optimization and diagnostic evaluation of monoclonal antibody-based blocking ELISA formats for detection of neutralizing antibodies to Hendra virus in mammalian sera.
Journal of virological methods    September 9, 2019   Volume 274 113731 doi: 10.1016/j.jviromet.2019.113731
Di Rubbo A, McNabb L, Klein R, White JR, Colling A, Dimitrov DS, Broder CC, Middleton D, Lunt RA.Maintenance of Hendra virus (HeV) in pteropid bat populations has been associated with spillover events in horses, humans and dogs. Experimental studies have demonstrated infections for several other species including guinea pigs, cats and ferrets. The criteria of a sensitive and specific serological test that is effective for a range of species, but which does not require use of live virus, has not been satisfactorily addressed by currently available tests. We have evaluated the use of two HeV neutralizing monoclonal antibodies (mAbs) in a blocking format enzyme-linked immunosorbent assay (bE...
A link between the newly described colistin resistance gene mcr-9 and clinical Enterobacteriaceae isolates carrying blaSHV-12 from horses in Sweden.
Journal of global antimicrobial resistance    September 5, 2019   Volume 20 285-289 doi: 10.1016/j.jgar.2019.08.007
Börjesson S, Greko C, Myrenås M, Landén A, Nilsson O, Pedersen K.The aim of this study was to investigate the occurrence of the newly described transferable colistin resistance gene mcr-9 in extended-spectrum β-lactamase (ESBL)-producing clinical Enterobacteriaceae isolates from horses in Sweden. A total of 56 whole-genome sequenced ESBL-producing Enterobacteriaceae isolates from horses were subjected to in silico detection of antimicrobial resistance genes and identification of plasmid replicons types. The colistin minimum inhibitory concentration (MIC) for mcr-positive isolates was determined by broth microdilution. Relatedness between Enterobacteriaceae...
First Complete Coding Sequence of a Venezuelan Equine Encephalitis Virus Strain Isolated from an Equine Encephalitis Case in Costa Rica.
Microbiology resource announcements    September 5, 2019   Volume 8, Issue 36 e00672-19 doi: 10.1128/MRA.00672-19
León B, Jiménez C, González R, Ramirez-Carvajal L.The first complete coding sequence of the Venezuelan equine encephalitis virus IE, isolated from a Costa Rican mare with severe encephalitis, was confirmed by histological and viral whole-genome analyses. The isolated virus grouped in the Pacific cluster.
Rapid clinical progression of B-cell chronic lymphocytic leukemia in a horse.
Journal of the American Veterinary Medical Association    September 4, 2019   Volume 255, Issue 6 716-721 doi: 10.2460/javma.255.6.716
Long AE, Javsicas LH, Stokol T, Felippe MJB, Frimberger AE.A 17-year-old Friesian gelding was examined at a referral hospital because of a 1-month history of mild exercise intolerance and marked lymphocytosis. Physical examination revealed no peripheral lymphadenopathy or other abnormalities. Results of an abdominal palpation examination per rectum and thoracic and abdominal ultrasonographic examinations were unremarkable. B-cell chronic lymphocytic leukemia (CLL) was diagnosed on the basis of severe lymphocytosis and positive expression of the B-cell marker CD20 by lymphocytes in the bone marrow and peripheral blood. Treatment with prednisolone (2 mg...
Screening of nematophagous-fungi from fresh faeces of grazing animals and soils.
Tropical biomedicine    September 1, 2019   Volume 36, Issue 3 687-693 
Farah Haziqah MT, Nur Hikmah AM, Mat Hasan H, Hamdan A, Nik Him NAII.An investigation was undertaken for screening and isolating nematophagous-fungi from the faecal samples of various grazing animals and soils in Malaysia. Total of 111 faeces and 50 soil samples were collected and the samples were cultured on 2% water agar plates. The growth of nematophagous-fungi was stimulated by sprinkling-baiting technique. The conidia of suspected nematophagous-fungi were inoculated on 2% water agar plates. All isolated were maintained on 2% cornmeal agar plates. Verticillium spp., Fusarium spp. and Arthrobotrys spp. were identified from the faecal and soil samples. 62.5% ...
Frequency of latent equine herpesvirus type-1 infection among a sample of horses in the central North Island of New Zealand.
New Zealand veterinary journal    September 1, 2019   Volume 68, Issue 1 23-30 doi: 10.1080/00480169.2019.1653238
Bueno I, Pearce P, Dunowska M. To estimate the frequency of infection with equine herpesvirus type-1 (EHV-1) among horses from the central North Island of New Zealand, including the frequency of detection of the D genotype. Samples of retropharyngeal lymph nodes (RLN) and submandibular lymph nodes (SLN) were dissected from the heads of 63 horses that were humanely killed for various unrelated reasons between March and November 2015. DNA extracted from these tissues was subjected to enrichment for EHV-1 sequences by hybridisation with biotin-labelled EHV-1 specific probe, followed by recovery of EHV-1 sequences on streptavi...
1 62 63 64 65 66 481