DNA in horses refers to the genetic material that carries the hereditary information necessary for the growth, development, functioning, and reproduction of equine species. It consists of sequences of nucleotides that encode the genetic instructions used in the development and functioning of horses. DNA analysis in horses can provide insights into genetic diversity, lineage, and breed characteristics. It is also utilized in identifying genetic disorders, understanding hereditary traits, and assisting in selective breeding programs. This page compiles peer-reviewed research studies and scholarly articles that explore the structure, function, and applications of DNA analysis in equine genetics and breeding.
Jinglong X, Xiaobin L, Fang Z, Chenchen W, Kailun Y.The aim of this research was to isolate bacteria capable of biotransforming daidzein from fresh feces from pregnant horses. A Hungate anaerobic roller tube was used for anaerobic culture. Single colonies were picked at random and incubated with daidzein. High performance liquid chromatography was used to detect whether the isolated bacteria were able to biotransform the substrate. A strain capable of reducing daidzein was selected and characterized using sequence analysis of 16S rDNA, and a phylogenetic tree was constructed. The morphological physiological and biochemical characteristics of th...
Işık R, Özdil F.Leptin receptor is a fundamental regulator in physiological functions of the regulation of food intake, energy homeostasis, immune function, and reproduction as well as on ovarian follicular cells on the placenta and lactating mammary glands. The aim of this study was to investigate the LEPR gene polymorphism in 60 donkeys reared in Thrace region of Turkey. A 585 bp long partial intron 6, exon 7, intron 7, and exon 8 regions of LEPR gene were amplified, and polymerase chain reaction products analyzed via DNA sequencing. A novel single-nucleotide polymorphism (SNP) was identified as g.713668A>...
Smith RM, Kotzé A, Grobler JP, Dalton DL.Toll-like receptors (TLR) are a family of proteins that signal activation of the innate immune response through the recognition of a variety of pathogen molecular compounds. Here, we characterized the complete TLR9 gene in Cape mountain zebra (Equus zebra zebra) from three populations in South Africa and compared sequences to a variety of horse and donkey breeds. Overall, we identified six single nucleotide polymorpHisms (SNPs). A single SNP (G586S) was non-synonymous, whereas the remaining SNPs were synonymous. The G586S alteration was detected in Cape mountain zebra populations with varying ...
Asif M, Parveen A, Ashraf S, Hussain M, Aktas M, Ozubek S, Shaikh RS, Iqbal F.The present study was designed to check the molecular detection of Anaplasma marginale and Theileria annulata in blood samples of horses and donkeys collected from Dera Ghazi Khan District in Punjab and to document their phylogenetic origin and their association with studied epidemiological factors (sex and age) and complete blood count parameters, if any. Results: A total of 195 blood samples were collected from apparently healthy horses (N = 141) and donkeys (N = 54). A. marginale DNA was detected by PCR in 4.9% (7/141) horse and in 9.2% (5/54) of donkey blood samples. Prevalence of ...
Leite RO, Ferreira JF, Araújo CET, Delfiol DJZ, Takahira RK, Borges AS, Oliveira-Filho JP.Glanzmann's thrombasthenia (GT) is an autosomal recessive inherited disorder characterized by changes in platelet aggregation, leading to hemorrhage and epistaxis. To date, two independent mutations have been described in horses and associated with this disorder, a point mutation (c.122G > C) and a 10-base-pair deletion (g.1456_1466del) in the Integrin subunit alpha2β gene (ITGA2B) of horses of different breeds (Quarter Horse, Thoroughbred, Oldenburg, and Peruvian Paso). ITGA2B codifies the αIIb subunit of the αIIbβ3 integrin, also termed platelet fibrinogen receptor. Horses with GT have b...
Mei M, Chen R, Gao X, Cao Y, Weng W, Duan Y, Tan X, Liu Z.Meat fraud and adulteration incidents occur frequently in almost all regions of the globe, especially with the increase in the world's population. To ensure the authenticity of meat products, we developed a 10-plex xMAP assay to simultaneously detect ten animal materials: bovine, caprine, poultry, swine, donkey, deer, horse, dog, fox and mink. Results: This method was investigated by analyzing DNA extracts from raw muscle, muscle mixtures, meat products and animal feeds. Our results indicated that the species of interest can be identified, differentiated and detected down to 1 g kg in bina...
Centromeres exert an inhibitory effect on meiotic recombination, but the possible contribution of satellite DNA to this "centromere effect" is under debate. In the horse, satellite DNA is present at all centromeres with the exception of the one from chromosome 11. This organization of centromeres allowed us to investigate the role of satellite DNA on recombination suppression in horse spermatocytes at the stage of pachytene. To this aim we analysed the distribution of the MLH1 protein, marker of recombination foci, relative to CENP-A, marker of centromeric function. We demonstrated that the sa...
Riera FL, Roldán JE, Espinosa JM, Fernandez JE, Ortiz I, Hinrichs K.Embryo biopsy for fetal sexing has clinical application, but few reports are available of its use within an active embryo transfer program. We evaluated results on biopsy of 459 embryos over one breeding season. There were no significant differences in pregnancy rate between biopsied and non-biopsied embryos (72% vs 73%) or for biopsied embryos recovered at the centre (73%) compared with those shipped overnight (72%). However, the pregnancy rate decreased significantly in shipped embryos biopsied ≥20h after collection. Overall, 86% of biopsies provided a sex diagnosis. The likelihood of a po...
Ramsauer AS, Wachoski-Dark GL, Fraefel C, Tobler K, Brandt S, Knight CG, Favrot C, Grest P.There is growing evidence that equine papillomavirus type 2 (EcPV2) infection is causally associated with the development of equine genital squamous cell carcinomas (SCCs). Early stages of disease present clinically as plaques or wart-like lesions which can gradually progress to tumoural lesions. Histologically these lesions are inconsistently described as benign hyperplasia, papilloma, penile intraepithelial neoplasia (PIN), carcinoma in situ (CIS) or SCC. Guidelines for histological classification of early SCC precursor lesions are not precisely defined, leading to potential misdiagnosis. Th...
Denham J.Telomeres are genetically conserved nucleoprotein complexes located at the ends of chromosomes that preserve genomic stability. In large mammals, somatic cell telomeres shorten with age, owing to the end replication problem and lack of telomere-lengthening events (e.g. telomerase and ALT activity). Therefore, telomere length reflects cellular replicative reserve and mitotic potential. Environmental insults can accelerate telomere attrition in response to cell division and DNA damage. As such, telomere shortening is considered one of the major hallmarks of ageing. Much effort has been dedicate...
Pereira B, Dorado J, Diaz-Jimenez M, Consuegra C, Ortiz I, Gosalvez J, Hidalgo M.The acquisition of equine oocyte developmental capacity is ensured by the follicular environment, such as granulosa cells, which could reflect the meiotic development potential of immature oocytes. This study evaluated the relationship between DNA fragmentation of granulosa cells, using the chromatin dispersion test, and equine oocyte meiotic development after in vitro maturation. Granulosa cells and cumulus-oocytes complexes (n = 50) were recovered from slaughterhouse-derived ovaries. Oocytes were in vitro matured, stained and evaluated under fluorescence microscopy. Maturation rates were c...
Tanaka J, Leeb T, Rushton J, Famula TR, Mack M, Jagannathan V, Flury C, Bachmann I, Eberth J, McDonnell SM, Penedo MCT, Bellone RR.Mushroom is a unique coat color phenotype in Shetland Ponies characterized by the dilution of the chestnut coat color to a sepia tone and is hypothesized to be a recessive trait. A genome wide association study (GWAS), utilizing the Affymetrix 670K array (MNEc670k) and a single locus mixed linear model analysis (EMMAX), identified a locus on ECA7 for further investigation ( = 2.08 × 10). This locus contained a 3 Mb run of homozygosity in the 12 mushroom ponies tested. Analysis of high throughput Illumina sequencing data from one mushroom Shetland pony compared to 87 genomes from horses of var...
Neuhauser S, Bollwein H, Siuda M, Handler J.The aim of the present study was to evaluate the effect of different freezing procedures on sperm motion, viability, the acrosome status, mitochondrial membrane potential (MMP), intracellular calcium content, and DNA integrity on epididymal stallion sperm. Therefore, the sperm of 10 healthy stallions was harvested by retrograde flushing after testectomy, diluted with a semen extender containing defined milk proteins and a freezing extender containing egg yolk and glycerol and frozen according to 4 different protocols, using a programmable freezer and a floating rack performing a slow (processe...
Rivas VN, Aleman M, Peterson JA, Dahlgren AR, Hales EN, Finno CJ.Juvenile idiopathic epilepsy (JIE) is an inherited disease characterized by recurrent seizures during the first year of life in Egyptian Arabian horses. Definitive diagnosis requires an electroencephalogram (EEG) performed by a veterinary specialist. A recent study has suggested that a 19 base-pair deletion, along with a triple-C insertion, in intron five of twelve (∆19InsCCC; chr20:29542397-29542425: GTTCAGGGGACCACATGGCTCTCTATAGA>TATCTTAAGACCC) of the () gene is associated with JIE. To confirm this association, a new sample set consisting of nine EEG-phenotyped affected and nine unaffec...
Bellone RR, Ocampo NR, Hughes SS, Le V, Arthur R, Finno CJ, Penedo MCT.Catastrophic fractures are among the most common cause of fatalities in racehorses. Several factors, including genetics, likely contribute to increased risk for fatal injuries. A variant in the procollagen-lysine, 2-oxoglutarate 5-dioxygenase1 gene (PLOD1 c.2032G>A) was shown to cause Warmblood fragile foal syndrome type 1 (WFFS), a fatal recessive defect of the connective tissue. Screening of multiple horse breeds identified the presence of the WFFS allele in the Thoroughbred. PLOD1 is involved in cross-linking of collagen fibrils and thus could potentially increase the risk of catastrophic b...
Sukmawinata E, Sato W, Mitoma S, Kanda T, Kusano K, Kambayashi Y, Sato T, Ishikawa Y, Goto Y, Uemura R, Sueyoshi M.Extended-spectrum β-lactamase-producing Escherichia coli (ESBLEC) have become a major health concern in both human and veterinary medicine. These bacteria could become a critical problem in equine medicine due to the limited number of antimicrobial drugs available. However, there are no previous reports of ESBLEC isolated from horses in Japan. The objectives of this study were to investigate the occurrence of ESBLEC isolated from feces in healthy Thoroughbred racehorses in Japan. Feces samples were collected from 147 healthy Thoroughbred racehorses by equine veterinarians at the Japan Racing ...
Raudsepp T, Finno CJ, Bellone RR, Petersen JL.The horse reference genome from the Thoroughbred mare Twilight has been available for a decade and, together with advances in genomics technologies, has led to unparalleled developments in equine genomics. At the core of this progress is the continuing improvement of the quality, contiguity and completeness of the reference genome, and its functional annotation. Recent achievements include the release of the next version of the reference genome (EquCab3.0) and generation of a reference sequence for the Y chromosome. Horse satellite-free centromeres provide unique models for mammalian centromer...
Greiser T, Sieme H, Martinsson G, Distl O.Objectives of the present study were to estimate genetic parameters for frozen-thawed semen traits of 271 fertile German Warmblood stallions and genetic correlations with raw semen quality traits. Semen samples were collected from stallions utilized for semen collection and artificial insemination (AI) on the Lower Saxon National Stud Celle and the North Rhine-Westphalian National Stud Warendorf. Semen quality variables were analyzed in 63,972 raw (gel-free volume, concentration, progressive motility, number of sperm) and 3681 frozen-thawed samples (motility, DNA fragmentation index (DFI), non...
Del Prete C, Stout T, Montagnaro S, Pagnini U, Uccello M, Florio P, Ciani F, Tafuri S, Palumbo V, Pasolini MP, Cocchia N, Henning H.During cold storage stallion spermatozoa experience undergo oxidative stress, which can impair sperm function and fertilizing capacity. Superoxide dismutase (SOD), catalase (CAT) and glutathione peroxidase (GPX) are the main endogenous enzymatic antioxidants in stallion seminal plasma, and counteract reactive oxygen species. Semen dilution reduces the endogenous antioxidant concentrations. The aim of this study was to investigate whether addition of 15 IU/mL each of SOD, CAT, and GPX to diluted stallion semen would ameliorate a reactive oxygen-mediated decrease in semen quality during 72 h o...
Pechacek D, Hwangbo M, Moreland R, Liu M, Ramsey J. 4s is a Gram-negative bacterium found in the equine intestinal ecosystem alongside diverse other coliform bacteria and bacteriophages. This announcement describes the complete genome of the T7-like 4s podophage Penshu1. From its 39,263-bp genome, 54 protein-encoding genes and a 179-bp terminal repeat were predicted.
Greiser T, Sieme H, Martinsson G, Distl O.The objectives of the present study were to analyze systematic effects on semen quality traits from fresh and frozen-thawed semen collected in and outside season. A total of 4,681 reports on semen traits of 121 stallions representing Arabian, Thoroughbred, Quarter Horse and four warmblood breeds used for artificial insemination at the Lower Saxon National stud Celle were edited for analysis of gel-free volume, sperm concentration, total number of sperm and total number of motile sperm in fresh semen and in frozen-thawed semen progressive motility, DNA fragmentation index and non-viable sperm. ...
Pereira BC, Ortiz I, Dorado JM, Diaz-Jimenez MA, Consuegra C, Gosalvez J, Hidalgo M.DNA fragmentation of cumulus cells could be used as an indicator of oocyte vitrification success as an indirect indicator of the quality of the oocyte. This study was designed to compare the DNA fragmentation of post-mortem equine cumulus cells before or after vitrification in the absence of permeable cryoprotectant agents. Cumulus-oocyte complexes (COCs; n = 56) were recovered from slaughterhouse ovaries and subjected to in vitro maturation (42 hr/38.2°C/5%CO ) before (control group) or after a permeable cryoprotectant-free vitrification method using 1 M sucrose (vitrification group). Af...
Alpoim-Moreira J, Fernandes C, Rebordão MR, Amaral A, Pinto-Bravo P, Bliebernicht M, Skarzynski DJ, Ferreira-Dias G.Inflammation and fibroproliferative diseases may be modulated by epigenetic changes. Therefore, we suggest that epigenetic mechanisms could be involved in equine endometrosis pathogenesis. DNA methylation is one of the methods to evaluate epigenetics, through the transcription of methyltransferases (DNMT1, DNMT3A, DNMT3B). The correlation between DNMTs and collagen (COL) transcripts was assessed for the different Kenney and Doig's (Current Therapy in Theriogenology. Philadelphia: WB Saunders; 1986) endometrium categories. Endometrial biopsies were randomly collected from cyclic mares. Histolog...
Poirier M, Smith OE, Therrien J, Rigoglio NN, Miglino MA, Silva LA, Meirelles FV, Smith LC.Cell reprogramming by somatic cell nuclear transfer and in induced pluripotent stem cells is associated with epigenetic modifications that are often incompatible with embryonic development and differentiation. For instance, aberrant DNA methylation patterns of the differentially methylated region and biallelic expression of H19-/IGF2-imprinted gene locus have been associated with abnormal growth of fetuses and placenta in several mammalian species. However, cloned horses are born with normal sizes and with no apparent placental anomalies, suggesting that H19/IGF2 imprinting may be epigenetical...
Ripley AM, Penedo MCT, Grahn RA, Martinez de Andino EV, Walbornn SR, Serafini R, Love CC, Hinrichs K.Fetal genotyping has important applications in the horse, but currently necessitates embryo recovery and biopsy. We investigated whether fetal genotyping could be performed on yolk-sac fluid recovered from pregnant mares via transvaginal aspiration. Fluid was collected before Day 30 to provide results before establishment of the endometrial cups (Day 37). Genotyping and assessment of maternal DNA contamination was performed by analyzing histograms of PCR results for 19 loci. In Exp. 1, mares underwent yolk-sac aspiration on Days 22-28 of gestation. Fluid (0.56-1.02 mL) was recovered from fiv...
Dang W, Shang S, Zhang X, Yu Y, Irwin DM, Wang Z, Zhang S.Previous studies investigating donkey parentage and genetic diversity used horse-specific multiplex systems. However, several mis-allele and null-allele issues were found with some of the horse primers when used in donkeys. In 2017, the International Society for Animal Genetics (ISAG) recommended 13 dinucleotide short tandem repeats (STRs) (AHT4, ASB23, HMS2, HMS3, HMS6, HMS7, HMS18, HTG7, HTG10, TKY297, TKY312, TKY337 and TKY343) as a core panel that should be used to identify individuals and to test for parentage in donkeys. To date, no single multiplex STR typing system containing all 13 do...
Lechmann J, Schoster A, Ernstberger M, Fouché N, Fraefel C, Bachofen C.Equid alphaherpesvirus 1 (EHV-1) infections can have a major impact on the horse industry and equine welfare by causing abortion or respiratory or neurologic disease. A single nucleotide polymorphism (A→G) in open reading frame (ORF) 30, encoding the catalytic subunit of the DNA polymerase, has been shown to be a strong predictive marker for neuropathogenicity. Given that a previously established real-time PCR (rtPCR) protocol yielded unsatisfactory results concerning determination of the EHV-1 genotype, we developed and evaluated a new conventional PCR protocol enabling identification of th...
Sild E, Värv S, Kaart T, Kantanen J, Popov R, Viinalass H.The maternal and paternal genetic variation of horse breeds from the Baltic Sea region, including three local Estonian breeds, was assessed and compared with that of Altai and Yakutian horses. In the mtDNA D-loop region, 72 haplotypes assigned to 20 haplogroups in the nine breeds were detected. In Estonian local breeds, 38 mtDNA haplotypes were found, and five of them were shared by the three breeds. More than 60% of all identified haplotypes were rare. Compared with the Estonian Native and Estonian Heavy Draught breeds, a higher haplotypic diversity was found in the Tori breed (h = 0.969). ...
Bueno I, Pearce P, Dunowska M. To estimate the frequency of infection with equine herpesvirus type-1 (EHV-1) among horses from the central North Island of New Zealand, including the frequency of detection of the D genotype. Samples of retropharyngeal lymph nodes (RLN) and submandibular lymph nodes (SLN) were dissected from the heads of 63 horses that were humanely killed for various unrelated reasons between March and November 2015. DNA extracted from these tissues was subjected to enrichment for EHV-1 sequences by hybridisation with biotin-labelled EHV-1 specific probe, followed by recovery of EHV-1 sequences on streptavi...
Moro LN, Amin G, Furmento V, Waisman A, Garate X, Neiman G, La Greca A, Santín Velazque NL, Luzzani C, Sevlever GE, Vichera G, Miriuka SG.Cell reprogramming has been well described in mouse and human cells. The expression of specific microRNAs has demonstrated to be essential for pluripotent maintenance and cell differentiation, but not much information is available in domestic species. We aim to generate horse iPSCs, characterize them and evaluate the expression of different microRNAs (miR-302a,b,c,d, miR-205, miR-145, miR-9, miR-96, miR-125b and miR-296). Two equine iPSC lines (L2 and L3) were characterized after the reprogramming of equine fibroblasts with the four human Yamanaka's factors (OCT-4/SOX-2/c-MYC/KLF4). The plurip...
Boyle AG, Stefanovski D, Rankin SC.Streptococcus equi subsp equi (S. equi) is the cause of "equine strangles" which is a highly infectious upper respiratory disease. Detection of S. equi is influenced by site of specimen collection, method of sampling, and type of diagnostic test that is performed. We hypothesized i) that a loop-mediated isothermal amplification (LAMP) assay that targets the S. equi-specific eqbE gene would be more sensitive than a realtime PCR assay that targets the S. equi-specific seeI gene and ii) that LAMP of specimens obtained by guttural pouch lavage (GPL) would be more sensitive than LAMP of nasopharyng...
Maury W, Perryman S, Oaks JL, Seid BK, Crawford T, McGuire T, Carpenter S.The role of in vivo long terminal repeat (LTR) sequence variation of the lentivirus equine infectious anemia virus (EIAV) has not been explored. In this study, we investigated the heterogeneity found in the LTR sequences from seven EIAV-seropositive horses: three horses with clinical disease and four horses without any detectable signs of disease. LTR sequences were targeted in this study because the LTR U3 enhancer region of tissue culture-derived isolates has been identified as one of the few hypervariable regions of the EIAV genome. Furthermore, LTR variation may regulate EIAV expression in...
Balasuriya UB, Dobbe JC, Heidner HW, Smalley VL, Navarrette A, Snijder EJ, MacLachlan NJ.We have used an infectious cDNA clone of equine arteritis virus (EAV) and reverse genetics technology to further characterize the neutralization determinants in the GP5 envelope glycoprotein of the virus. We generated a panel of 20 recombinant viruses, including 10 chimeric viruses that each contained the ORF5 (which encodes GP5) of different laboratory, field, and vaccine strains of EAV, a chimeric virus containing the N-terminal ectodomain of GP5 of a European strain of porcine reproductive and respiratory syndrome virus, and 9 mutant viruses with site-specific substitutions in their GP5 pro...
Santagostino M, Piras FM, Cappelletti E, Del Giudice S, Semino O, Nergadze SG, Giulotto E.Interstitial telomeric sequences (ITSs) are short stretches of telomeric-like repeats (TTAGGG)n at nonterminal chromosomal sites. We previously demonstrated that, in the genomes of primates and rodents, ITSs were inserted during the repair of DNA double-strand breaks. These conclusions were derived from sequence comparisons of ITS-containing loci and ITS-less orthologous loci in different species. To our knowledge, insertion polymorphism of ITSs, i.e., the presence of an ITS-containing allele and an ITS-less allele in the same species, has not been described. In this work, we carried out a gen...
Côté O, Lillie BN, Hayes MA, Clark ME, van den Bosch L, Katavolos P, Viel L, Bienzle D.Secretoglobin 1A1 (SCGB 1A1), also called Clara cell secretory protein, is the most abundantly secreted protein of the airway. The SCGB1A1 gene has been characterized in mammals as a single copy in the genome. However, analysis of the equine genome suggested that horses might have multiple SCGB1A1 gene copies. Non-ciliated lung epithelial cells produce SCGB 1A1 during inhalation of noxious substances to counter airway inflammation. Airway fluid and lung tissue of horses with recurrent airway obstruction (RAO), a chronic inflammatory lung disease affecting mature horses similar to environmental...
Caffara M, Piva S, Pallaver F, Iacono E, Galuppi R.Fourteen Cryptosporidium isolates from hospitalized foals were genotyped and subtyped using PCR-RFLP analysis of the 18S rDNA. Cryptosporidium parvum and Cryptosporidium horse genotype were detected in 3 and 11 stool specimens, respectively. Sequences of the gp60 gene of Cryptosporidium horse genotype allowed identification of the subtype family VIaA15G4, defining a novel microsatellite pattern within horse subtype VIa. Cryptosporidium horse genotype has only been described occasionally worldwide and this is the first time it has been identified in foals from Italy.
Kashi Y, Tikochinsky Y, Genislav E, Iraqi F, Nave A, Beckmann JS, Gruenbaum Y, Soller M.Southern blots of genomic DNA from a variety of species digested by restriction endonucleases having a four-bp specificity, were probed with a bovine genomic clone consisting of seven tandem poly-TG stretches separated by a 29bp linker sequence. Highly variable DNA 'fingerprint' patterns were obtained in chicken, sheep, and horse, moderately variable DNA 'fingerprints' in mouse and man, and a monomorphic pattern in Drosophila. In chicken, horse and man a (TG)10 synthetic oligonucleotide probe gave results identical to those given by the bovine probe. Furthermore, in chicken the DNA fingerprint...
Kano I, Nagai F, Satoh K, Ushiyama K, Nakao T, Kano K.Genomic DNA for Na,K-ATPase alpha 1 subunit was obtained from libraries of horse kidney genomic DNA in Charon 4A and in EMBL3 bacteriophages by screening with the full sized cDNA probe of the alpha 1 subunit of rat Na,K-ATPase as probe. The gene spans 30 kb and consists of 23 exons and 22 intervening sequences. Intron-exon boundaries were analyzed. The protein-coding nucleotide sequence encodes 1016 amino acids with an Mr of 112,264. The putative amino acid sequence of horse alpha 1 is 96-97% homologous to those of other mammalian species.
Peters SE, Wakefield AE, Whitwell KE, Hopkin JM.Genetically distinct forms of Pneumocystis carinii infect several mammalian hosts. We report the amplification of P. carinii DNA from samples of two infected thoroughbred foal lungs by using primers designed from the sequence of a P. carinii mitochondrial rRNA gene; these primers also prime the amplification of P. carinii DNA from other hosts. The nucleotide sequence of part of the mitochondrial rRNA gene amplified from P. carinii infecting one of the foals was determined and found to be distinct from that of published rat-, rabbit-, ferret-, and human-derived P. carinii sequences.
Barlough JE, Rikihisa Y, Madigan JE.A nested polymerase chain reaction was developed for amplifying a 529-bp segment of the 16S ribosomal RNA gene of Ehrlichia risticii from equine buffy coat cells. Confirmation of identity of the amplified bands was accomplished by Southern hybridization and DNA sequencing. The study indicated a detection limit of > 10 copies of the target gene, and specificity for E. risticii as based on a panel of test rickettsiae. Ticks (Ixodes pacificus) collected in an area of northern California enzootic for equine monocytic ehrlichiosis were found to be negative for E. risticii DNA.
Darr CR, Moraes LE, Connon RE, Love CC, Teague S, Varner DD, Meyers SA.Mitochondrial DNA (mtDNA) copy number has been utilized as a measure of sperm quality in several species including mice, dogs, and humans, and has been suggested as a potential biomarker of fertility in stallion sperm. The results of the present study extend this recent discovery using sperm samples from American Quarter Horse stallions of varying age. By determining copy number of three mitochondrial genes, cytochrome b (CYTB), NADH dehydrogenase 1 (ND1) and NADH dehydrogenase 4 (ND4), instead of a single gene, we demonstrate an improved understanding of mtDNA fate in stallion sperm mitochond...
Cormier AC, Chalmers G, Zamudio R, Mulvey MR, Mather AE, Boerlin P.Conserved IncI1 and IncHI1 plasmids carrying blaCTX-M-1 have been found circulating in chickens and horses from continental Europe, respectively. In Canada, blaCTX-M-1 is overwhelmingly the most common blaCTX-M variant found in Escherichia coli from chicken and horses and can be recovered at lower frequencies in swine, cattle, and dogs. Whole-genome sequencing has identified a large genetic diversity of isolates carrying this variant, warranting further investigations into the plasmids carrying this gene. Therefore, the objective of this study was to describe the genetic profiles of blaCTX-M-1...
Bell KS, Philp JC, Christofi N, Aw DW.Two regions in the gene coding for 16S rRNA in Rhodococcus equi were selected as species-specific primer sequences for the polymerase chain reaction (PCR). PCR using these primers was tested against 10 strains of R. equi (including the type strain) and gave positive results for all but was negative for all other tested species of Rhodococcus; representatives of the most closely related genera and a number of other bacterial species. This method could therefore be used to identify this species which can infect the lungs or other organs of horses, pigs, humans and other animals.
Kovac M, Litvin YA, Aliev RO, Zakirova EY, Rutland CS, Kiyasov AP, Rizvanov AA.In this clinical study, for the first time we used the direct gene therapy to restore severe injuries of the suspensory ligament branch and superficial digital flexor tendon in horses (). We injected the plasmid DNA encoding two therapeutic species-specific growth factors: vascular endothelial growth factor 164 and fibroblast growth factor 2 at the site of injury in the suspensory ligament branch and tendon. Treatment effects were evaluated with the use of clinical observation and ultrasound imaging during a period of a few months. We showed that gene therapy used within a period of 2-3 mont...
Pusterla N, Leutenegger CM, Sigrist B, Chae JS, Lutz H, Madigan JE.A real-time quantitative PCR using the TaqMan fluorogenic detection system (TaqMan PCR) was established for identification of Ehrlichia risticii, the agent of Potomac horse fever (PHF). The TaqMan PCR identified an 85 base pair section of the 16S rRNA gene by use of a specific fluorogenic probe and two primers. This technique was specific for eight tested E. risticii strains. The TaqMan system identified 10 copies of a cloned section of the 16S rRNA gene of E. risticii. The sensitivity and specificity of the TaqMan PCR were similar to those of conventional nested PCR. The TaqMan PCR was evalua...
Janabi AHD, Kerkhof LJ, McGuinness LR, Biddle AS, McKeever KH.There are many choices for methods of extracting bacterial DNA for Next Generation Sequencing (NGS) from fecal samples. Here, we compare our modifications of a phenol/chloroform extraction method plus an inhibitor removal solution (C3) (ph/Chl+C3) to the PowerFecal® DNA Isolation Kit (MoBio-K). DNA quality and quantity coupled to NGS results were used to assess differences in relative abundance, Shannon diversity index, unique species, and principle coordinate analysis (PCoA) between biological replicates. Six replicate samples, taken from a single ball of horse feces manually collected from ...
Giara and Sarcidano are 2 of the 15 extant native Italian horse breeds with limited dispersal capability that originated from a larger number of individuals. The 2 breeds live in two distinct isolated locations on the island of Sardinia. To determine the genetic structure and evolutionary history of these 2 Sardinian breeds, the first hypervariable segment of the mitochondrial DNA (mtDNA) was sequenced and analyzed in 40 Giara and Sarcidano horses and compared with publicly available mtDNA data from 43 Old World breeds. Four different analyses, including genetic distance, analysis of molecular...
Argyle D, Ellsmore V, Gault EA, Munro AF, Nasir L.To determine the role of telomeres in cellular ageing in equids, we analysed telomere lengths in peripheral blood derived DNA samples from a panel of donkeys (Equus asinus) ranging from 2 to 30 years of age. The average telomere lengths ranged from 7 to 21 kbp and a statistically significant inverse correlation between telomere lengths and donor age was demonstrated. Similarly, telomere lengths in primary fibroblasts isolated from a horse (Equus equus) demonstrated telomeric loss with in vitro ageing when cultured to senescence. We extended this study to evaluate activity of the enzyme telomer...
Crossett B, Allen WR, Stewart F.Large quantities of an unusual 19 kDa protein (p19) are secreted into the lumen of the uterus of the mare (Equus caballus) during the oestrous cycle and early pregnancy. p19 associates strongly with the acellular capsule that surrounds the young horse conceptus and is believed to be important in maintaining pregnancy. Here we report the complete cDNA sequence encoding p19, its expression patterns in horse tissues and a Southern blot analysis of the gene in horse DNA. The predicted amino acid sequence of the p19 cDNA demonstrated a signal peptide of 18 residues and a mature protein of 162 resid...
Nielsen MK, Olsen SN, Lyons ET, Monrad J, Thamsborg SM.Strongyle parasites are ubiquitous in grazing horses, and the large strongyle Strongylus vulgaris is considered the most pathogenic helminth parasite of horses. Recent investigations have suggested an association between occurrence of this parasite and usage of selective therapy based on regular fecal egg counts. The established diagnostic method for S. vulgaris involves larval culture and subsequent morphological identification of third stage larvae under the microscope. Recently, a real-time PCR assay was developed and validated for the detection and semi-quantification of S. vulgaris eggs i...
Blackhall WJ, Kuzmina T, von Samson-Himmelstjerna G.Resistance to benzimidazoles (BZ) in the gastrointestinal nematodes of livestock is characterised by the presence of specific polymorphisms in the β-tubulin isotype 1 protein, a component of microtubules. The most prevalent polymorphism associated with resistance in nematodes infecting cattle, sheep, and goats is found at codon 200, with minor occurrences of polymorphisms at codons 167 and 198. In the cyathostomins that infect horses, however, a polymorphism at codon 167 appears to be more common than the codon 200 polymorphism. In the present study, a focussed analysis of PCR-amplified β-tu...
Wang J, Guo K, Li S, Liu D, Chu X, Wang Y, Guo W, Du C, Wang X, Hu Z.Salmonella enterica subsp. serovar Abortusequi is a major pathogen in horse and donkey herds, causing abortion in pregnant equids and resulting in enormous economic losses. A rapid and reliable method is urgently needed to detect . Abortusequi in herds where the disease is suspected. To achieve this goal, a TaqMan-based real-time PCR assay targeting the gene for the flagellin protein phase 2 antigen FljB was developed. This real-time PCR assay had high specificity, sensitivity, and reproducibility. The detection limit of the assay was 30 copies/μL of standard plasmid and 10 CFU/μL of bacter...
The centromere is the chromosomal locus essential for proper chromosome segregation. While the centromeric function is well conserved and epigenetically specified, centromeric DNA sequences are typically composed of satellite DNA and represent the most rapidly evolving sequences in eukaryotic genomes. The presence of satellite sequences at centromeres hampered the comprehensive molecular analysis of these enigmatic loci. The discovery of functional centromeres completely devoid of satellite repetitions and fixed in some animal and plant species represented a turning point in centromere biology...
Brama PA, Tekoppele JM, Bank RA, van Weeren PR, Barneveld A.This study aimed to examine whether biochemical characteristics of juvenile articular cartilage are changing during the first year post partum and whether they can be influenced by exercise at young age. Water, glycosaminoglycan (GAG), DNA, total collagen, hydroxylysine and hydroxylysylpyridinoline (HP) content were measured in articular cartilage of 43 foals that were subdivided into 3 groups (n = 15, 14 and 14) which were subjected to different exercise regimens from one week after birth to age 5 months. At the age of 5 months all foals were weaned and 8 foals were selected randomly from eac...
McDonnell A, Love S, Tait A, Lichtenfels JR, Matthews JB.Three nucleotide data sets, one nuclear (ITS-2) and two mitochondrial (COI and l-rRNA), have been investigated in order to determine relationships among species of Strongylinae and Cyathostominae, intestinal parasites of the horse. The data exhibited a strong mutational bias towards A and T and in the COI gene, silent sites appeared to saturate rapidly partly due to this substitution bias. Thus, the COI gene was found to be less phylogenetically informative than the l-rRNA and ITS-2 genes. Combined analysis of the l-rRNA and ITS-2 genes supported a monophyletic clade of the cyathostomes with T...
Pielberg G, Mikko S, Sandberg K, Andersson L.Grey horses are born coloured, turn progressively grey and often develop melanomas late in life. Grey shows an autosomal dominant inheritance and the locus has previously been mapped to horse chromosome 25 (ECA25), around the TXN gene. We have now developed eight new single nucleotide polymorphisms (SNPs) associated with genes on ECA25 using information on the linear order of genes on human chromosome 9q, as well as the human and mouse coding sequences. These SNPs were mapped in relation to the Grey locus using more than 300 progeny from matings between two Swedish Warmblood grey stallions and...
The Journal of heredityApril 4, 2020
Volume 111, Issue 3 287-293 doi: 10.1093/jhered/esaa009
Magdesian KG, Tanaka J, Bellone RR.Splashed white is a coat color pattern in horses characterized by extensive white patterning on the legs, belly, and face often accompanied by blue eyes and deafness. Three mutations in microphthalmia-associated transcription factor (MITF) and two mutations in Paired Box 3 (PAX3) have been identified that explain splashed white patterns (SW1-SW5). An American Paint Horse stallion with a splashed white phenotype and blue eyes, whose parents were not white patterned, was negative for the 5 known splashed white variants and other known white spotting alleles. This novel splashed white phenotype (...
Teixeira RB, Rendahl AK, Anderson SM, Mickelson JR, Sigler D, Buchanan BR, Coleman RJ, McCue ME.Both graying and melanoma formation in horses have recently been linked to a duplication in the STX17 gene. This duplication, as well as a mutation in the ASIP gene that increases MC1R pathway signaling, affects melanoma risk and severity in gray horses. Objective: To determine if melanoma susceptibility in gray Quarter Horses (QH) is lower than gray horses from other breeds because of decreased MC1R signaling resulting from a high incidence of the MC1R chestnut coat color allele in the QH population. Methods: A total of 335 gray QH with and without dermal melanomas. Methods: Blood or hair roo...
Kim CH, Casey JW.Equine infectious anemia virus (EIAV) is a lentivirus that infects and persists in the monocyte/macrophage populations of blood and tissues. We employed polymerase chain reaction to investigate the distribution and the level of genome variability of EIAV DNA in different tissues of a horse infected with a highly virulent variant of the Wyoming strain of the virus. Long terminal repeat, gag, and pol primer pairs were used to direct the amplification of EIAV DNA from the peripheral blood mononuclear cells and from cells, presumably the macrophage subtypes, of the kidney, spleen, liver, lymph nod...