Genotyping in horses involves analyzing the genetic makeup of individual horses to identify specific genetic markers. This process aids in understanding genetic variations that may influence traits such as coat color, disease susceptibility, and performance capabilities. Genotyping can be used in breeding programs to select for desirable traits and manage genetic diversity within populations. Common methods for genotyping include single nucleotide polymorphism (SNP) analysis and microsatellite markers. This page compiles peer-reviewed research studies and scholarly articles that explore the methodologies, applications, and implications of genotyping in equine genetics and breeding.
Rui P, Zhao F, Yan S, Wang C, Fu Q, Hao J, Zhou X, Zhong H, Tang M, Hui W, Li W, Shi D, Ma Z, Song T.Hepatitis E virus (HEV) is the causative agent of acute self-limiting hepatitis in humans in developing countries. Hepatitis E virus RNA was first detected in donkeys in Spain, but little is known about the possible presence of HEV in donkeys in China. Objective: To investigate the prevalence of HEV in donkeys in northern China. Methods: Investigation of the prevalence of HEV in donkeys using serological, molecular and phylogenetic approaches. Methods: A total of 401 donkey serum specimens were tested for serological and molecular detection of HEV via enzyme-linked immunosorbent assay and quan...
Rockwell H, Mack M, Famula T, Sandmeyer L, Bauer B, Dwyer A, Lassaline M, Beeson S, Archer S, McCue M, Bellone RR.Equine recurrent uveitis (ERU) is characterized by intraocular inflammation that often leads to blindness in horses. Appaloosas are more likely than any other breed to develop insidious ERU, distinguished by low-grade chronic intraocular inflammation, suggesting a genetic predisposition. Appaloosas are known for their white coat spotting patterns caused by the leopard complex spotting allele (LP) and the modifier PATN1. A marker linked to LP on ECA1 and markers near MHC on ECA20 were previously associated with increased ERU risk. This study aims to further investigate these loci and identify a...
Ablondi M, Eriksson S, Tetu S, Sabbioni A, Viklund Å, Mikko S.The equestrian sport horse Swedish Warmblood (SWB) originates from versatile cavalry horses. Most modern SWB breeders have specialized their breeding either towards show jumping or dressage disciplines. The aim of this study was to explore the genomic structure of SWB horses to evaluate the presence of genomic subpopulations, and to search for signatures of selection in subgroups of SWB with high or low breeding values (EBVs) for show jumping. We analyzed high density genotype information from 380 SWB horses born in the period 2010-2011, and used Principal Coordinates Analysis and Discriminant...
Farries G, Bryan K, McGivney CL, McGettigan PA, Gough KF, Browne JA, MacHugh DE, Katz LM, Hill EW.While over ten thousand genetic loci have been associated with phenotypic traits and inherited diseases in genome-wide association studies, in most cases only a relatively small proportion of the trait heritability is explained and biological mechanisms underpinning these traits have not been clearly identified. Expression quantitative trait loci (eQTL) are subsets of genomic loci shown experimentally to influence gene expression. Since gene expression is one of the primary determinants of phenotype, the identification of eQTL may reveal biologically relevant loci and provide functional links ...
Amano T, Tozaki T, Takasu M, Onogi A, Yamada F, Kawai M, Ueda J.We investigated whether regular changes of the sire in a breeding farm of Hokkaido Native Horses (HKDs) enables the DNA-level genetic variation of the produced animals to be maintained. The genotypes of 31 microsatellite markers were identified and analyzed in 207 animals produced in a breeding farm in which the sire was replaced every 3 to 5 years. The mean allele number indicating the degree of genetic variation was 5.97 and was similar to those reported previously. The mean observed heterozygosity was 0.74 and was higher than the expected heterozygosity, 0.69; F was -0.07, indicating that ...
Işık R, Özdil F.Leptin receptor is a fundamental regulator in physiological functions of the regulation of food intake, energy homeostasis, immune function, and reproduction as well as on ovarian follicular cells on the placenta and lactating mammary glands. The aim of this study was to investigate the LEPR gene polymorphism in 60 donkeys reared in Thrace region of Turkey. A 585 bp long partial intron 6, exon 7, intron 7, and exon 8 regions of LEPR gene were amplified, and polymerase chain reaction products analyzed via DNA sequencing. A novel single-nucleotide polymorphism (SNP) was identified as g.713668A>...
Smith RM, Kotzé A, Grobler JP, Dalton DL.Toll-like receptors (TLR) are a family of proteins that signal activation of the innate immune response through the recognition of a variety of pathogen molecular compounds. Here, we characterized the complete TLR9 gene in Cape mountain zebra (Equus zebra zebra) from three populations in South Africa and compared sequences to a variety of horse and donkey breeds. Overall, we identified six single nucleotide polymorpHisms (SNPs). A single SNP (G586S) was non-synonymous, whereas the remaining SNPs were synonymous. The G586S alteration was detected in Cape mountain zebra populations with varying ...
Pusterla N, Hatch K, Crossley B, Wademan C, Barnum S, Flynn K.The objective of this study was to determine if the genotype of equine herpesvirus-1 (EHV-1) impacted clinical disease and outcome of horses with laboratory confirmed equine herpesvirus myeloencephalopathy (EHM). Medical records from 65 horses diagnosed with EHM from 2011 to 2019 were reviewed for signalment, presence and severity of clinical signs (lethargy, fever, ataxia, urinary incontinence) and outcome. Horses were further grouped based on the EHV-1 genotype into neuropathic (D) or non-neuropathic (N) EHV-1 infection. Between the two EHV-1 genotype groups, age and sex distributions were s...
Leite RO, Ferreira JF, Araújo CET, Delfiol DJZ, Takahira RK, Borges AS, Oliveira-Filho JP.Glanzmann's thrombasthenia (GT) is an autosomal recessive inherited disorder characterized by changes in platelet aggregation, leading to hemorrhage and epistaxis. To date, two independent mutations have been described in horses and associated with this disorder, a point mutation (c.122G > C) and a 10-base-pair deletion (g.1456_1466del) in the Integrin subunit alpha2β gene (ITGA2B) of horses of different breeds (Quarter Horse, Thoroughbred, Oldenburg, and Peruvian Paso). ITGA2B codifies the αIIb subunit of the αIIbβ3 integrin, also termed platelet fibrinogen receptor. Horses with GT have b...
Norton E, Schultz N, Geor R, McFarlane D, Mickelson J, McCue M.Equine metabolic syndrome (EMS) is a complex trait for which few genetic studies have been published. Our study objectives were to perform within breed genome-wide association analyses (GWA) to identify associated loci in two high-risk breeds, coupled with meta-analysis to identify shared and unique loci between breeds. GWA for 12 EMS traits identified 303 and 142 associated genomic regions in 264 Welsh ponies and 286 Morgan horses, respectively. Meta-analysis demonstrated that 65 GWA regions were shared across breeds. Region boundaries were defined based on a fixed-size or the breakdown of li...
Blott S, Cunningham H, Malkowski L, Brown A, Rauch C.Exercise-induced pulmonary haemorrhage (EIPH) occurs in horses performing high-intensity athletic activity. The application of physics principles to derive a 'physical model', which is coherent with existing physiology and cell biology data, shows that critical parameters for capillary rupture are cell-cell adhesion and cell stiffness (cytoskeleton organisation). Specifically, length of fracture in the capillary is a ratio between the energy involved in cell-cell adhesion and the stiffness of cells suggesting that if the adhesion diminishes and/or that the stiffness of cells increases EIPH is ...
Solé M, Ablondi M, Binzer-Panchal A, Velie BD, Hollfelder N, Buys N, Ducro BJ, François L, Janssens S, Schurink A, Viklund Å, Eriksson S....Copy Number Variation (CNV) is a common form of genetic variation underlying animal evolution and phenotypic diversity across a wide range of species. In the mammalian genome, high frequency of CNV differentiation between breeds may be candidates for population-specific selection. However, CNV differentiation, selection and its population genetics have been poorly explored in horses. Results: We investigated the patterns, population variation and gene annotation of CNV using the Axiom® Equine Genotyping Array (670,796 SNPs) from a large cohort of individuals (N = 1755) belonging to eight ...
The Journal of heredityOctober 20, 2019
Volume 110, Issue 7 769-781 doi: 10.1093/jhered/esz032
Han H, Bryan K, Shiraigol W, Bai D, Zhao Y, Bao W, Yang S, Zhang W, MacHugh DE, Dugarjaviin M, Hill EW.The Mongolian horse is one of the oldest extant horse populations and although domesticated, most animals are free-ranging and experience minimal human intervention. As an ancient population originating in one of the key domestication centers, the Mongolian horse may play a key role in understanding the origins and recent evolutionary history of horses. Here we describe an analysis of high-density genome-wide single-nucleotide polymorphism (SNP) data in 40 globally dispersed horse populations (n = 895). In particular, we have focused on new results from Chinese Mongolian horses (n = 100) that ...
Tanaka J, Leeb T, Rushton J, Famula TR, Mack M, Jagannathan V, Flury C, Bachmann I, Eberth J, McDonnell SM, Penedo MCT, Bellone RR.Mushroom is a unique coat color phenotype in Shetland Ponies characterized by the dilution of the chestnut coat color to a sepia tone and is hypothesized to be a recessive trait. A genome wide association study (GWAS), utilizing the Affymetrix 670K array (MNEc670k) and a single locus mixed linear model analysis (EMMAX), identified a locus on ECA7 for further investigation ( = 2.08 × 10). This locus contained a 3 Mb run of homozygosity in the 12 mushroom ponies tested. Analysis of high throughput Illumina sequencing data from one mushroom Shetland pony compared to 87 genomes from horses of var...
Aurich C, Müller-Herbst S, Reineking W, Müller E, Wohlsein P, Gunreben B, Aurich J.Warmblood fragile foal syndrome (WFFS) is a monogenetic defect with autosomal recessive inheritance. The WFFS homozygosity is non-compatible with extra-uterine life. Although as many as 15% of Warmblood horses are WFFS carriers, there has been little veterinary focus on this condition. The aim of this study was to determine outcomes and symptoms of clinical signs and pathological abnormalities during pregnancies when there were WFFS homozygous foetuses. Diagnostic material of 15 abortion or stillbirth cases with suspected diagnosis of WFFS was available for this study. Additionally, there were...
Rivas VN, Aleman M, Peterson JA, Dahlgren AR, Hales EN, Finno CJ.Juvenile idiopathic epilepsy (JIE) is an inherited disease characterized by recurrent seizures during the first year of life in Egyptian Arabian horses. Definitive diagnosis requires an electroencephalogram (EEG) performed by a veterinary specialist. A recent study has suggested that a 19 base-pair deletion, along with a triple-C insertion, in intron five of twelve (∆19InsCCC; chr20:29542397-29542425: GTTCAGGGGACCACATGGCTCTCTATAGA>TATCTTAAGACCC) of the () gene is associated with JIE. To confirm this association, a new sample set consisting of nine EEG-phenotyped affected and nine unaffec...
Tozaki T, Kusano K, Ishikawa Y, Kushiro A, Nomura M, Kikuchi M, Kakoi H, Hirota K, Miyake T, Hill EW, Nagata S.Fractures are medical conditions that compromise the athletic potential of horses and/or the safety of jockeys. Therefore, the reduction of fracture risk is an important horse and human welfare issue. The present study used molecular genetic approaches to determine the effect of genetic risk for fracture at four candidate SNPs spanning the myostatin (MSTN) gene on horse chromosome 18. Among the 3706 Japanese Thoroughbred racehorses, 1089 (29.4%) had experienced fractures in their athletic life, indicating the common occurrence of this injury in Thoroughbreds. In the case/control association st...
Sutton G, Garvey M, Cullinane A, Jourdan M, Fortier C, Moreau P, Foursin M, Gryspeerdt A, Maisonnier V, Marcillaud-Pitel C, Legrand L, Paillot R....Equine herpesvirus 1 (EHV-1) is an Alphaherpesvirus infecting not only horses but also other equid and non-equid mammals. It can cause respiratory distress, stillbirth and neonatal death, abortion, and neurological disease. The different forms of disease induced by EHV-1 infection can have dramatic consequences on the equine industry, and thus the virus represents a great challenge for the equine and scientific community. This report describes the progress of a major EHV-1 outbreak that took place in Normandy in 2009, during which the three forms of disease were observed. A collection of EHV-1...
Bellone RR, Ocampo NR, Hughes SS, Le V, Arthur R, Finno CJ, Penedo MCT.Catastrophic fractures are among the most common cause of fatalities in racehorses. Several factors, including genetics, likely contribute to increased risk for fatal injuries. A variant in the procollagen-lysine, 2-oxoglutarate 5-dioxygenase1 gene (PLOD1 c.2032G>A) was shown to cause Warmblood fragile foal syndrome type 1 (WFFS), a fatal recessive defect of the connective tissue. Screening of multiple horse breeds identified the presence of the WFFS allele in the Thoroughbred. PLOD1 is involved in cross-linking of collagen fibrils and thus could potentially increase the risk of catastrophic b...
Raudsepp T, Finno CJ, Bellone RR, Petersen JL.The horse reference genome from the Thoroughbred mare Twilight has been available for a decade and, together with advances in genomics technologies, has led to unparalleled developments in equine genomics. At the core of this progress is the continuing improvement of the quality, contiguity and completeness of the reference genome, and its functional annotation. Recent achievements include the release of the next version of the reference genome (EquCab3.0) and generation of a reference sequence for the Y chromosome. Horse satellite-free centromeres provide unique models for mammalian centromer...
Velie BD, Smith PM, Fjordbakk CT, Solé M, Jäderkvist Fegraeus K, Rosengren MK, Røed KH, Ihler CF, Lindgren G, Strand E.Dynamic laryngeal collapse (DLC) associated with poll flexion is the most common disorder of the upper respiratory tract (URT) in the Norwegian-Swedish Coldblooded Trotter (NSCT). The disorder, which has also been diagnosed in other breeds of trotters and gaited horses, appears to be related to anatomic phenotypes and only occurs during poll flexion when the horse is exercised 'on the bit'. Objective: Identify genomic regions associated with DLC in the NSCT by combining a rigorous phenotyping protocol with genomic data from a high-density equine genotyping array. Methods: Prospective case/cont...
Ablondi M, Viklund Å, Lindgren G, Eriksson S, Mikko S.A growing demand for improved physical skills and mental attitude in modern sport horses has led to strong selection for performance in many warmblood studbooks. The aim of this study was to detect genomic regions with low diversity, and therefore potentially under selection, in Swedish Warmblood horses (SWB) by analysing high-density SNP data. To investigate if such signatures could be the result of selection for equestrian sport performance, we compared our SWB SNP data with those from Exmoor ponies, a horse breed not selected for sport performance traits. Results: The genomic scan for homoz...
Ropka-Molik K, Stefaniuk-Szmukier M, Szmatoła T, Piórkowska K, Bugno-Poniewierska M.Arabian horses are commonly believed to be one of the oldest and the most popular horse breeds in the world, characterized by favourable stamina traits and exercise phenotypes. During intensive training, the rates of lactate production and utilization are critical to avoid muscle fatigue and a decrease in exercise performance. The key factor determining transmembrane lactate transport is the monocarboxylate transporter 1 protein coded for by the SLC16A1 gene. The aim of the present research was to identify polymorphisms in the coding sequence and UTRs in the equine SLC16A1 gene and to evaluate...
Farries G, Gough KF, Parnell AC, McGivney BA, McGivney CL, McGettigan PA, MacHugh DE, Katz LM, Hill EW.Despite strong selection for athletic traits in Thoroughbred horses, there is marked variation in speed and aptitude for racing performance within the breed. Using global positioning system monitoring during exercise training, we measured speed variables and temporal changes in speed with age to derive phenotypes for GWAS. The aim of the study was to test the hypothesis that genetic variation contributes to variation in end-point physiological traits, in this case galloping speed measured during field exercise tests. Standardisation of field-measured phenotypes was attempted by assessing horse...
Ripley AM, Penedo MCT, Grahn RA, Martinez de Andino EV, Walbornn SR, Serafini R, Love CC, Hinrichs K.Fetal genotyping has important applications in the horse, but currently necessitates embryo recovery and biopsy. We investigated whether fetal genotyping could be performed on yolk-sac fluid recovered from pregnant mares via transvaginal aspiration. Fluid was collected before Day 30 to provide results before establishment of the endometrial cups (Day 37). Genotyping and assessment of maternal DNA contamination was performed by analyzing histograms of PCR results for 19 loci. In Exp. 1, mares underwent yolk-sac aspiration on Days 22-28 of gestation. Fluid (0.56-1.02 mL) was recovered from fiv...
Dang W, Shang S, Zhang X, Yu Y, Irwin DM, Wang Z, Zhang S.Previous studies investigating donkey parentage and genetic diversity used horse-specific multiplex systems. However, several mis-allele and null-allele issues were found with some of the horse primers when used in donkeys. In 2017, the International Society for Animal Genetics (ISAG) recommended 13 dinucleotide short tandem repeats (STRs) (AHT4, ASB23, HMS2, HMS3, HMS6, HMS7, HMS18, HTG7, HTG10, TKY297, TKY312, TKY337 and TKY343) as a core panel that should be used to identify individuals and to test for parentage in donkeys. To date, no single multiplex STR typing system containing all 13 do...
Marquardt SA, Wilcox CV, Burns EN, Peterson JA, Finno CJ.Equine neuroaxonal dystrophy/equine degenerative myeloencephalopathy (eNAD/EDM) is a neurologic disease that has been reported in young horses from a wide range of breeds. The disease is inherited and associated with vitamin E deficiency during the first two years of life, resulting in bilateral symmetric ataxia. A missense mutation (chr3:71,917,591 C > T) within adhesion G protein-coupled receptor L3 (ADGRL3) was recently associated with risk for EDM in the Caspian breed. In order to confirm these findings, genotyping of this missense mutation, along with the three other associated single nuc...
Shrestha M, Solé M, Ducro BJ, Sundquist M, Thomas R, Schurink A, Eriksson S, Lindgren G.Equine insect bite hypersensitivity (IBH) is a pruritic skin allergy caused primarily by biting midges, Culicoides spp. IBH susceptibility has polygenic inheritance and occurs at high frequencies in several horse breeds worldwide, causing increased costs and reduced welfare of affected horses. The aim of this study was to identify and validate single nucleotide polymorphisms (SNPs) associated with equine IBH susceptibility. After quality control, 33,523 SNPs were included in a Bayesian genome-wide association study on 177 affected and 178 unaffected Icelandic horses. We report associated regio...
Lechmann J, Schoster A, Ernstberger M, Fouché N, Fraefel C, Bachofen C.Equid alphaherpesvirus 1 (EHV-1) infections can have a major impact on the horse industry and equine welfare by causing abortion or respiratory or neurologic disease. A single nucleotide polymorphism (A→G) in open reading frame (ORF) 30, encoding the catalytic subunit of the DNA polymerase, has been shown to be a strong predictive marker for neuropathogenicity. Given that a previously established real-time PCR (rtPCR) protocol yielded unsatisfactory results concerning determination of the EHV-1 genotype, we developed and evaluated a new conventional PCR protocol enabling identification of th...
Tirosh-Levy S, Gottlieb Y, Arieli O, Mazuz ML, King R, Horowitz I, Steinman A.Equine piroplasmosis (EP) is an important tick-borne disease of equids, caused by Theileria equi and Babesia caballi. It is endemic in most parts of the world, including Israel, and has clinical and economic consequences. This study was set to evaluate the presence of EP parasites in domestic donkeys and in wild equids in Israel and the Palestinian Authority (PA). To assess subclinical EP infection in 98 domestic donkeys (Equus africanus asinus), 9 Asiatic wild donkeys (Equus hemionus), 8 zebras (Equus quagga), 7 African wild donkeys (Equus africanus) and 5 mules, were tested using PCR and qPC...
Copy number variation (CNV) has been proved to be widespread in human, animal and plant genomes. Together with single nucleotide polymorphisms (SNPs), CVNs play a key role in genetic diversity. In this study, genome-wide detection of CNVs was performed based on SNP data from 24 Criollo Argentino horses genotyped with the GGP Equine70k array. Overall, 165 CNVs meeting stringent quality control criteria were identified and then aggregated into 87 CNV regions (CNVRs), representing a horse genome coverage of 13.69 Mb. Functional analysis of CNVRs allowed the identification of 337 genes implicate...
Hisey EA, Hermans H, Lounsberry ZT, Avila F, Grahn RA, Knickelbein KE, Duward-Akhurst SA, McCue ME, Kalbfleisch TS, Lassaline ME, Back W, Bellone RR.Distichiasis, an ocular disorder in which aberrant cilia (eyelashes) grow from the opening of the Meibomian glands of the eyelid, has been reported in Friesian horses. These misplaced cilia can cause discomfort, chronic keratitis, and corneal ulceration, potentially impacting vision due to corneal fibrosis, or, if secondary infection occurs, may lead to loss of the eye. Friesian horses represent the vast majority of reported cases of equine distichiasis, and as the breed is known to be affected with inherited monogenic disorders, this condition was hypothesized to be a simply inherited Mendeli...
Rockwell H, Mack M, Famula T, Sandmeyer L, Bauer B, Dwyer A, Lassaline M, Beeson S, Archer S, McCue M, Bellone RR.Equine recurrent uveitis (ERU) is characterized by intraocular inflammation that often leads to blindness in horses. Appaloosas are more likely than any other breed to develop insidious ERU, distinguished by low-grade chronic intraocular inflammation, suggesting a genetic predisposition. Appaloosas are known for their white coat spotting patterns caused by the leopard complex spotting allele (LP) and the modifier PATN1. A marker linked to LP on ECA1 and markers near MHC on ECA20 were previously associated with increased ERU risk. This study aims to further investigate these loci and identify a...
Dimsoski P.To describe the development and performance of the new horse genotyping kit. Methods: Highly discriminatory 17-Plex horse genotyping kit was designed by adding the fifth dye to the StockMarks kit for genotyping horses and taking advantage of the new instrument platforms. This was accomplished by using a new set of five fluorescent dyes developed by Applied Biosystems (DS-31), with four of the dyes used to label the forward amplification primers (6-FAM, VIC, NED, and PET) in each primer set. Results: The new equine kit contained five extra loci (ASB17, LEX3, HMS1, CA425, and ASB23) in addition ...
Howell AK, Malalana F, Beesley NJ, Hodgkinson JE, Rhodes H, Sekiya M, Archer D, Clough HE, Gilmore P, Williams DJL.Fasciola hepatica (liver fluke) affects grazing animals including horses but the extent to which it affects UK horses is unknown. Objective: To define how liver fluke affects the UK horse population. Methods: Descriptive, cross-sectional, observational study. Methods: An F. hepatica excretory-secretory antibody detection ELISA with a diagnostic sensitivity of 71% and specificity of 97% was validated and used to analyse serum samples. An abattoir study was performed to determine prevalence. A case-control study of 269 horses compared fluke exposure between horses with liver disease and control...
The Journal of heredityFebruary 21, 2008
Volume 99, Issue 2 130-136 doi: 10.1093/jhered/esm115
Rieder S, Hagger C, Obexer-Ruff G, Leeb T, Poncet PA.White markings and spotting patterns in animal species are thought to be a result of the domestication process. They often serve for the identification of individuals but sometimes are accompanied by complex pathological syndromes. In the Swiss Franches-Montagnes horse population, white markings increased vastly in size and occurrence during the past 30 years, although the breeding goal demands a horse with as little depigmented areas as possible. In order to improve selection and avoid more excessive depigmentation on the population level, we estimated population parameters and breeding value...
Miyazawa T, Matsuda M, Isayama Y, Samata T, Ishida Y, Ogawa S, Takei K, Honda M, Kamada M.Profiles of the genomic DNA of 104 strains of T. equigenitalis isolated from brood mares with contagious equine metritis in Hokkaido during the breeding seasons from 1980 to 1993, as well as those of five strains (SS28, EQ56, EQ59, EQ70 and HH139) previously isolated in Japan were examined after restriction digestion and crossed-field gel electrophoresis. These profiles were essentially identical to each other and the various isolates and strains appeared to have a common genotype, designated 'genotype J', with respect to two restriction enzymes, ApaI and NotI. These results suggest a common s...
Sunday Idoko I, Tirosh-Levy S, Leszkowicz Mazuz M, Mohammed Adam B, Sikiti Garba B, Wesley Nafarnda D, Steinman A.Equine piroplasmosis (EP) is a tick-borne disease of equids, caused by the two haemoprotozoal parasites: and Nigeria constitutes a major crossroads of animal transport in West Africa and may serve as a factor in EP dissemination in the region. The study aim was to characterize EP parasites in donkeys and horses in northern Nigeria using a molecular approach. Blood was collected from 57 donkeys and 47 horses. EP infection was detected and characterized by polymerase chain reaction (PCR). Twenty five donkeys (43.8%) were infected with , five (8.8%) with three (5.3%) with dual infections. Four...
Singh G.The equine influenza virus, Ludhiana/5/87, isolated from the clinical material during the epidemic of equine influenza in India in 1987 was inhibited in haemagglutination-inhibition test by the antiserum against the prototype A/eq/Prague/1/56 (H7N7) virus and by post-epidemic horse sera. In haemagglutinin and neuraminidase analysis, the A/eq/Ludhiana/5/87 isolate appeared similar to the prototype A/eq/Prague/1/56 virus and was characterized as the H7N7 subtype.
Deng L, Li W, Zhong Z, Liu X, Chai Y, Luo X, Song Y, Wang W, Gong C, Huang X, Hu Y, Fu H, He M, Wang Y, Zhang Y, Wu K, Cao S, Peng G.Giardia intestinalis, a cosmopolitan zoonotic parasite, is one of the most common causes of protozoal diarrhea in both humans and animals worldwide. Although G. intestinalis has been detected in many animals, information regarding its prevalence and genotype in Chinese racehorses is scarce. In the present study, we investigated the prevalence of G. intestinalis in racehorses and performed molecular characterization of the pathogen to assess its zoonotic potential. Two hundred and sixty-four racehorse fecal samples from six equestrian clubs located in different regions of the Sichuan province o...
Solé M, Valera M, Fernández J.The Pura Raza Español (PRE) is an autochthonous Spanish horse population distributed in 65 countries and managed by a single association. Since 1960s, breeding animals have been steadily exported to other countries to establish local subpopulations. We analysed the genetic structure of a PRE horse meta-population (MP) of 215,500 animals from countries with at least 80 active animals (27 countries comprising 77% of the total animals in the complete pedigree). Genotypes from active animals (59% of the total animals in the complete pedigree) were also studied. Genetic analysis of the MP was perf...
The Journal of heredityAugust 3, 2016
Volume 107, Issue 6 537-543 doi: 10.1093/jhered/esw042
Norton EM, Mickelson JR, Binns MM, Blott SC, Caputo P, Isgren CM, McCoy AM, Moore A, Piercy RJ, Swinburne JE, Vaudin M, McCue ME.Recurrent exertional rhabdomyolysis (RER) in Thoroughbred and Standardbred racehorses is characterized by episodes of muscle rigidity and cell damage that often recur upon strenuous exercise. The objective was to evaluate the importance of genetic factors in RER by obtaining an unbiased estimate of heritability in cohorts of unrelated Thoroughbred and Standardbred racehorses. Four hundred ninety-one Thoroughbred and 196 Standardbred racehorses were genotyped with the 54K or 74K SNP genotyping arrays. Heritability was calculated from genome-wide SNP data with a mixed linear and Bayesian model, ...
The Journal of hereditySeptember 13, 2011
Volume 102, Issue 6 753-758 doi: 10.1093/jhered/esr091
Guastella AM, Zuccaro A, Criscione A, Marletta D, Bordonaro S.Genetic diversity and relationship among 3 Sicilian horse breeds were investigated using 16 microsatellite markers and a 397-bp length mitochondrial D-loop sequence. The analysis of autosomal DNA was performed on 191 horses (80 Siciliano [SIC], 61 Sanfratellano [SAN], and 50 Sicilian Oriental Purebred [SOP]). SIC and SAN breeds were notably higher in genetic variability than the SOP. Genetic distances and cluster analysis showed a close relationship between SIC and SAN breeds, as expected according to the breeds' history. Sequencing of hypervariable mitochondrial DNA region was performed on a ...
Pronost S, Hue E, Fortier C, Foursin M, Fortier G, Desbrosse F, Rey FA, Pitel PH, Richard E, Saunier B.Like hepatitis C virus (HCV) in humans, the newly identified equine hepacivirus (NPHV) displays a predominating liver tropism that may evolve into chronic infections. The genomes of the two viruses share several organizational and functional features and are phylogenetically closest amongst the Hepacivirus genus. A limited amount of data is available regarding the spread of hepacivirus infections in horses. In this study, we asked whether in a more representative sample the prevalence and distribution of NPHV infections in France would resemble that reported so far in other countries. A total ...
Klumplerova M, Vychodilova L, Bobrova O, Cvanova M, Futas J, Janova E, Vyskocil M, Vrtkova I, Putnova L, Dusek L, Marti E, Horin P.Insect bite hypersensitivity (IBH) is an allergic dermatitis of horses caused by bites of insects. IBH is a multifactorial disease with contribution of genetic and environmental factors. Candidate gene association analysis of IBH was performed in a group of 89 Icelandic horses all born in Iceland and imported to Europe. Horses were classified in IBH-affected and non-affected based on clinical signs and history of recurrent dermatitis, and on the results of an in vitro sulfidoleukotriene (sLT)-release assay with Culicoides nubeculosus and Simulium vittatum extract. Different genetic markers wer...
Guérin G, Bailey E, Bernoco D, Anderson I, Antczak DF, Bell K, Biros I, Bjørnstad G, Bowling AT, Brandon R, Caetano AR, Cholewinski G, Colling D....A low-density, male-based linkage map was constructed as one of the objectives of the International Equine Gene Mapping Workshop. Here we report the second generation map based on testing 503 half-sibling offspring from 13 sire families for 344 informative markers using the CRIMAP program. The multipoint linkage analysis localized 310 markers (90%) with 257 markers being linearly ordered. The map included 34 linkage groups representing all 31 autosomes and spanning 2262 cM with an average interval between loci of 10.1 cM. This map is a milestone in that it is the first map with linkage groups ...
van der Heide R, Koopmans MP, Shekary N, Houwers DJ, van Duynhoven YT, van der Poel WH.To gain more insight into interspecies transmission of rotavirus group A, human and animal fecal samples were collected between 1997 and 2001 in The Netherlands. A total of 110 human stool samples were successfully P and G genotyped by reverse transcriptase PCR. All strains belonged to the main human rotavirus genotypes G1 to G4, G9, [P4], [P6], [P8], and [P9]. [P8]G1 was predominant, and 5.5% belonged to the G9 genotype. Eleven percent of all P[8] genotypes could be genotyped only by a recently published modified primer. Rotavirus-positive fecal samples from 28 calf herds were genotyped by DN...
Wolny-Koładka K, Lenart-Boroń A.The aim of the study was to determine the antimicrobial resistance profile and the occurrence of extended-spectrum beta-lactamase genes and to analyze the genetic diversity of Escherichia coli strains isolated from the environment of horse riding centers. The study was conducted using E. coli strains isolated from the air, manure, and horse nostril swabs in three horse riding centers differing in the system of horse keeping-stable (OJK Pegaz and KJK Szary) and free-range (SKH Nielepice). Resistance to antibiotics was determined using the disk-diffusion method, and the PCR technique was employe...
Kouam MK, Kantzoura V, Masuoka PM, Gajadhar AA, Theodoropoulos G.Equine piroplasms in Greece were studied using the reverse line blot hybridization (RLB) assay. Three genotypes consisting of two Theileria (T. equi and T. equi-like) and one Babesia (B. caballi-like) were identified. Of 787 samples tested, 371 (47.14%) hybridised to catchall probe (probe specifically designed to capture any piroplasm species present in a sample), 346 (43.96%) to T. equi probe, 364 (46.25%) to T. equi-like probe, 0 (0%) to B. caballi probe and 3 (0.38%) to B. caballi-like probe. Seven samples gave faint signals with the catchall probe only, indicating the presence of known or ...
Brooks SA, Stick J, Braman A, Palermo K, Robinson NE, Ainsworth DM.Equine recurrent laryngeal neuropathy (RLN) is a bilateral mononeuropathy with an unknown etiology. In Thoroughbreds (TB), we previously demonstrated that the haplotype association for height (LCORL/NCAPG locus on ECA3, which affects body size) and RLN was coincident. In the present study, we performed a genome-wide association scan (GWAS) for RLN in 458 American Belgian Draft Horses, a breed fixed for the LCORL/NCAPG risk alelle. In this breed, RLN risk is associated with sexually dimorphic differences in height, and we identified a novel locus contributing to height in a sex-specific manner:...
Stasiak K, Dunowska M, Hills SF, Rola J.Equid herpesvirus type 1 (EHV-1) is a common viral infection associated with varied clinical outcomes including respiratory disease, abortion and neurological disease. We have characterized EHV-1 sequences (n = 38) obtained from cases of equine abortion in Poland between 1999 and 2016, based on sequencing of PCR products from open reading frames (ORF) 30 and 68 of the EHV-1 genome. The majority (81.6%) of sequences were not classified into any of the previously described groups based on the ORF68 sequence. The remaining sequences belonged to ORF68 group III (7.9%) or IV (10.5%). A haplotype ne...
Wolfsberger WW, Ayala NM, Castro-Marquez SO, Irizarry-Negron VM, Potapchuk A, Shchubelka K, Potish L, Majeske AJ, Oliver LF, Lameiro AD....Since the first Spanish settlers brought horses to America centuries ago, several local varieties and breeds have been established in the New World. These were generally a consequence of the admixture of the different breeds arriving from Europe. In some instances, local horses have been selectively bred for specific traits, such as appearance, endurance, strength, and gait. We looked at the genetics of two breeds, the Puerto Rican Non-Purebred (PRNPB) (also known as the "Criollo") horses and the Puerto Rican Paso Fino (PRPF), from the Caribbean Island of Puerto Rico. While it is reasonable ...
Go YY, Cook RF, Fulgêncio JQ, Campos JR, Henney P, Timoney PJ, Horohov DW, Balasuriya UB.In a recent study, we demonstrated that the virulent Bucyrus strain (VBS) of EAV could infect in vitro a small population of CD3(+) T lymphocytes from some but not all horses. Furthermore, we have shown that a common haplotype is associated with this in vitro CD3(+) T cell susceptibility/resistance phenotype to EAV infection. In this study, we investigated whether the differences in the susceptibility or resistance of CD3(+) T cells in vitro correlate with the outcome and severity of clinical signs in vivo. Thus, horses were divided into two groups based on their CD3(+) T cell susceptible or r...
Grilz-Seger G, Reiter S, Neuditschko M, Wallner B, Rieder S, Leeb T, Jagannathan V, Mesarič M, Cotman M, Pausch H, Lindgren G, Velie B, Horna M....The roan coat color in horses is characterized by dispersed white hair and dark points. This phenotype segregates in a broad range of horse breeds, while the underlying genetic background is still unknown. Previous studies mapped the roan locus to the KIT gene on equine chromosome 3 (ECA3). However, this association could not be validated across different horse breeds. Performing a genome-wide association analysis (GWAS) in Noriker horses, we identified a single nucleotide polymorphism (SNP) (ECA3:g.79,543.439 A > G) in the intron 17 of the KIT gene. The G -allele of the top associated SNP...
Reissmann M, Musa L, Zakizadeh S, Ludwig A.Considering the hidden mode of inheritance of some coat-color-associated alleles, we investigated the presence/absence of coat-color-associated alleles in 1093 domestic horses of 55 breeds and 20 specimens of Przewalski's horse. For coat-color genotyping, allele specific PCR, pyrosequencing and Li-Cor analyses were conducted on 12 coat-color-associated alleles of five genes. Our data provide deep insight into the distribution of coat-color-associated alleles within breeds. We found that the alleles for the basic colorations (bay, black, and chestnut) are widely distributed and occur in nearly ...
Kakoi H, Kikuchi M, Tozaki T, Hirota KI, Nagata SI, Hobo S, Takasu M.The distribution of Y chromosomal haplotypes in Japanese native horse populations was investigated to obtain genetic information on these populations. Here, 159 male/gelded horses from eight local populations were investigated, and three Y haplotypes (JHT-1, JHT-2, and JHT-3) were identified by analyzing five Y-linked loci. Five populations had only JHT-1, whereas two populations had only JHT-2. One population had JHT-1 and JHT-3. Based on the geographical distribution of these haplotypes and previously reported haplotypes for other Asian horses, JHT-1 is considered to be a major haplotype in ...
Liu LL, Fang C, Liu WJ.The utility of high-density single nucleotide polymorphism (SNP) data help to accurately identify genomic regions that have undergone positive selection. In this study, the Affymetrix Equine 670 K high-density SNP array was used to genotype Kazakh and Yili horse population. After quality control, 370,227 autosomal SNPs were used to detect selection signatures by using global fixation index (F) and cross-population extended haplotype homozygosity (XP-EHH). The database of Ensemble, Genecards, and NCBI were used to make gene annotation and functional analysis. The results showed that there wer...
Rejmanek D, Miller MA, Grigg ME, Crosbie PR, Conrad PA.Sarcocystis neurona is a significant cause of neurological disease in horses and other animals, including the threatened Southern sea otter (Enhydra lutris nereis). Opossums (Didelphis virginiana), the only known definitive hosts for S. neurona in North America, are an introduced species in California. S. neurona DNA isolated from sporocysts and/or infected tissues of 10 opossums, 6 horses, 1 cat, 23 Southern sea otters, and 1 harbor porpoise (Phocoena phocoena) with natural infections was analyzed based on 15 genetic markers, including the first internal transcribed spacer (ITS-1) region; the...
He Z, Dai X, Lyu W, Beaumont M, Yu F.Novel technologies for recovering DNA information from archaeological and historical specimens have made available an ever-increasing amount of temporally spaced genetic samples from natural populations. These genetic time series permit the direct assessment of patterns of temporal changes in allele frequencies and hold the promise of improving power for the inference of selection. Increased time resolution can further facilitate testing hypotheses regarding the drivers of past selection events such as the incidence of plant and animal domestication. However, studying past selection processes ...
Cuxson JL, Hartley CA, Ficorilli NP, Symes SJ, Devlin JM, Gilkerson JR.A single nucleotide polymorphism (SNP) has been previously associated with EHV-1 neurological disease in several countries around the world. This disease is very uncommon in Australia and little information is available about the presence of this SNP in Australian EHV-1 isolates. The ORF30 sequence of 66 Australian EHV-1 isolates was determined and the genotype was compared to the disease manifestation of the case from which the virus was isolated. Of the 66 isolates, 61 were from cases of abortion and 5 were cases associated with equine herpesvirus myeloencephalopathy (EHM). There was no asso...