Analyze Diet

Topic:Epidemiology

Epidemiology in horses involves the study of the distribution and determinants of health-related states and events in equine populations. It encompasses the investigation of patterns, causes, and effects of diseases and health conditions within horse populations. This field of study aims to identify risk factors for disease and targets for preventive healthcare. Key components of equine epidemiology include disease surveillance, outbreak investigation, and the study of disease dynamics within herds or regions. Research in this area often focuses on infectious diseases, zoonotic diseases, and the impact of environmental factors on equine health. This page compiles peer-reviewed research studies and scholarly articles that explore various aspects of epidemiology in horses, including disease prevalence, transmission pathways, and strategies for disease prevention and control.
Development of membrane-based flow-through assay for detection of trypanosomosis in equines.
Journal of parasitic diseases : official organ of the Indian Society for Parasitology    November 8, 2019   Volume 44, Issue 1 99-104 doi: 10.1007/s12639-019-01166-8
Kumar R, Yadav SC, Kumar S, Dilbaghi N.A rapid flow-through immunoassay using protein A labeled gold nanoparticles (GNPs) for the qualitative detection of trypanosomosis in equine serum samples was developed. The flow-through device consisted of antigen-coated nitrocellulose membrane fixed on absorbent pads. The GNPs based detection probe was used as the colored marker. The assay can be employed for the detection of specific antibodies at 14 days post-infection in the infected pooled serum samples of equines. The assay can be conducted in < 5 min. The results of the flow-through assay were comparable with the methods like E...
[Equine Infectious Anaemia – a review from an official veterinary perspective].
Schweizer Archiv fur Tierheilkunde    November 7, 2019   Volume 161, Issue 11 725-738 doi: 10.17236/sat00232
Zimmerli U, Thür B.Equine infectious anaemia (EIA) is a sporadic viral disease in many countries. Every single case has, however, a dramatic impact: infected animals have to be put down, and quarantine restrictions on horse movements lasting three months lead to substantial economic losses. In Switzerland, the mandatory notification was introduced in 1994 in order to facilitate international traffic. A year later, the "new" Ordinance on epizootics of 1995 classified EIA as a "disease to be eradicated". An infected polo horse in the canton of Argovia in summer 2017 thus represented Switzerland's first official ca...
Identification of a mecA/mecC-positive MRSA ST1-t127 isolate from a racehorse in Japan.
The Journal of antimicrobial chemotherapy    November 7, 2019   Volume 75, Issue 2 292-295 doi: 10.1093/jac/dkz459
Sekizuka T, Niwa H, Kinoshita Y, Uchida-Fujii E, Inamine Y, Hashino M, Kuroda M.MRSA is a known pathogen that affects horses. We investigated an equine MRSA isolate for potential antimicrobial resistance genes, classified the staphylococcal cassette chromosome mec (SCCmec) and identified the strain-specific dissemination in the horse community based on WGS. WGS, using short-read sequencing, and subsequent long-read sequencing by hybrid assembly, was conducted to obtain a complete genome sequence. Pairwise sequence alignment of relative SCCmec sequences and core-genome phylogenetic analysis were performed to highlight transmission routes of the SCCmec and MRSA strain-speci...
Disease investigations for equine infectious anemia in Canada (2009-2012) – Retrospective evaluation and risk factor analysis.
The Canadian veterinary journal = La revue veterinaire canadienne    November 7, 2019   Volume 60, Issue 11 1199-1206 
Lohmann KL, James CR, Higgins SN, Howden KJ, Epp T.This retrospective study describes the detection of equine infectious anemia (EIA) during Canadian Food Inspection Agency (CFIA) disease investigations in Canada, examines aspects of importance for disease control, and evaluates potential animal-level risk factors for EIA in high-risk horses. Based on review of all EIA-positive samples and all samples collected during disease investigations (N = 4553) over a 4-year period (2009 to 2012), 409 EIA cases were detected. Horse owners with EIA cases owned between 1 and 60 affected animals, and 49 horses seroconverted during a disease investigation p...
Serological detection and risk factors for equine piroplasmosis in the semiarid region of Pernambuco, Northeastern Brazil. Souza EAR, Araujo AC, Pires LCSR, Freschi CR, Azevedo SS, Machado RZ, Horta MC.Equine piroplasmosis, an economically important disease in horses, has so far not been reported in Pernambuco state, Brazil. This study aimed to evaluate the seroprevalence of anti-Babesia caballi and anti-Theileria equi antibodies based on the detection of these agents in equine blood and in ticks on horses in the municipality of Petrolina, Pernambuco, northeastern Brazil. Blood samples were drawn from 393 horses and sera were examined by ELISA. The presence of tick infestations was evaluated, and 101 ticks were subjected to DNA amplification for the detection of Babesia spp. by polymerase ch...
Factors associated with euthanasia in horses and ponies enrolled in a laminitis cohort study in Great Britain.
Preventive veterinary medicine    November 6, 2019   Volume 174 104833 doi: 10.1016/j.prevetmed.2019.104833
Pollard D, Wylie CE, Newton JR, Verheyen KLP.Euthanasia is a complex topic, with animal owners using multiple factors to shape their decision-making process. Previous epidemiological studies have described causes of equine mortality in specific populations, but there is limited evidence regarding factors contributing specifically to equine euthanasia in Great Britain (GB). This observational study used a prospective cohort design: the objectives were to describe owner-reported reasons for euthanasia, estimate the rate of euthanasia and identify associated factors in horses/ponies enrolled in a web-based epidemiological study of laminitis...
Silent Circulation of the Saint Louis Encephalitis Virus among Humans and Equids, Southeast Brazil.
Viruses    November 5, 2019   Volume 11, Issue 11 1029 doi: 10.3390/v11111029
Barbosa Costa G, Marinho PES, Vilela APP, Saraiva-Silva AT, Crispim APC, Borges IA, Dutra AGS, Lobato ZIP, Dos Reis JKP, de Oliveira DB, Drumond BP....Saint Louis encephalitis virus (SLEV) is a mosquito-borne flavivirus that occurs throughout the Americas, and is considered a public health threat. In Brazil, SLEV has been detected from human cases associated with dengue-like disease, but no neurological symptoms were reported. Furthermore, the epidemiology of SLEV in human populations is still poorly explored in the country. We reported serological and molecular detection of SLEV in a healthy population of equids and humans from rural areas in Southeast Brazil. A plaque reduction neutralization test was applied, and neutralizing antibodies w...
Serological evidence of leptospirosis in Iran; A systematic review and meta-analysis.
Microbial pathogenesis    November 4, 2019   Volume 138 103833 doi: 10.1016/j.micpath.2019.103833
Khalili M, Sakhaee E, Bagheri Amiri F, Safat AA, Afshar D, Esmaeili S.Leptospirosis is a neglected infectious zoonotic disease that affects domestic animals and wildlife as well as humans. Although leptospirosis is known as an endemic disease in Iran, there is no accurate information on the overall prevalence of this disease in humans and animals. The aim of this systematic review and meta-analysis was to estimate the seroprevalence of leptospirosis among human and domestic and wild animals in Iran. A systematic review of English and Persian articles (since 1998 to December 2017) was conducted using Google Scholar, Medline/PubMed, Science Direct, Scopus, Web of ...
Success and Limitation of Equine Influenza Vaccination: The First Incursion in a Decade of a Florida Clade 1 Equine Influenza Virus that Shakes Protection Despite High Vaccine Coverage.
Vaccines    November 2, 2019   Volume 7, Issue 4 174 doi: 10.3390/vaccines7040174
Fougerolle S, Fortier C, Legrand L, Jourdan M, Marcillaud-Pitel C, Pronost S, Paillot R.Every year, several epizooties of equine influenza (EI) are reported worldwide. However, no EI case has been identified in France between 2015 and late 2018, despite an effective field surveillance of the pathogen and the disease. Vaccination against equine influenza virus (EIV) remains to this day one of the most effective methods to prevent or limit EI outbreaks and the lack of detection of the pathogen could be linked to vaccination coverage. The aim of this study was to evaluate EI immunity and vaccine coverage in France through a large-scale serological study. A total of 3004 archived sur...
The effect of equine herpesvirus type 4 on type-I interferon signaling molecules.
Veterinary immunology and immunopathology    November 2, 2019   Volume 219 109971 doi: 10.1016/j.vetimm.2019.109971
Oladunni FS, Reedy S, Balasuriya UBR, Horohov DW, Chambers TM.Equine herpesvirus type 4 (EHV-4) is mildly pathogenic but is a common cause of respiratory disease in horses worldwide. We previously demonstrated that unlike EHV-1, EHV-4 is not a potent inducer of type-I IFN and does not suppress that IFN response, especially during late infection, when compared to EHV-1 infection in equine endothelial cells (EECs). Here, we investigated the impact of EHV-4 infection in EECs on type-I IFN signaling molecules at 3, 6, and 12 hpi. Findings from our study revealed that EHV-4 did not induce nor suppress TLR3 and TLR4 expression in EECs at all the studied time...
Epidemiological Study of Equine Piroplasmosis (Theileria equi and Babesia caballi) by Microscopic Examination and Competitive-ELISA in Erbil Province North-Iraq.
Iranian journal of parasitology    November 2, 2019   Volume 14, Issue 3 404-412 
Aziz KJ, Al-Barwary LTO.Equine piroplasmosis is a major tick-borne disease that can lead to serious health problems and economic losses in horse industry. The aim of the study is to determine the prevalence of and in different species of Equus namely (Horse, mule, donkey and pony) by Giemsa stained blood films and competitive ELISA. Methods: This study was conducted at various geographic areas of Erbil governorate. A total of 349 blood samples from equine (209 horses, 62 mule, 57 donkey and 21 ponies) were collected to estimate the prevalence rate of and by using Giemsa stained blood smear and competitive ELISA. ...
No Evidence of Mosquito Involvement in the Transmission of Equine Hepacivirus (Flaviviridae) in an Epidemiological Survey of Austrian Horses.
Viruses    November 1, 2019   Volume 11, Issue 11 1014 doi: 10.3390/v11111014
Badenhorst M, de Heus P, Auer A, Rümenapf T, Tegtmeyer B, Kolodziejek J, Nowotny N, Steinmann E, Cavalleri JV.Prevalence studies have demonstrated a global distribution of equine hepacivirus (EqHV), a member of the family Flaviviridae. However, apart from a single case of vertical transmission, natural routes of EqHV transmission remain elusive. Many known flaviviruses are horizontally transmitted between hematophagous arthropods and vertebrate hosts. This study represents the first investigation of potential EqHV transmission by mosquitoes. More than 5000 mosquitoes were collected across Austria and analyzed for EqHV ribonucleic acid (RNA) by reverse transcription quantitative polymerase chain reacti...
Cutaneous Leishmaniosis caused by Leishmania martiniquensis in a Horse in Florida.
Journal of comparative pathology    October 31, 2019   Volume 173 13-18 doi: 10.1016/j.jcpa.2019.09.011
Menezes RC, Campos MP, Popielarczyk M, Kiupel M.We report a new case of cutaneous leishmaniosis caused by Leishmania (Mundinia) martiniquensis in a horse in Florida, USA. A 10-year-old neutered male Quarter horse was presented with multifocal to coalescing, raised, ulcerated and oozing, non-healing wounds on both pinnae of several weeks' duration. After a few months, the lesions regressed spontaneously. Biopsies of the lesions were performed with microscopical findings of epidermal hyperplasia with multifocal ulceration and focally extensive, dermal pyogranulomatous inflammation with numerous intact and degenerate neutrophils being surround...
Assessing the potential of plains zebra to maintain African horse sickness in the Western Cape Province, South Africa.
PloS one    October 31, 2019   Volume 14, Issue 10 e0222366 doi: 10.1371/journal.pone.0222366
Porphyre T, Grewar JD.African horse sickness (AHS) is a disease of equids that results in a non-tariff barrier to the trade of live equids from affected countries. AHS is endemic in South Africa except for a controlled area in the Western Cape Province (WCP) where sporadic outbreaks have occurred in the past 2 decades. There is potential that the presence of zebra populations, thought to be the natural reservoir hosts for AHS, in the WCP could maintain AHS virus circulation in the area and act as a year-round source of infection for horses. However, it remains unclear whether the epidemiology or the ecological cond...
Assessment of Leishmania infantum infection in equine populations in a canine visceral leishmaniosis transmission area.
BMC veterinary research    October 30, 2019   Volume 15, Issue 1 381 doi: 10.1186/s12917-019-2108-1
Escobar TA, Dowich G, Dos Santos TP, Zuravski L, Duarte CA, Lübeck I, Manfredini V.Leishmaniosis, zoonosis that produces significant public health impacts, is caused by Leishmania infantum. Canines are the main domestic reservoir and, besides humans, other species of mammals could be infected when living in endemic areas. In this study, we detected equine Leishmania infantum infections in a canine visceral leishmaniosis transmission area and evaluated the clinical, haematological, biochemical and oxidative stress disorders. This study was conducted in Uruguaiana, Rio Grande do Sul, south of Brazil. Peripheral blood samples were collected from 124 animals (98 horses and 26 do...
An Equine Herpesvirus Type 1 (EHV-1) Ab4 Open Reading Frame 2 Deletion Mutant Provides Immunity and Protection from EHV-1 Infection and Disease.
Journal of virology    October 29, 2019   Volume 93, Issue 22 e01011-19 doi: 10.1128/JVI.01011-19
Schnabel CL, Babasyan S, Rollins A, Freer H, Wimer CL, Perkins GA, Raza F, Osterrieder N, Wagner B.Equine herpesvirus type 1 (EHV-1) outbreaks continue to occur despite widely used vaccination. Therefore, development of EHV-1 vaccines providing improved immunity and protection is ongoing. Here, an open reading frame 2 deletion mutant of the neuropathogenic EHV-1 strain Ab4 (Ab4ΔORF2) was tested as a vaccine candidate. Three groups of horses ( = 8 each) were infected intranasally with Ab4ΔORF2 or the parent Ab4 virus or were kept as noninfected controls. Horses infected with Ab4ΔORF2 had reduced fever and nasal virus shedding compared to those infected with Ab4 but mounted similar ada...
African horse sickness: a potential threat to the UK.
The Veterinary record    October 28, 2019   Volume 185, Issue 16 501-503 doi: 10.1136/vr.l6189
The UK has never experienced an outbreak of African horse sickness but, as Matthew Robin of the Fyrnwy Equine Clinic explains, there is still a risk of a case occurring.
The contribution of domestic animals to the transmission of schistosomiasis japonica in the Lindu Subdistrict of the Central Sulawesi Province, Indonesia.
Veterinary world    October 23, 2019   Volume 12, Issue 10 1591-1598 doi: 10.14202/vetworld.2019.1591-1598
Budiono NG, Satrija F, Ridwan Y, Handharyani E, Murtini S.Schistosomiasis is endemic in Indonesia and is found in three remote areas in Central Sulawesi Province. Non-human mammals serve as reservoir hosts, meaning the disease is zoonotic. The previous schistosomiasis studies in animals from the Lindu Subdistrict did not determine which domestic animal species can serve as the primary source of transmission. No animals have been treated in Indonesia to control the disease; therefore, the parasite's life cycle is not blocked entirely. This study aimed to determine the prevalence and identify the risk factors associated with, infection in animals, and...
Differences in microbiome and virome between cattle and horses in the same farm.
Asian-Australasian journal of animal sciences    October 22, 2019   Volume 33, Issue 6 1042-1055 doi: 10.5713/ajas.19.0267
Park J, Kim EB.The ecosystem of an animal farm is composed of various elements, such as animals, farmers, plants, feed, soil, and microorganisms. A domesticated animal's health is largely connected with the reservoir of bacteria and viruses in animal farms. Although a few studies have focused on exploring the gut microbiome of animals, communities of microbiota and viruses in feedlots have not been thoroughly investigated. Methods: Here, we collected feces and dust samples (4 groups: cattle feces, C_F; horse feces, H_F; cattle dust, C_D; and horse dust, H_D) from cattle and horse farms sharing the same housi...
High intake of sugars and starch, low number of meals and low roughage intake are associated with Equine Gastric Ulcer Syndrome in a Belgian cohort.
Journal of animal physiology and animal nutrition    October 22, 2019   Volume 105 Suppl 2 18-23 doi: 10.1111/jpn.13215
Galinelli N, Wambacq W, Broeckx BJG, Hesta M.Equine gastric ulcer syndrome (EGUS) is a pathological condition affecting the glandular and squamous regions of the stomach. It is characterized by non-specific clinical signs, behavioural changes or can also be found without any overt clinical manifestations. Nutritional factors such as intermittent feeding, high sugars and starch intake, large amounts of straw as forage and prolonged time without access to forage have all been associated with an increased risk of equine squamous gastric disease (ESGD). The aim of this study was to investigate which nutritional practices are commonly seen in...
Molecular investigation and phylogeny of species of the Anaplasmataceae infecting animals and ticks in Senegal.
Parasites & vectors    October 22, 2019   Volume 12, Issue 1 495 doi: 10.1186/s13071-019-3742-y
Dahmani M, Davoust B, Sambou M, Bassene H, Scandola P, Ameur T, Raoult D, Fenollar F, Mediannikov O.Our study aimed to assess the diversity of the species of Anaplasmataceae in Senegal that infect animals and ticks in three areas: near Keur Momar Sarr (northern region), Dielmo and Diop (Sine Saloum, central region of Senegal), and in Casamance (southern region of Senegal). Methods: A total of 204 ticks and 433 blood samples were collected from ruminants, horses, donkeys and dogs. Ticks were identified morphologically and by molecular characterization targeting the 12S rRNA gene. Molecular characterization of species of Anaplasmataceae infecting Senegalese ticks and animals was conducted usin...
Results of racetrack examinations of Standardbred horses at race meetings in New South Wales.
Australian veterinary journal    October 21, 2019   Volume 97, Issue 12 509-514 doi: 10.1111/avj.12882
Knight PK.This study analysed the race day veterinary reports from harness racing meetings controlled by the New South Wales Greyhound and Harness Racing Regulatory Authority between 1 September 2008 and 30 June 2009. The findings of all prerace and postrace examinations were analysed, and the frequency of observations was recorded. Chi-square testing was used to determine whether the incidence of abnormalities differed between age groups and tracks. A total of 542 meetings were conducted during the period of the study, with veterinary examinations conducted at 395 of these meetings. A total of 520 vete...
Seroprevalence of Toxoplasma gondii in horses: A global systematic review and meta-analysis.
Acta tropica    October 19, 2019   Volume 201 105222 doi: 10.1016/j.actatropica.2019.105222
Li X, Ni HB, Ren WX, Jiang J, Gong QL, Zhang XX.Toxoplasmosis, one of the most common zoonoses worldwide, is caused by Toxoplasma gondii. T. gondii can infect almost all warm-blooded animals, including humans. Horses are an intermediate host of T. gondii, representing a potential risk for humans. To determine the T. gondii seroprevalence in horses worldwide, a global meta-analysis was conducted. A total of 35 publications were obtained by searching the PubMed, ScienceDirect, Chinese Web of knowledge (CNKI) and Wanfang databases. A total of 12,354 horses were assessed, of which 1580 were positive for T. gondii. The pooled overall seroprevale...
Characterization of Equine Parvovirus in Thoroughbred Breeding Horses from Germany.
Viruses    October 18, 2019   Volume 11, Issue 10 doi: 10.3390/v11100965
Meister TL, Tegtmeyer B, Brüggemann Y, Sieme H, Feige K, Todt D, Stang A, Cavalleri JV, Steinmann E.An equine parvovirus-hepatitis (EqPV-H) has been recently identified in association with equine serum hepatitis, also known as Theiler's disease. The disease was first described by Arnold Theiler in 1918 and is often observed with parenteral use of blood products in equines. However, natural ways of viral circulation and potential risk factors for transmission still remain unknown. In this study, we investigated the occurrence of EqPV-H infections in Thoroughbred horses in northern and western Germany and aimed to identify potential risk factors associated with viral infections. A total of 392...
Piroplasmosis in Italian Standardbred Horses: 15 Years of Surveillance Data.
Journal of equine veterinary science    October 18, 2019   Volume 83 102813 doi: 10.1016/j.jevs.2019.102813
Padalino B, Rosanowski SM, Di Bella C, Lacinio R, Rubino GTR.This study aimed to document the prevalence of chronic equine piroplasmosis (EP) in poorly performing Standardbred racehorses and to explore associations between the disease and sex, age, and hematological parameters. Blood was collected between 2004 and 2018; blood cell counts were performed using a cell counter analyzer, biochemical parameters using a photometer, and serum proteins using agarose gel electrophoresis. Blood smears were prepared, colored with a modified Giemsa, and an experienced technician identified the presence of protozoa. The horses were categorized into piroplasmosis posi...
TRIM39-RPP21 Variants (∆19InsCCC) Are Not Associated with Juvenile Idiopathic Epilepsy in Egyptian Arabian Horses.
Genes    October 16, 2019   Volume 10, Issue 10 816 doi: 10.3390/genes10100816
Rivas VN, Aleman M, Peterson JA, Dahlgren AR, Hales EN, Finno CJ.Juvenile idiopathic epilepsy (JIE) is an inherited disease characterized by recurrent seizures during the first year of life in Egyptian Arabian horses. Definitive diagnosis requires an electroencephalogram (EEG) performed by a veterinary specialist. A recent study has suggested that a 19 base-pair deletion, along with a triple-C insertion, in intron five of twelve (∆19InsCCC; chr20:29542397-29542425: GTTCAGGGGACCACATGGCTCTCTATAGA>TATCTTAAGACCC) of the () gene is associated with JIE. To confirm this association, a new sample set consisting of nine EEG-phenotyped affected and nine unaffec...
Proposed injury thresholds for concussion in equestrian sports.
Journal of science and medicine in sport    October 16, 2019   Volume 23, Issue 3 222-236 doi: 10.1016/j.jsams.2019.10.006
Clark JM, Adanty K, Post A, Hoshizaki TB, Clissold J, McGoldrick A, Hill J, Annaidh AN, Gilchrist MD.Equestrian helmets are designed to pass certification standards based on linear drop tests onto rigid steel surfaces. However, concussions in equestrian sports occur most commonly when a rider is thrown off a horse and obliquely impacts a compliant surface such as turf or sand. This paper seeks to elucidate the mechanics of such impacts and thereby propose corresponding thresholds for the occurrence of concussion that can improve equestrian helmet standards and designs. Methods: The present study examined the biomechanics of real-world equestrian accidents and developed thresholds for the occu...
Leishmania spp. and leishmaniasis on the Caribbean islands.
Transactions of the Royal Society of Tropical Medicine and Hygiene    October 15, 2019   Volume 114, Issue 2 73-78 doi: 10.1093/trstmh/trz076
Yao C.The kinetoplastid protozoan Leishmania spp. cause leishmaniasis, which clinically exhibit mainly as a cutaneous, mucocutanous or visceral form depending upon the parasite species in humans. The disease is widespread geographically, leading to 20 000 annual deaths. Here, leishmaniases in both humans and animals, reservoirs and sand fly vectors on the Caribbean islands are reviewed. Autochthonous human infections by Leishmania spp. were found in the Dominican Republic, Guadeloupe and Martinique as well as Trinidad and Tobago; canine infections were found in St. Kitts and Grenada; and equine infe...
The First Detection of Equine Coronavirus in Adult Horses and Foals in Ireland.
Viruses    October 14, 2019   Volume 11, Issue 10 946 doi: 10.3390/v11100946
Nemoto M, Schofield W, Cullinane A.The objective of this study was to investigate the presence of equine coronavirus (ECoV) in clinical samples submitted to a diagnostic laboratory in Ireland. A total of 424 clinical samples were examined from equids with enteric disease in 24 Irish counties between 2011 and 2015. A real-time reverse transcription polymerase chain reaction was used to detect ECoV RNA. Nucleocapsid, spike and the region from the p4.7 to p12.7 genes of positive samples were sequenced, and sequence and phylogenetic analyses were conducted. Five samples (1.2%) collected in 2011 and 2013 tested positive for ECoV. Po...
A candidate-SNP retrospective cohort study for fracture risk in Japanese Thoroughbred racehorses.
Animal genetics    October 14, 2019   Volume 51, Issue 1 43-50 doi: 10.1111/age.12866
Tozaki T, Kusano K, Ishikawa Y, Kushiro A, Nomura M, Kikuchi M, Kakoi H, Hirota K, Miyake T, Hill EW, Nagata S.Fractures are medical conditions that compromise the athletic potential of horses and/or the safety of jockeys. Therefore, the reduction of fracture risk is an important horse and human welfare issue. The present study used molecular genetic approaches to determine the effect of genetic risk for fracture at four candidate SNPs spanning the myostatin (MSTN) gene on horse chromosome 18. Among the 3706 Japanese Thoroughbred racehorses, 1089 (29.4%) had experienced fractures in their athletic life, indicating the common occurrence of this injury in Thoroughbreds. In the case/control association st...
1 67 68 69 70 71 364