Epidemiology in horses involves the study of the distribution and determinants of health-related states and events in equine populations. It encompasses the investigation of patterns, causes, and effects of diseases and health conditions within horse populations. This field of study aims to identify risk factors for disease and targets for preventive healthcare. Key components of equine epidemiology include disease surveillance, outbreak investigation, and the study of disease dynamics within herds or regions. Research in this area often focuses on infectious diseases, zoonotic diseases, and the impact of environmental factors on equine health. This page compiles peer-reviewed research studies and scholarly articles that explore various aspects of epidemiology in horses, including disease prevalence, transmission pathways, and strategies for disease prevention and control.
Kumar R, Yadav SC, Kumar S, Dilbaghi N.A rapid flow-through immunoassay using protein A labeled gold nanoparticles (GNPs) for the qualitative detection of trypanosomosis in equine serum samples was developed. The flow-through device consisted of antigen-coated nitrocellulose membrane fixed on absorbent pads. The GNPs based detection probe was used as the colored marker. The assay can be employed for the detection of specific antibodies at 14 days post-infection in the infected pooled serum samples of equines. The assay can be conducted in < 5 min. The results of the flow-through assay were comparable with the methods like E...
Zimmerli U, Thür B.Equine infectious anaemia (EIA) is a sporadic viral disease in many countries. Every single case has, however, a dramatic impact: infected animals have to be put down, and quarantine restrictions on horse movements lasting three months lead to substantial economic losses. In Switzerland, the mandatory notification was introduced in 1994 in order to facilitate international traffic. A year later, the "new" Ordinance on epizootics of 1995 classified EIA as a "disease to be eradicated". An infected polo horse in the canton of Argovia in summer 2017 thus represented Switzerland's first official ca...
Sekizuka T, Niwa H, Kinoshita Y, Uchida-Fujii E, Inamine Y, Hashino M, Kuroda M.MRSA is a known pathogen that affects horses. We investigated an equine MRSA isolate for potential antimicrobial resistance genes, classified the staphylococcal cassette chromosome mec (SCCmec) and identified the strain-specific dissemination in the horse community based on WGS. WGS, using short-read sequencing, and subsequent long-read sequencing by hybrid assembly, was conducted to obtain a complete genome sequence. Pairwise sequence alignment of relative SCCmec sequences and core-genome phylogenetic analysis were performed to highlight transmission routes of the SCCmec and MRSA strain-speci...
Lohmann KL, James CR, Higgins SN, Howden KJ, Epp T.This retrospective study describes the detection of equine infectious anemia (EIA) during Canadian Food Inspection Agency (CFIA) disease investigations in Canada, examines aspects of importance for disease control, and evaluates potential animal-level risk factors for EIA in high-risk horses. Based on review of all EIA-positive samples and all samples collected during disease investigations (N = 4553) over a 4-year period (2009 to 2012), 409 EIA cases were detected. Horse owners with EIA cases owned between 1 and 60 affected animals, and 49 horses seroconverted during a disease investigation p...
Souza EAR, Araujo AC, Pires LCSR, Freschi CR, Azevedo SS, Machado RZ, Horta MC.Equine piroplasmosis, an economically important disease in horses, has so far not been reported in Pernambuco state, Brazil. This study aimed to evaluate the seroprevalence of anti-Babesia caballi and anti-Theileria equi antibodies based on the detection of these agents in equine blood and in ticks on horses in the municipality of Petrolina, Pernambuco, northeastern Brazil. Blood samples were drawn from 393 horses and sera were examined by ELISA. The presence of tick infestations was evaluated, and 101 ticks were subjected to DNA amplification for the detection of Babesia spp. by polymerase ch...
Pollard D, Wylie CE, Newton JR, Verheyen KLP.Euthanasia is a complex topic, with animal owners using multiple factors to shape their decision-making process. Previous epidemiological studies have described causes of equine mortality in specific populations, but there is limited evidence regarding factors contributing specifically to equine euthanasia in Great Britain (GB). This observational study used a prospective cohort design: the objectives were to describe owner-reported reasons for euthanasia, estimate the rate of euthanasia and identify associated factors in horses/ponies enrolled in a web-based epidemiological study of laminitis...
Barbosa Costa G, Marinho PES, Vilela APP, Saraiva-Silva AT, Crispim APC, Borges IA, Dutra AGS, Lobato ZIP, Dos Reis JKP, de Oliveira DB, Drumond BP....Saint Louis encephalitis virus (SLEV) is a mosquito-borne flavivirus that occurs throughout the Americas, and is considered a public health threat. In Brazil, SLEV has been detected from human cases associated with dengue-like disease, but no neurological symptoms were reported. Furthermore, the epidemiology of SLEV in human populations is still poorly explored in the country. We reported serological and molecular detection of SLEV in a healthy population of equids and humans from rural areas in Southeast Brazil. A plaque reduction neutralization test was applied, and neutralizing antibodies w...
Khalili M, Sakhaee E, Bagheri Amiri F, Safat AA, Afshar D, Esmaeili S.Leptospirosis is a neglected infectious zoonotic disease that affects domestic animals and wildlife as well as humans. Although leptospirosis is known as an endemic disease in Iran, there is no accurate information on the overall prevalence of this disease in humans and animals. The aim of this systematic review and meta-analysis was to estimate the seroprevalence of leptospirosis among human and domestic and wild animals in Iran. A systematic review of English and Persian articles (since 1998 to December 2017) was conducted using Google Scholar, Medline/PubMed, Science Direct, Scopus, Web of ...
Fougerolle S, Fortier C, Legrand L, Jourdan M, Marcillaud-Pitel C, Pronost S, Paillot R.Every year, several epizooties of equine influenza (EI) are reported worldwide. However, no EI case has been identified in France between 2015 and late 2018, despite an effective field surveillance of the pathogen and the disease. Vaccination against equine influenza virus (EIV) remains to this day one of the most effective methods to prevent or limit EI outbreaks and the lack of detection of the pathogen could be linked to vaccination coverage. The aim of this study was to evaluate EI immunity and vaccine coverage in France through a large-scale serological study. A total of 3004 archived sur...
Oladunni FS, Reedy S, Balasuriya UBR, Horohov DW, Chambers TM.Equine herpesvirus type 4 (EHV-4) is mildly pathogenic but is a common cause of respiratory disease in horses worldwide. We previously demonstrated that unlike EHV-1, EHV-4 is not a potent inducer of type-I IFN and does not suppress that IFN response, especially during late infection, when compared to EHV-1 infection in equine endothelial cells (EECs). Here, we investigated the impact of EHV-4 infection in EECs on type-I IFN signaling molecules at 3, 6, and 12 hpi. Findings from our study revealed that EHV-4 did not induce nor suppress TLR3 and TLR4 expression in EECs at all the studied time...
Aziz KJ, Al-Barwary LTO.Equine piroplasmosis is a major tick-borne disease that can lead to serious health problems and economic losses in horse industry. The aim of the study is to determine the prevalence of and in different species of Equus namely (Horse, mule, donkey and pony) by Giemsa stained blood films and competitive ELISA. Methods: This study was conducted at various geographic areas of Erbil governorate. A total of 349 blood samples from equine (209 horses, 62 mule, 57 donkey and 21 ponies) were collected to estimate the prevalence rate of and by using Giemsa stained blood smear and competitive ELISA. ...
Badenhorst M, de Heus P, Auer A, Rümenapf T, Tegtmeyer B, Kolodziejek J, Nowotny N, Steinmann E, Cavalleri JV.Prevalence studies have demonstrated a global distribution of equine hepacivirus (EqHV), a member of the family Flaviviridae. However, apart from a single case of vertical transmission, natural routes of EqHV transmission remain elusive. Many known flaviviruses are horizontally transmitted between hematophagous arthropods and vertebrate hosts. This study represents the first investigation of potential EqHV transmission by mosquitoes. More than 5000 mosquitoes were collected across Austria and analyzed for EqHV ribonucleic acid (RNA) by reverse transcription quantitative polymerase chain reacti...
Menezes RC, Campos MP, Popielarczyk M, Kiupel M.We report a new case of cutaneous leishmaniosis caused by Leishmania (Mundinia) martiniquensis in a horse in Florida, USA. A 10-year-old neutered male Quarter horse was presented with multifocal to coalescing, raised, ulcerated and oozing, non-healing wounds on both pinnae of several weeks' duration. After a few months, the lesions regressed spontaneously. Biopsies of the lesions were performed with microscopical findings of epidermal hyperplasia with multifocal ulceration and focally extensive, dermal pyogranulomatous inflammation with numerous intact and degenerate neutrophils being surround...
Porphyre T, Grewar JD.African horse sickness (AHS) is a disease of equids that results in a non-tariff barrier to the trade of live equids from affected countries. AHS is endemic in South Africa except for a controlled area in the Western Cape Province (WCP) where sporadic outbreaks have occurred in the past 2 decades. There is potential that the presence of zebra populations, thought to be the natural reservoir hosts for AHS, in the WCP could maintain AHS virus circulation in the area and act as a year-round source of infection for horses. However, it remains unclear whether the epidemiology or the ecological cond...
Escobar TA, Dowich G, Dos Santos TP, Zuravski L, Duarte CA, Lübeck I, Manfredini V.Leishmaniosis, zoonosis that produces significant public health impacts, is caused by Leishmania infantum. Canines are the main domestic reservoir and, besides humans, other species of mammals could be infected when living in endemic areas. In this study, we detected equine Leishmania infantum infections in a canine visceral leishmaniosis transmission area and evaluated the clinical, haematological, biochemical and oxidative stress disorders. This study was conducted in Uruguaiana, Rio Grande do Sul, south of Brazil. Peripheral blood samples were collected from 124 animals (98 horses and 26 do...
Schnabel CL, Babasyan S, Rollins A, Freer H, Wimer CL, Perkins GA, Raza F, Osterrieder N, Wagner B.Equine herpesvirus type 1 (EHV-1) outbreaks continue to occur despite widely used vaccination. Therefore, development of EHV-1 vaccines providing improved immunity and protection is ongoing. Here, an open reading frame 2 deletion mutant of the neuropathogenic EHV-1 strain Ab4 (Ab4ΔORF2) was tested as a vaccine candidate. Three groups of horses ( = 8 each) were infected intranasally with Ab4ΔORF2 or the parent Ab4 virus or were kept as noninfected controls. Horses infected with Ab4ΔORF2 had reduced fever and nasal virus shedding compared to those infected with Ab4 but mounted similar ada...
The UK has never experienced an outbreak of African horse sickness but, as Matthew Robin of the Fyrnwy Equine Clinic explains, there is still a risk of a case occurring.
Budiono NG, Satrija F, Ridwan Y, Handharyani E, Murtini S.Schistosomiasis is endemic in Indonesia and is found in three remote areas in Central Sulawesi Province. Non-human mammals serve as reservoir hosts, meaning the disease is zoonotic. The previous schistosomiasis studies in animals from the Lindu Subdistrict did not determine which domestic animal species can serve as the primary source of transmission. No animals have been treated in Indonesia to control the disease; therefore, the parasite's life cycle is not blocked entirely. This study aimed to determine the prevalence and identify the risk factors associated with, infection in animals, and...
Park J, Kim EB.The ecosystem of an animal farm is composed of various elements, such as animals, farmers, plants, feed, soil, and microorganisms. A domesticated animal's health is largely connected with the reservoir of bacteria and viruses in animal farms. Although a few studies have focused on exploring the gut microbiome of animals, communities of microbiota and viruses in feedlots have not been thoroughly investigated. Methods: Here, we collected feces and dust samples (4 groups: cattle feces, C_F; horse feces, H_F; cattle dust, C_D; and horse dust, H_D) from cattle and horse farms sharing the same housi...
Galinelli N, Wambacq W, Broeckx BJG, Hesta M.Equine gastric ulcer syndrome (EGUS) is a pathological condition affecting the glandular and squamous regions of the stomach. It is characterized by non-specific clinical signs, behavioural changes or can also be found without any overt clinical manifestations. Nutritional factors such as intermittent feeding, high sugars and starch intake, large amounts of straw as forage and prolonged time without access to forage have all been associated with an increased risk of equine squamous gastric disease (ESGD). The aim of this study was to investigate which nutritional practices are commonly seen in...
Dahmani M, Davoust B, Sambou M, Bassene H, Scandola P, Ameur T, Raoult D, Fenollar F, Mediannikov O.Our study aimed to assess the diversity of the species of Anaplasmataceae in Senegal that infect animals and ticks in three areas: near Keur Momar Sarr (northern region), Dielmo and Diop (Sine Saloum, central region of Senegal), and in Casamance (southern region of Senegal). Methods: A total of 204 ticks and 433 blood samples were collected from ruminants, horses, donkeys and dogs. Ticks were identified morphologically and by molecular characterization targeting the 12S rRNA gene. Molecular characterization of species of Anaplasmataceae infecting Senegalese ticks and animals was conducted usin...
Knight PK.This study analysed the race day veterinary reports from harness racing meetings controlled by the New South Wales Greyhound and Harness Racing Regulatory Authority between 1 September 2008 and 30 June 2009. The findings of all prerace and postrace examinations were analysed, and the frequency of observations was recorded. Chi-square testing was used to determine whether the incidence of abnormalities differed between age groups and tracks. A total of 542 meetings were conducted during the period of the study, with veterinary examinations conducted at 395 of these meetings. A total of 520 vete...
Li X, Ni HB, Ren WX, Jiang J, Gong QL, Zhang XX.Toxoplasmosis, one of the most common zoonoses worldwide, is caused by Toxoplasma gondii. T. gondii can infect almost all warm-blooded animals, including humans. Horses are an intermediate host of T. gondii, representing a potential risk for humans. To determine the T. gondii seroprevalence in horses worldwide, a global meta-analysis was conducted. A total of 35 publications were obtained by searching the PubMed, ScienceDirect, Chinese Web of knowledge (CNKI) and Wanfang databases. A total of 12,354 horses were assessed, of which 1580 were positive for T. gondii. The pooled overall seroprevale...
Meister TL, Tegtmeyer B, Brüggemann Y, Sieme H, Feige K, Todt D, Stang A, Cavalleri JV, Steinmann E.An equine parvovirus-hepatitis (EqPV-H) has been recently identified in association with equine serum hepatitis, also known as Theiler's disease. The disease was first described by Arnold Theiler in 1918 and is often observed with parenteral use of blood products in equines. However, natural ways of viral circulation and potential risk factors for transmission still remain unknown. In this study, we investigated the occurrence of EqPV-H infections in Thoroughbred horses in northern and western Germany and aimed to identify potential risk factors associated with viral infections. A total of 392...
Padalino B, Rosanowski SM, Di Bella C, Lacinio R, Rubino GTR.This study aimed to document the prevalence of chronic equine piroplasmosis (EP) in poorly performing Standardbred racehorses and to explore associations between the disease and sex, age, and hematological parameters. Blood was collected between 2004 and 2018; blood cell counts were performed using a cell counter analyzer, biochemical parameters using a photometer, and serum proteins using agarose gel electrophoresis. Blood smears were prepared, colored with a modified Giemsa, and an experienced technician identified the presence of protozoa. The horses were categorized into piroplasmosis posi...
Rivas VN, Aleman M, Peterson JA, Dahlgren AR, Hales EN, Finno CJ.Juvenile idiopathic epilepsy (JIE) is an inherited disease characterized by recurrent seizures during the first year of life in Egyptian Arabian horses. Definitive diagnosis requires an electroencephalogram (EEG) performed by a veterinary specialist. A recent study has suggested that a 19 base-pair deletion, along with a triple-C insertion, in intron five of twelve (∆19InsCCC; chr20:29542397-29542425: GTTCAGGGGACCACATGGCTCTCTATAGA>TATCTTAAGACCC) of the () gene is associated with JIE. To confirm this association, a new sample set consisting of nine EEG-phenotyped affected and nine unaffec...
Clark JM, Adanty K, Post A, Hoshizaki TB, Clissold J, McGoldrick A, Hill J, Annaidh AN, Gilchrist MD.Equestrian helmets are designed to pass certification standards based on linear drop tests onto rigid steel surfaces. However, concussions in equestrian sports occur most commonly when a rider is thrown off a horse and obliquely impacts a compliant surface such as turf or sand. This paper seeks to elucidate the mechanics of such impacts and thereby propose corresponding thresholds for the occurrence of concussion that can improve equestrian helmet standards and designs. Methods: The present study examined the biomechanics of real-world equestrian accidents and developed thresholds for the occu...
Yao C.The kinetoplastid protozoan Leishmania spp. cause leishmaniasis, which clinically exhibit mainly as a cutaneous, mucocutanous or visceral form depending upon the parasite species in humans. The disease is widespread geographically, leading to 20 000 annual deaths. Here, leishmaniases in both humans and animals, reservoirs and sand fly vectors on the Caribbean islands are reviewed. Autochthonous human infections by Leishmania spp. were found in the Dominican Republic, Guadeloupe and Martinique as well as Trinidad and Tobago; canine infections were found in St. Kitts and Grenada; and equine infe...
Nemoto M, Schofield W, Cullinane A.The objective of this study was to investigate the presence of equine coronavirus (ECoV) in clinical samples submitted to a diagnostic laboratory in Ireland. A total of 424 clinical samples were examined from equids with enteric disease in 24 Irish counties between 2011 and 2015. A real-time reverse transcription polymerase chain reaction was used to detect ECoV RNA. Nucleocapsid, spike and the region from the p4.7 to p12.7 genes of positive samples were sequenced, and sequence and phylogenetic analyses were conducted. Five samples (1.2%) collected in 2011 and 2013 tested positive for ECoV. Po...
Tozaki T, Kusano K, Ishikawa Y, Kushiro A, Nomura M, Kikuchi M, Kakoi H, Hirota K, Miyake T, Hill EW, Nagata S.Fractures are medical conditions that compromise the athletic potential of horses and/or the safety of jockeys. Therefore, the reduction of fracture risk is an important horse and human welfare issue. The present study used molecular genetic approaches to determine the effect of genetic risk for fracture at four candidate SNPs spanning the myostatin (MSTN) gene on horse chromosome 18. Among the 3706 Japanese Thoroughbred racehorses, 1089 (29.4%) had experienced fractures in their athletic life, indicating the common occurrence of this injury in Thoroughbreds. In the case/control association st...
Truppel JH, Otomura F, Teodoro U, Massafera R, da Costa-Ribeiro MC, Catarino CM, Dalagrana L, Costa Ferreira ME, Thomaz-Soccol V.In this study, we detected Leishmania (Viannia) braziliensis infection in equids living in endemic regions of cutaneous leishmaniasis. To determine the role of these animals in the Leishmania cycle, we used two approaches: serological and molecular methods. Antibodies to the parasite were assayed using the Enzyme Linked Immunosorbent Assay (ELISA). Blood samples were collected and tested by polymerase chain reaction (PCR), and the positive products were sequenced. The results showed that 11.0% (25/227) of the equids were seropositive for Leishmania sp, and 16.3% (37/227) were PCR positive. Ant...
Davoust B, Mediannikov O, Roqueplo C, Perret C, Demoncheaux JP, Sambou M, Guillot J, Blaga R.Toxoplasma gondii is an obligate, intracellular, parasitic protozoan within the phylum Apicomplexa that causes toxoplasmosis in mammalian hosts (including humans) and birds. We used modified direct agglutination test for the screening of the animals' sera collected in Senegal. In total, 419 animals' sera have been studied: 103 bovines, 43 sheep, 52 goats, 63 horses, 13 donkeys and 145 dogs. The collection of sera was performed in four different regions of Senegal: Dakar, Sine Saloum, Kedougou and Basse Casamance from 2011 to 2013. We have revealed antibodies in 13% of bovines, 16% of sheep, 15...
Stewart AJ, Hinchcliff KW, Saville WJ, Jose-Cunilleras E, Hardy J, Kohn CW, Reed SM, Kowalski JJ.Medical records of 101 blood culture-confirmed bacteremic foals were reviewed to determine whether foals with Actinobacillus sp. bacteremia are affected at an earlier age, have more severe signs of disease, and have a worse prognosis than do foals with bacteremia of other causes. Thirty percent (30/101) of bacteremic foals had Actinobacillus sp. cultured, and these were 2 times more likely to die (crude odds ratio [OR(CR)] 0.8, 4; P = .14), with a survival rate of 43% (13/30) compared to the overall survival rate of 55% (56/101). When compared to other bacteremic foals, foals with actinobacill...
Boston RC, Nunamaker DM.To determine the degree to which components of the training program of 2-year-old Thoroughbred racehorses influence their susceptibility to fatigue injury of the third metacarpal bone (bucked shins). Methods: 226 two-year-old Thoroughbred racehorses. Methods: Daily training information and health reports on 2-year-old Thoroughbreds were compiled from records provided from 5 commercial stables. For each horse, data (exercise variables) were collected that comprised distance jogged (approx speed of 5 m/s), galloped (approx 11 m/s), and breezed (approx 15 to 16 m/s) until a single instance of buc...
Pinchbeck GL, Clegg PD, Proudman CJ, Stirk A, Morgan KL, French NP.A prospective cohort study was conducted on horses starting in hurdle and steeplechase races on six UK racecourses in 2000 and 2001. Trainers or carers were questioned on the horses' pre-race routine and observational data were collected in the stables and parade ring. Some practices were common to many starters, such as withholding food and water before racing whereas other practices, such as schooling frequency, were more variable. There was a total of 2879 starts and a total of 83 injuries or medical events (28.8/1000 starts). The commonest types of injury were tendon/suspensory injuries an...
Ravel S, Mediannikov O, Bossard G, Desquesnes M, Cuny G, Davoust B.In Senegal, several areas provide great potential for agriculture and animal production, but African animal trypanosomosis (AAT) is one of the major constraints to the development of more effective livestock production systems. A study was conducted to assess the current situation of AAT in this country. Surveys were carried out between June 2011 and September 2012 in four different areas: Dakar, Sine Saloum, Kedougou region and Basse Casamance in several animal species: dogs (152), donkeys (23), horses (63), sheep (43), goats (52) and cattle (104), distributed in the four sites. Molecular too...
Ruiz-López MJ, Muñoz-Chimeno M, Figuerola J, Gavilán AM, Varona S, Cuesta I, Martínez-de la Puente J, Zaballos Á, Molero F, Soriguer RC....Emerging infectious diseases are one of the most important global health challenges because of their impact on human and animal health. The vector-borne West Nile virus (WNV) is transmitted between birds by mosquitos, but it can also infect humans and horses causing disease. The local circulation of WNV in Spain has been known for decades, and since 2010, there have been regular outbreaks in horses, although only six cases were reported in humans until 2019. In 2020, Spain experienced a major outbreak with 77 human cases, which was followed by 6 additional cases in 2021, most of them in the An...
Rehbein S, Lindner T, Visser M, Winter R.Faecal samples of 250 horses from farms with a known history of tapeworm infection were examined comparatively for cestode eggs using a double centrifugation/combined sedimentation-floatation technique. From each faecal sample, three 5 g and three 15 g subsamples were processed, each using either saturated NaCl solution, specific gravity (sp. g.) 1.2 [NaCl]; concentrated sugar solution, sp. g. 1.26 [sugar]; or concentrated ZnSO4 solution, sp. g. 1.3 [ZnSO4] for floatation. In total, faeces from 187 horses ( = 74.8%) tested 'positive' for Anoplocephala eggs. Percentages of samples testing '...
Karamendin K, Kydyrmanov A, Kasymbekov Y, Khan E, Daulbayeva K, Asanova S, Zhumatov K, Seidalina A, Sayatov M, Fereidouni SR.Equine influenza (EI) continues to be an important respiratory pathogen of horses worldwide. Since 2007 several outbreaks of EI have occurred in Central Asian countries, including Kazakhstan, western Mongolia, India and western China. Phylogenetic analysis showed that two H3N8 equine influenza virus (EIV) isolates from Kazakhstan, A/equine/Almaty/26/2007 and A/equine/South Kazakhstan/236/12, were related to Florida sublineage 2, with high similarity to EIVs circulating in the same period in neighbouring countries. New outbreaks of EI during 2011 and 2012 in Kazakhstan and other Central Asian c...
Banet-Noach C, Malkinson M, Brill A, Samina I, Yadin H, Weisman Y, Pokamunski S, King R, Deubel V, Stram Y.In November 1997, an outbreak of a neuroparalytic disease caused by West Nile (WN) virus was diagnosed in young goose flocks. Domestic geese were similarly affected in the late summer and fall of 1998, 1999, 2000 and 2001. WN viruses were also isolated from migratory and wild birds and horses in 1998-2001. A 1278 bp sequence of the envelope gene of 24 Israeli WN virus isolates was compared with those of seven isolates from Africa, Europe and New York. As a result, the Israeli isolates could then be grouped into two clusters. The 15 avian and three equine from 1997-2001 in the first cluster of ...
Verheyen KL, Henley WE, Price JS, Wood JL.Dorsometacarpal disease (DMD) is common in young Thoroughbred (TB) racehorses, often interfering with their training programme. No reports exist on incidence rate or associated risk factors in the UK. Objective: To estimate the incidence rate of DMD in TB horses in training for flat racing in the UK and identify associated risk factors, particularly in relation to training regimens. Methods: Data were drawn from a large prospective study in which TB horses in 13 training yards were monitored for a period of up to 2 years, recording daily training information and details of musculoskeletal inju...
Pusterla N, Pusterla JB, Braun U, Lutz H.Four cows and four horses were infected experimentally with Ehrlichia phagocytophila, the cause of tickborne fever in ruminants, and with human granulocytic ehrlichia-like agent, a recently discovered species that infects people, horses and dogs in the USA and Europe. They were infected in either order, 30 days apart, to investigate serological cross-reactivity within the Ephagocytophila genogroup. The course of infection was assessed by routine clinical, haematological, serological and polymerase chain reaction (PCR) examinations. Two of the cows infected with Ephagocytophila and two of the h...
Rott R, Herzog S, Richt J, Stitz L.Borna disease is an endemic progressive encephalomyelitis of horses and sheep prevalent in central Europe. A wide variety of animal species, ranging from chickens to primates can be infected experimentally with the causative virus, which is only poorly characterized. Furthermore, BD virus-specific antibodies have been detected in sera and cerebrospinal fluids of psychiatric patients. Our studies on the pathogenesis of BD have shown that-at least in rats-the disease is not caused by the infecting virus itself, but by a virus-induced immunopathological reaction. Thus, after intracerebral infecti...
Marenzoni ML, Stefanetti V, Papa P, Casagrande Proietti P, Bietta A, Coletti M, Passamonti F, Henning K.The role of the horse in Coxiella burnetii infection has not been defined. Accordingly, a twofold approach was taken to further our knowledge on this topic: (1) conduct a systematic review of the literature to establish available evidence of C. burnetii infection in the horse; (2) undertake a biomolecular investigation of 122 cases of equine abortion, stillbirth and neonatal foal death, for the presence of C. burnetii using a PCR test targeting the IS1111 gene of C. burnetii. A review of the literature turned up seven studies that identified C. burnetii DNA in equine specimens, especially abor...
KAPLAN MM, PAYNE AM.In 1957 the World Health Organization arranged a survey of horse and swine sera in a number of countries in order to gain information on the role and importance of animals in the epidemiology of influenza. The veterinary services of the countries concerned were requested to obtain blood specimens from these animals, if possible both before and after the human pandemic of Asian influenza. This paper reports on the results of haemagglutination-inhibition and complement-fixation tests performed on these sera in WHO Influenza Centres and other collaborating laboratories.It is apparent from these r...
Gao JF, Zhang XX, Wang XX, Li Q, Li Y, Xu WW, Gao Y, Wang CR.Parascarosis is caused mainly by parasitic infections with Parascaris equorum and Parascaris univalens, the most common ascarid nematodes, in the small intestine of equines. Parascarosis often causes severe illness and even death in foals and yearlings. In this study, we obtained the complete sequence of the P. equorum mitochondrial (mt) genome and compared its organization and structure with that of P. equorum Japan isolate (nearly complete), and the complete mtDNA sequences of P. univalens Switzerland and USA isolates. The complete mtDNA genome of P. equorum China isolate is 13,899 base pair...
Shkap V, Cohen I, Leibovitz B, Savitsky , Pipano E, Avni G, Shofer S, Giger U, Kappmeyer L, Knowles D.Sera from 361 horses were tested by indirect immunofluorescence antibody test (IFA) and by competitive inhibition ELISA (cELISA), to detect antibodies to Babesia equi. The concordance between the assays was 95.7%. Application of a cutoff based on a calculated percent inhibition of 20% inhibition was used. Approximately one-third of all the horses tested were found serologically positive to B. equi, with more horses testing positive from northern Israel. Among horses raised with access to pasture there was a significant difference in the percentage of seropositive reactors (76.6% in the north ...
Jakubek EB, Lundén A, Uggla A.Sera from 414 Swedish horses were investigated for the presence of antibodies to Toxoplasma gondii and Neospora sp. by the T. gondii direct agglutination test (DAT), and an Neospora caninum iscom-ELISA. Five sera (1%) had a titre >1:40 in DAT, but when analysed by immunoblotting against T. gondii antigens only two of them were positive, giving a seroprevalence of 0.5%. Since the Neospora iscom ELISA had not been validated for equine sera it was used for an initial screening, and all sera with an optical density exceeding 0.200 absorbance units were selected for further investigation by immu...
Dangoudoubiyam S, Oliveira JB, Víquez C, Gómez-García A, González O, Romero JJ, Kwok OC, Dubey JP, Howe DK.Serum samples from 315 horses from Costa Rica, Central America, were examined for the presence of antibodies against Sarcocystis neurona, Neospora spp., and Toxoplasma gondii by using the surface antigen (SAG) SnSAG2 enzyme-linked immunosorbent assay (ELISA), the NhSAG1 ELISA, and the modified agglutination test, respectively. Anti- S. neurona antibodies were found in 42.2% of the horses by using the SnSAG2 ELISA. Anti- Neospora spp. antibodies were found in only 3.5% of the horses by using the NhSAG1 ELISA, and only 1 of these horses was confirmed seropositive by Western blot. Antibodies to T...
Gierup J, Larsson M, Lennquist S.A prospective one-year study of horse-riding accidents was performed in an area with a very high frequency of amateur riding. Totally 174 patients with riding injuries were registered--66% children--making an incidence of only 0.7 per thousand riding occasions. However, many of these injuries were of a severe nature, one leading to death and 27 of the patients reporting persisting symptoms at follow-up one year after the accident. Eleven per cent of the accidents lead to cerebral injuries and 44% to fractures, mainly of the upper extremities. Eleven per cent required hospitalization and 17% op...
Sells PD, Pinchbeck G, Mezzane H, Ibourki J, Crane M.Wounds are one of the primary welfare concerns of working equids and are often related to harness or load-bearing packs. Objective: To identify and quantify factors associated with the presence of pack wounds in donkeys and mules working in the wood trade in the Midelt (Northern High Atlas) region of Morocco, and to compare wounds of these donkeys and mules to those working in other trades. Methods: The study population comprised equids working in the Midelt region involved in the wood trade. Comparison populations were comprised of equids working in other trades, in the same region and in Khe...
Simonato G, Danesi P, Frangipane di Regalbono A, Dotto G, Tessarin C, Pietrobelli M, Pasotto D.Animal-assisted interventions (AAIs) are based on the establishment of a therapeutic relationship between animals and beneficiaries that is certain to provide positive effects, while currently, it reads as if AAIs aim at exposing stakeholders to potential risk of infection. The surveillance of zoonotic pathogens is necessary for guaranteeing common health. This study investigated the presence of potentially zoonotic parasites, including dermatophytes, in animals involved in AAIs. Between 2015 and 2017, 190 animals (equids, dogs, cats, birds, rabbits, rodents, and goats) were investigated. Anam...
Sauer FJ, Hermann M, Ramseyer A, Burger D, Riemer S, Gerber V.Sport horses need to fulfill high physical and psychological requirements during training and competition. These as well as certain conditions of modern husbandry may affect their wellbeing. Here we aimed to (1) evaluate effects of demographic and management factors as well as personality traits on stress reactivity of sport horses, (2) investigate if elite sport horses have elevated stress levels compared to amateur sport horses, and (3) assess whether different equestrian disciplines differentially influence equine adrenal cortex responsiveness. For this purpose, we visited 149 healthy elite...
Brits D, Steyn M, L'Abbé EN.Histology is used to describe post-mortem bone alterations, trauma, pathology and age estimation and to separate human and non-human bones. Many scholars are however not familiar with the intricate and variable microstructure of bone, and due to the complex nature of some classification systems, bone histomorphology is often incorrectly described or identified. Little information is available on the histomorphology of non-human bones found in southern Africa, and therefore, the aim of this study was to describe the histomorphology of non-human species commonly found in southern Africa, namely,...
ter Laak EA, Fennema G, Jaartsveld FH.Contagious Equine Metritis (CEM) was detected in the Netherlands for the first time in 1987. A total number of five mares (Dutch saddle-horse) were infected in three separate outbreaks. The origin of the infection could not be determined in any of the cases. As the isolates of the causal organism, Taylorella equigenitalis, showed auto-agglutination, diagnosis was difficult. Therefore, an indirect immune fluorescence test as used to diagnose the second isolate. Five strains were isolated, which all were resistant to streptomycin. The prevalence of CEM since 1981 is summarised. The importance of...
Portas M, Boinas FS, Oliveira E Sousa J, Rawlings P.African horse sickness (AHS) was diagnosed for the first time in southern Portugal in autumn 1989, following outbreaks in Spain. AHS virus presence was confirmed by virus isolation and serotyping. An eradication campaign with four sanitary zones was set up by Central Veterinary Services in close collaboration with private organizations. Vaccination began on 6 October. In February 1990, vaccination was extended to all Portuguese equines (170000 animals). There were 137 outbreaks on 104 farms: 206 of the equidae present died (16%) or were slaughtered (14%); 81.5% were horses, 10.7% were donkeys ...
Blay KL, Gueirard P, Guiso N, Chaby R.Six monoclonal antibodies (mAbs) against lipopolysaccharides (LPS) from Bordetella pertussis (P1P3, 60.5), B. parapertussis (PP2, PP6, PPB) and B. bronchiseptica (BRg1) were used to examine the presence of antigenic determinants of LPS on B. bronchiseptica cells. Forty-eight clinical isolates of this Gram-negative bacterium (4 canine, 3 equine, 6 porcine, 4 rabbit and 31 human) were examined. Significant cross-reactivities with the heterologous anti-pertussis and anti-parapertussis mAbs were observed. The isolates also exhibited marked antigenic polymorphism. The 48 isolates could be classifie...
Yuen KY, Bielefeldt-Ohmann H.Ross River virus (RRV) has recently been suggested to be a potential emerging infectious disease worldwide. RRV infection remains the most common human arboviral disease in Australia, with a yearly estimated economic cost of $4.3 billion. Infection in humans and horses can cause chronic, long-term debilitating arthritogenic illnesses. However, current knowledge of immunopathogenesis remains to be elucidated and is mainly inferred from a murine model that only partially resembles clinical signs and pathology in human and horses. The epidemiology of RRV transmission is complex and multifactorial...
Sairanen J, Nivola K, Katila T, Virtala AM, Ojala M.The Finnish mating records of Standardbred trotters (SB; n = 33 679) and Finnhorses (FH; n = 32 731) were analysed to study the effect of the level of inbreeding on foaling rates and to estimate the heritability of foaling rate. A linear mixed model was assumed, with the outcome of the foaling (foal or no foal) as the trait of the study. A restricted maximum likelihood-based method was used to calculate the estimates of the variance components. Predictions of breeding values and estimates of fixed effects were also calculated. The average level of inbreeding was 9.9% in the SB and 3.6% in the ...
López RH, Soto SU, Gallego-Gómez JC.West Nile virus (WNV) is a member of the genus Flavivirus, and it is transmitted between Culex sp. mosquitoes and avian hosts. Equids and humans are commonly infected with WNV as dead-end hosts, and the signs and symptoms of infection range from mild illness to neurologic symptoms as encephalitis, meningitis and sometimes death. Previous phylogenetic studies have classified WNV into six genetically distinct lineages and provided valuable insight on WNV dispersal patterns within the Americas and its emergence in different geographic areas. In this study, we isolated, sequenced and genetically c...
