Genotyping in horses involves analyzing the genetic makeup of individual horses to identify specific genetic markers. This process aids in understanding genetic variations that may influence traits such as coat color, disease susceptibility, and performance capabilities. Genotyping can be used in breeding programs to select for desirable traits and manage genetic diversity within populations. Common methods for genotyping include single nucleotide polymorphism (SNP) analysis and microsatellite markers. This page compiles peer-reviewed research studies and scholarly articles that explore the methodologies, applications, and implications of genotyping in equine genetics and breeding.
Ivens PA, Matthews D, Webb K, Newton JR, Steward K, Waller AS, Robinson C, Slater JD.Strangles is the most commonly diagnosed and important infectious disease of horses worldwide. Very little is known about the temporo-spatial and molecular epidemiology of strangles. The disease is not notifiable in the UK and there are few published data on the geographical locations of outbreaks. Objective: To investigate whether typing of a surface protein (SeM) of Streptococcus equi ssp. equi (S. equi), the causative agent of strangles, is a useful epidemiological tool. Methods: The variable region of the SeM gene was amplified from 145 isolates of S. equi by PCR and sequenced. Different S...
Donabedian SM, Perri MB, Abdujamilova N, Gordoncillo MJ, Naqvi A, Reyes KC, Zervos MJ, Bartlett P.Vancomycin-resistant enterococci are a major cause of nosocomial infections but are rarely found in humans in the community and have not been identified in food animals in the United States. We evaluated a total of 360 fecal specimens from humans and their animals being raised for exhibit at three county fairs in Michigan. Fecal samples from 158 humans, 55 swine, 50 cattle, 25 horses, 57 sheep, 14 goats, and 1 llama were obtained and plated onto Enterococcosel agar containing 16 μg/ml of vancomycin. Vancomycin-resistant Enterococcus faecium (VREF) was isolated from six pigs but not from human...
Lin Y, Barker E, Kislow J, Kaldhone P, Stemper ME, Pantrangi M, Moore FM, Hall M, Fritsche TR, Novicki T, Foley SL, Shukla SK.Not much is known about the zoonotic transmission of methicillin-resistant Staphylococcus aureus (MRSA) in companion animals in the United States. We report the rate of prevalence of S. aureus and MRSA recovered from clinical samples of animals requiring treatment at veterinary clinics throughout the upper midwestern and northeastern United States. Methods: We compared phenotypes, genotypes, and virulence profiles of the MRSA isolates identified in companion animals, such as cats, dogs, horses, and pigs, with typical human nosocomial and community-associated MRSA (CA-MRSA) genotypes to assess ...
Burton AJ, Nydam DV, Dearen TK, Mitchell K, Bowman DD, Xiao L.To date, little is known about the prevalence, genotypes and zoonotic potential of Cryptosporidium spp. affecting horses, especially in North America. A cross-sectional study was conducted in New York, USA between February 25th and May 1st 2009. Fecal samples were collected from three hundred and forty nine 1-10-week-old foals and their dams on 14 different broodmare farms. All fecal samples were screened for Cryptosporidium spp. using a direct immunofluorescence assay (DFA). DNA extraction and PCR-RFLP analysis of the small-subunit (SSU) rRNA gene were performed on all the foal samples. PCR-p...
Dall'Olio S, Fontanesi L, Nanni Costa L, Tassinari M, Minieri L, Falaschini A.Myostatin (MSTN) is a negative modulator of muscle mass. We characterized the horse (Equus caballus) MSTN gene and identified and analysed single nucleotide polymorphisms (SNPs) in breeds of different morphological types. Sequencing of coding, untranslated, intronic, and regulatory regions of MSTN gene in 12 horses from 10 breeds revealed seven SNPs: two in the promoter, four in intron 1, and one in intron 2. The SNPs of the promoter (GQ183900:g.26T>C and GQ183900:g.156T>C, the latter located within a conserved TATA-box like motif) were screened in 396 horses from 16 breeds. The g.26C an...
Bolton T, Kuskie K, Halbert N, Chaffin K, Healy M, Lawhon S, Jackson A, Cohen N.Rhodococcus equi is an important pathogen of foals aged 1-6 months. Evidence exists that foals are exposed to a wide diversity of R. equi strains in their environment. However, limited data are available regarding the extent to which genotypic variation exists among isolates infecting individual foals. Therefore, electrophoresis of repetitive sequence-based polymerase chain reaction (rep-PCR) amplicons in an automated microfluidics chip format was used to genotype 9 virulent R. equi isolates obtained from distinct anatomic locations in a single foal. Four of the isolates were obtained from dif...
Brault SA, Bird BH, Balasuriya UB, MacLachlan NJ.Equine herpesvirus-2 (EHV-2) infection has been implicated as a cause of a variety of clinical disorders in young horses, including upper respiratory tract disease, generalized malaise, fever, pharyngeal lymphoid hyperplasia, and lymphadenopathy. Considerable sequence heterogeneity has been demonstrated previously among EHV-2 strains, and individual horses can be concurrently infected with more than one virus strain. In this study, the temporal variation of the viral load and genomic diversity of the glycoprotein B (gB) gene of EHV-2 in the nasal secretions of a cohort of foals was characteriz...
Dallap Schaer BL, Aceto H, Rankin SC.Nosocomial salmonellosis is an important problem for large animal veterinary teaching hospitals (VTHs). Objective: To describe failure of an Infection Control Program (ICP) that resulted in an outbreak of salmonellosis caused by Salmonella Newport multidrug resistant (MDR)-AmpC at a large animal VTH. Methods: Sixty-one animals identified with the outbreak strain of Salmonella. Methods: Retrospective study: Data collected included signalment, presenting complaint, duration of hospitalization, discharge status, and financial information. Phenotypic and genotypic characterization was performed on...
Kouam MK, Kantzoura V, Masuoka PM, Gajadhar AA, Theodoropoulos G.Equine piroplasms in Greece were studied using the reverse line blot hybridization (RLB) assay. Three genotypes consisting of two Theileria (T. equi and T. equi-like) and one Babesia (B. caballi-like) were identified. Of 787 samples tested, 371 (47.14%) hybridised to catchall probe (probe specifically designed to capture any piroplasm species present in a sample), 346 (43.96%) to T. equi probe, 364 (46.25%) to T. equi-like probe, 0 (0%) to B. caballi probe and 3 (0.38%) to B. caballi-like probe. Seven samples gave faint signals with the catchall probe only, indicating the presence of known or ...
Bartolomé E, Goyache F, Molina A, Cervantes I, Valera M, Gutiérrez JP.A method to quantify the contribution of subpopulations to genetic diversity in the whole population was assessed using pedigree information. The standardization of between- and within-subpopulation mean coancestries was developed to account for the different coat colour subpopulation sizes in the Spanish Purebred (SPB) horse population. The data included 166264 horses registered in the SPB Studbook. Animals born in the past 11 years (1996 to 2006) were selected as the 'reference population' and were grouped according to coat colour into eight subpopulations: grey (64 836 animals), bay (33 633...
Jahn P, Zeman P, Bezdekova B, Praskova I.Twelve confirmed cases of equine granulocytic anaplasmosis (EGA) and five additional suspected cases, showing a compatible clinical history and specific IgG titres of 1280 or above, were recorded in the Czech Republic during the period 2002 to 2008. The diagnosis was based on clinical signs, the detection of Anaplasma phagocytophilum morulae in neutrophils in blood smears, serology and molecular methods. Pyrexia (39.8 to 41.3 degrees C), depression, partial or total anorexia, limb oedema and icterus were the most frequently observed clinical abnormalities. Haematological examination revealed t...
Ling Y, Ma Y, Guan W, Cheng Y, Wang Y, Han J, Jin D, Mang L, Mahmut H.Y chromosome acts as a single nonrecombining unit that is male specific and in effect haploid, thus ensuring the preservation of mutational events as a single haplotype via male lines. In this study, 6 Y chromosome-specific microsatellites (SSR) were tested for the patrilineal genetic variations of 573 male samples from Chinese domestic horse (30 breeds), Przewalski's horse, and donkey. All the 6 loci appeared as a haplotype block in Przewalski's horse and the domestic donkey. There were notable differences, however, at Y chromosome markers between horse and donkey. There were 2 haplotypes of ...
Easton C, Fuentealba NA, Paullier C, Alonzo P, Carluccio J, Galosi CM.Equine herpesvirus 1 (EHV-1) is a major cause of epidemic abortion, neonatal mortality, respiratory disease and neurological disorders in horses. In South America, the virus has been isolated in Brazil, Argentina and Colombia. In Chile pathological findings from one aborted foetus have been reported, and in Uruguay only serological data about EHV-1 activity have been found. Some pathological findings were reported in Uruguay several years ago, but these data have never been officially confirmed. The present work describes the relevant findings of a study of EHV-1 infections in the Uruguayan eq...
Bhoora R, Quan M, Matjila PT, Zweygarth E, Guthrie AJ, Collins NE.Although a quantitative real-time PCR assay (qPCR) assay for the detection of Theileria equi has been developed and evaluated, it is possible that additional, as yet undetected 18S rRNA gene sequence variants may exist. A qPCR assay targeting a different gene, used in conjunction with the T. equi 18S rRNA qPCR assay, could assist in the detection of all T. equi genotypes in field samples. A T. equi ema-1-specific qPCR (Ueti et al., 2003) was tested on 107 South African field samples, 90 of which tested positive for T. equi antibody using the immuno-fluorescent antibody test (IFAT). The qPCR as...
Fasanella A, Garofolo G, Galante D, Quaranta V, Palazzo L, Lista F, Adone R, Jones MH.Anthrax is a disease of humans and animals caused by the encapsulated, spore-forming Bacillus anthracis. In Italy, anthrax is normally a sporadic disease. During the summer 2004, anthrax broke out in the Basilicata, in southern Italy, a region with a low prevalence of anthrax in which vaccination had been suspended since 1998. The disease involved several animals in few weeks and in a large area. Over 41 days, 81 cattle died, as well as 15 sheep, 9 goats, 11 horses and 8 deer. The Multiple-locus Variable-Number Tandem Repeats Analysis (MLVA) showed that all the 53 isolates belonged to the Clus...
Brooks SA, Gabreski N, Miller D, Brisbin A, Brown HE, Streeter C, Mezey J, Cook D, Antczak DF.Lavender Foal Syndrome (LFS) is a lethal inherited disease of horses with a suspected autosomal recessive mode of inheritance. LFS has been primarily diagnosed in a subgroup of the Arabian breed, the Egyptian Arabian horse. The condition is characterized by multiple neurological abnormalities and a dilute coat color. Candidate genes based on comparative phenotypes in mice and humans include the ras-associated protein RAB27a (RAB27A) and myosin Va (MYO5A). Here we report mapping of the locus responsible for LFS using a small set of 36 horses segregating for LFS. These horses were genotyped usin...
Pronost S, Léon A, Legrand L, Fortier C, Miszczak F, Freymuth F, Fortier G.Equine herpesvirus 1 (EHV-1) is a common pathogen of the horse which may induce mild respiratory distress, abortion, neonatal death and neurological disease. A single nucleotide polymorphism in the EHV-1 DNA polymerase (ORF30 A(2254) to G(2254)) has been associated with clinical signs of Equine herpes myeloencephalopathy (EHM). The aim of this work was to analyze the ORF30 genomic region among a panel of EHV-1 DNA extract in order to estimate the prevalence of the EHV-1 neuropathogenic genotype in France. Samples coming from cases associated with EHM, horses with respiratory symptoms and abort...
Bellone RR, Forsyth G, Leeb T, Archer S, Sigurdsson S, Imsland F, Mauceli E, Engensteiner M, Bailey E, Sandmeyer L, Grahn B, Lindblad-Toh K, Wade CM.Leopard Complex spotting occurs in several breeds of horses and is caused by an incompletely dominant allele (LP). Homozygosity for LP is also associated with congenital stationary night blindness (CSNB) in Appaloosa horses. Previously, LP was mapped to a 6 cm region on ECA1 containing the candidate gene TRPM1 (Transient Receptor Potential Cation Channel, Subfamily M, Member 1) and decreased expression of this gene, measured by qRT-PCR, was identified as the likely cause of both spotting and ocular phenotypes. This study describes investigations for a mutation causing or associated with the Le...
Rejmanek D, Miller MA, Grigg ME, Crosbie PR, Conrad PA.Sarcocystis neurona is a significant cause of neurological disease in horses and other animals, including the threatened Southern sea otter (Enhydra lutris nereis). Opossums (Didelphis virginiana), the only known definitive hosts for S. neurona in North America, are an introduced species in California. S. neurona DNA isolated from sporocysts and/or infected tissues of 10 opossums, 6 horses, 1 cat, 23 Southern sea otters, and 1 harbor porpoise (Phocoena phocoena) with natural infections was analyzed based on 15 genetic markers, including the first internal transcribed spacer (ITS-1) region; the...
Hirota K, Kakoi H, Gawahara H, Hasegawa T, Tozaki T.We characterized the SNP 53 JPN System for parentage verification during horse registry. The SNP 53 JPN System was constructed using 53 highly polymorphic single nucleotide polymorphisms (SNPs), which were amplified and genotyped with 2 multiplex assays. The SNP 53 JPN System showed good resolution for 95 unrelated thoroughbreds, and the exclusion probability (PE01) for each SNP ranged from 11.5 to 23.0%, resulting in a total PE01 value of 99.996%. These results indicate that the SNP 53 JPN System is useful for parentage testing of thoroughbreds. Of the 53 SNPs, 8 SNPs could be used to exclude...
Tallmadge RL, Campbell JA, Miller DC, Antczak DF.The genomic sequences of 15 horse major histocompatibility complex (MHC) class I genes and a collection of MHC class I homozygous horses of five different haplotypes were used to investigate the genomic structure and polymorphism of the equine MHC. A combination of conserved and locus-specific primers was used to amplify horse MHC class I genes with classical and nonclassical characteristics. Multiple clones from each haplotype identified three to five classical sequences per homozygous animal and two to three nonclassical sequences. Phylogenetic analysis was applied to these sequences, and gr...
Hill EW, Gu J, Eivers SS, Fonseca RG, McGivney BA, Govindarajan P, Orr N, Katz LM, MacHugh DE.Variants of the MSTN gene encoding myostatin are associated with muscle hypertrophy phenotypes in a range of mammalian species, most notably cattle, dogs, mice, and humans. Using a sample of registered Thoroughbred horses (n = 148), we have identified a novel MSTN sequence polymorphism that is strongly associated (g.66493737C>T, P = 4.85x10(-8)) with best race distance among elite racehorses (n = 79). This observation was independently validated (P = 1.91x10(-6)) in a resampled group of Thoroughbreds (n = 62) and in a cohort of Thoroughbreds (n = 37, P = 0.0047) produced by the same trainer...
Murray SJ, Santangelo KS, Bertone AL.To evaluate early cellular influences of bone morphogenetic protein (BMP)12 and BMP2 on equine superficial digital flexor tenocytes (SDFTNs) and equine bone marrow-derived mesenchymal stem cells (BMDMSCs). Methods: 9 adult clinically normal horses. Methods: BMDMSCs and SDFTNs were cultured in monolayer, either untreated or transduced with adenovirus encoding green fluorescent protein, adenovirus encoding BMP12, or adenovirus encoding BMP2. Cytomorphologic, cytochemical, immunocytochemical, and reverse transcriptase-quantitative PCR (RT-qPCR) analyses were performed on days 3 and 6. Genetic pro...
Mittmann EH, Mömke S, Distl O.Chronic pastern dermatitis (CPD), also known as chronic progressive lymphedema (CPL), is a skin disease that affects draft horses. This disease causes painful lower-leg swelling, nodule formation, and skin ulceration, interfering with movement. The aim of this whole-genome scan was to identify quantitative trait loci (QTL) for CPD in German draft horses. We recorded clinical data for CPD in 917 German draft horses and collected blood samples from these horses. Of these 917 horses, 31 paternal half-sib families comprising 378 horses from the breeds Rhenish German, Schleswig, Saxon-Thuringian, a...
DeAssis JB, DeLaat DM, Peixoto MG, Bergmann JA, Fonseca CG, Carvalho MR.One hundred and fifteen unrelated Mangalarga Marchador horses were sampled from three geographically distinct regions of Minas Gerais State, Brazil (South, Southeast, and Northeast) and tested for 10 microsatellite loci. Genetic diversity and population structure parameters were estimated with ARLEQUIN 3.0, CERVUS 2.0, POPGENE 1.31, GENEPOP on the web, STRUCTURE 2.0, and SPAGEDI 1.2 software packages. Under Hardy-Weinberg assumptions, seven markers were at equilibrium (LEX014, LEX017, LEX019, SGCV23, TKY321, VHL20, and VIASH39), while two (ASB3 and LEX031) presented significant homozygote exce...
BMC research notesDecember 16, 2009
Volume 2 255 doi: 10.1186/1756-0500-2-255
Rendo F, Iriondo M, Manzano C, Estonba A.The Cantabrian Coast horse breeds of the Iberian Peninsula have mainly black or bay colored coats, but alleles responsible for a chestnut coat color run in these breeds and occasionally, chestnut horses are born. Chestnut coat color is caused by two recessive alleles, e and e(a), of the melanocortin-1 receptor gene, whereas the presence of the dominant, wild-type E allele produces black or bay coat horses. Because black or bay colored coats are considered as the purebred phenotype for most of the breeds from this region, it is important to have a fast and reliable method to detect alleles caus...
Ossiprandi MC, Buttrini M, Bottarelli E, Zerbini L.Clostridium difficile, associated with a wide spectrum of diseases in humans, as well as in several animal species, is an important cause of colitis in adult horses and foals. The aim of this study was to investigate by toxin gene profile and PCR-ribotyping the molecular characteristics of 14 C. difficile strains isolated from 42 faeces of healthy horses. Both toxin genes, tcdA and tcdB, were present in only 1 isolate (7.1%). Six isolates (42.9%) demonstrated tcdA-/tcdB+ genotype, and seven isolates (50.0%) were tcdA-/tcdB-. All strains were binary toxin genes negative (cdtA-/cdtB-). The PCR-p...
Hornstra H, Pearson T, Georgia S, Liguori A, Dale J, Price E, O'Neill M, Deshazer D, Muhammad G, Saqib M, Naureen A, Keim P.We collected epidemiologic and molecular data from Burkholderia mallei isolates from equines in Punjab, Pakistan from 1999 through 2007. We show that recent outbreaks are genetically distinct from available whole genome sequences and that these genotypes are persistent and ubiquitous in Punjab, probably due to human-mediated movement of equines.
Horin P, Sabakova K, Futas J, Vychodilova L, Necesankova M.In previous work, we found significant associations of horse polymorphic microsatellite and immunity-related (IR) gene markers with Rhodococcus equi infection of foals. Here, a statistically significant association between a single nucleotide polymorphism (SNP) within the interleukin 7 receptor-encoding gene (IL7R) with high R. equi burden in transtracheal aspirates was found (Fisher's F = 0.043, odds ratio: 8.00, 95% confidence interval: 1.127-56.795). Further positional and/or functional candidate genes investigated TLR2, IL13, IL17A, IL28R, TACE/ADAM 17 and GBP1, were not associated with in...
Salim B, Bakheit MA, Kamau J, Nakamura I, Sugimoto C.This is a molecular epidemiological investigation on Theileria equi, a causative agent of equine piroplasmosis. Blood samples were collected from 127 horses from different geographical locations in Sudan. The small subunit of rRNA gene (18S; ~1,600 bp) was amplified from 20 positive field samples and subsequently subjected to direct sequencing and analysis to reveal possible strain differences and the presence of a novel species or genotypes. Sequences were compared with published sequences mainly from South African and Spanish isolates. Eleven distinct T. equi sequences within 18S rRNA gene w...
Valberg SJ, Henry ML, Herrick KL, Velez-Irizarry D, Finno CJ, Petersen JL.Genetic tests for variants in MYOT (P2; rs1138656462), FLNC (P3a; rs1139799323 or P3b; rs1142918816) and MYOZ3 (P4; rs1142544043) genes are offered commercially to diagnose myofibrillar myopathy (MFM) and type 2 polysaccharide storage myopathy (PSSM2) in Quarter Horses (QH). Objective: To determine if PSSM2-QH has histopathological features of MFM. To compare genotype and allele frequencies of variants P2, P3, P4 between control-QH and PSSM2-QH diagnosed by histopathology. Methods: Retrospective cross-sectional. Methods: The study includes a total of 229 healthy control-QH, 163 PSSM2-QH GYS1 ...
Dang W, Shang S, Zhang X, Yu Y, Irwin DM, Wang Z, Zhang S.Previous studies investigating donkey parentage and genetic diversity used horse-specific multiplex systems. However, several mis-allele and null-allele issues were found with some of the horse primers when used in donkeys. In 2017, the International Society for Animal Genetics (ISAG) recommended 13 dinucleotide short tandem repeats (STRs) (AHT4, ASB23, HMS2, HMS3, HMS6, HMS7, HMS18, HTG7, HTG10, TKY297, TKY312, TKY337 and TKY343) as a core panel that should be used to identify individuals and to test for parentage in donkeys. To date, no single multiplex STR typing system containing all 13 do...
Ishida N, Hasegawa T, Oyunsuren T, Mukoyama H.The mitochondrial DNA sequence of cytochrome b gene in a Thoroughbred horse was determined. By comparing DNA sequences between the Thoroughbred and published sequence data (two horses and one Grevyi zebra), polymerase chain reaction (PCR) primers were designed for amplification of a 590 bp DNA fragment in the cytochrome b gene, and PCR-restriction fragment length polymorphism (RFLP) analysis was studied in 140 horses of six breeds using three restriction enzymes (AciI, BamHI, RsaI). Two morphs were found using each of the three enzymes. By combining three enzymes morphs, the 140 horses examine...
Rivas VN, Aleman M, Peterson JA, Dahlgren AR, Hales EN, Finno CJ.Juvenile idiopathic epilepsy (JIE) is an inherited disease characterized by recurrent seizures during the first year of life in Egyptian Arabian horses. Definitive diagnosis requires an electroencephalogram (EEG) performed by a veterinary specialist. A recent study has suggested that a 19 base-pair deletion, along with a triple-C insertion, in intron five of twelve (∆19InsCCC; chr20:29542397-29542425: GTTCAGGGGACCACATGGCTCTCTATAGA>TATCTTAAGACCC) of the () gene is associated with JIE. To confirm this association, a new sample set consisting of nine EEG-phenotyped affected and nine unaffec...
Ayala-Valdovinos MA, Galindo-García J, Sánchez-Chiprés D, Duifhuis-Rivera T.Lethal white foal syndrome (LWFS) is an autosomal recessive disease of neonatal foals characterized by a white hair coat and a functional intestinal obstruction. Traditional techniques for identifying the dinucleotide mutation (TC→AG) of the endothelin receptor B gene (EDNRB) associated with LWFS are time-consuming. We developed a new technique based on mutagenically separated polymerase chain reaction (MS-PCR) for simple detection of the EDNRB genotype in horses.
Silva ILS, Junqueira GSB, Oliveira CAA, Costa RB, DE Camargo GMF.Grullo is a dun dilution on a black coat that is common in the Campolina horse: an autochthonous Brazilian breed. The aims of this case study were to evaluate inconsistencies in grullo coat color registration and to explain their possible causes. A total of 3,270 grullo Campolina horses were evaluated. To confirm the genetic possibility of having grullo animals, the coat color genotypes of parents were inferred by phenotype and compared with those of progeny. A total of 242 horses that were registered as grullos could not have this coat based on their parents' information. Possible explanation...
Dias De Castro LL, Oliveira Júnior GA, Perez BC, Carvalho ME, De Souza Ramos EA, Ferraz JBS, Molento MB.Cyathostomins are considered one of the most important parasites of horses. A group of horses within a herd can be responsible for eliminating the majority of parasite eggs. This phenotype might be explained by genetic factors. This study aimed to identify genomic regions associated with fecal egg count (FEC) and hematological parameters by performing a genomic-wide association study (GWAS) in Thoroughbred horses naturally infected with cyathostomins. Packed cell volume (PCV), differential leukocyte, and FEC were determined from 90 horses. All animals were genotyped using the Illumina Equine 7...
Kun TJ, Wictum EJ, Penedo MCT.Degraded biological samples are a challenge for testing laboratories. Genotyping success can be improved through the use of mini-STRs, by which primers are placed adjacent to the repeat motifs to reduce amplicon size. Here, we present a genetic profiling system comprising 13 autosomal and one X-linked dinucleotide-repeat markers and the SRY gene based on the internationally accepted equine parentage panel. The markers are divided into two panels with all alleles falling at or below 182 bp. The application of this method significantly increases the ability to profile difficult samples and to p...
Molín J, Asín J, Vitoria A, Sanz A, Gimeno M, Romero A, Sánchez J, Pinczowski P, Vázquez FJ, Rodellar C, Luján L.A 1-month-old Purebred Spanish Horse (PSH) foal presented with progressive hepatic failure culminating in death. Hepatic lesions were consistent with congenital hepatic fibrosis (CHF). Genetic studies in the PKHD1 gene in the affected foal revealed that it was heterozygous for the 2 previously described single-nucleotide polymorphisms (SNPs) linked to CHF in Swiss Franches-Montagnes (SFM) horses. In addition, 2 novel mutations were detected, the foal being homozygous for one of them and heterozygous for the other. Genetic studies in a healthy PSH population ( n = 35) showed a 3-fold higher gen...
Bowling AT, Scott AM, Flint J, Clegg JB.Four minor haplotypes that produce abnormal haemoglobin phenotypes in horses have been characterized. Two of them, AIIb and V, are copy number variants with, respectively, one and three alpha genes instead of the normal complement of two. The AIIa and C haplotypes, on the other hand, each have two alpha genes but, as a result of probable gene conversions, they now encode identical, though haplotype specific, globins. Two out of 60 unrelated and phenotypically normal horses studied had an unusual triplicated rearrangement in the embryonic zeta-gene locus. Each of these variants appears to have ...
Zabek T, Golonka P, Fornal A, Semik E.Genetic polymorphism of IHH gene were investigated in Angloarabian, Polish Coldblood and Polish Halfbred horses with the inclusion of a group of Polish Halfbreds affected by osteochondrosis. IHH is a good candidate gene for association study of developmental disorders mainly affecting skeleton development. DNA sequence spanning IHH gene annotated in the horse genome and its putative promoter were investigated using SANGER sequencing. Analysis of genetic variability at polymorphic sites in the IHH gene body and the promoter region confirmed genetic differences between warmblood and coldblood ho...
Frontiers in geneticsJanuary 29, 2021
Volume 12 619947 doi: 10.3389/fgene.2021.619947
Dugué M, Dumont Saint Priest B, Crichan H, Danvy S, Ricard A.Functional longevity is essential for the well-being of horses and the satisfaction of riders. Conventional selection using longevity breeding values calculated from competition results is not efficient because it takes too long to obtain reliable information. Therefore, the objective was to identify early criteria for selection. We assessed two types of early criteria: gait traits of young horses and QTLs. Thus, our aim was to estimate the genetic correlation between gait traits and longevity and to perform a genome-wide association study (GWAS) for longevity. Measurements of gaits by acceler...
Stewart F, Allen WR, Moor RM.Rat testicular radioreceptor assays specific for FSH and LH were used to determine the FSH:LH ratio of PMSG produced by horse, donkey, mule and hinny conceptuses. Measurements of FSH and LH activities in PMSG produced both in vivo and in vitro by the four types of conceptuses showed that the genotype of the foetus markedly influences the FSH:LH ratio of PMSG. The FSH:LH ratio of PMSG produced by the horse conceptus was around unity whereas the ratio of PMSG produced by the donkey conceptus was as low as 0-2. Furthermore, the hybrid mule and hinny conceptuses both produced PMSG with an FSH:LH r...
Khrabrova LA, Blohina NV, Bazaron BZ, Khamiruev TN.The Zabaikalskaya horse is an indigenous breed of horses from Siberia with diverse use. It is characterized by endurance and good adaptability to year-round herd maintenance in the harsh conditions of the Baikal steppes. To determine the genetic characteristics of the maternal lineage of the Zabaikalskaya horse breed based on mitochondrial DNA polymorphisms, we collected hair samples from 31 horses belonging to breeding farms in the Trans-Baikal Territory. Analysis of the 530 bp sequence of the mtDNA D-loop was performed using the maximum composite likelihood (MCL) model in combination with bo...
Brard S, Ricard A.An A/C mutation responsible for the ability to pace in horses was recently discovered in the gene. It has also been proven that allele C has a negative effect on trotters' performances. However, in French trotters (FT), the frequency of allele A is only 77% due to an unexpected positive effect of allele C in late-career FT performances. Here we set out to ascertain whether the genotype at SNP (linked to ) should be used to compute EBV for FT. We used the genotypes of 630 horses, with 41,711 SNP retained. The pedigree comprised 5,699 horses. Qualification status (trotters need to complete a 2,0...
Velie BD, Smith PM, Fjordbakk CT, Solé M, Jäderkvist Fegraeus K, Rosengren MK, Røed KH, Ihler CF, Lindgren G, Strand E.Dynamic laryngeal collapse (DLC) associated with poll flexion is the most common disorder of the upper respiratory tract (URT) in the Norwegian-Swedish Coldblooded Trotter (NSCT). The disorder, which has also been diagnosed in other breeds of trotters and gaited horses, appears to be related to anatomic phenotypes and only occurs during poll flexion when the horse is exercised 'on the bit'. Objective: Identify genomic regions associated with DLC in the NSCT by combining a rigorous phenotyping protocol with genomic data from a high-density equine genotyping array. Methods: Prospective case/cont...
Morice P, Allano M, Provost C, Fairbrother JH, Gagnon CA, Sauvé F.Genomic characterization was conducted on 2 methicillin-resistant Staphylococcus aureus (MRSA) strains isolated from 2 horses hospitalized during an overlapping period of time and 2 methicillin-sensitive S. aureus (MSSA) strains isolated from 2 distinct horses. Phylogenetic proximity was traced and the genotypic and phenotypic characteristics of the antimicrobial resistance of the strains were compared. Whole genome sequencing of MRSA strains for this report was similar but differed from whole genome sequencing of MSSA strains. The MRSA strains were closely related, belonging to sequence type ...
Maniego J, Giles O, Hincks P, Stewart G, Proudman C, Ryder E.We present here the use of targeted, long-read sequencing of the myostatin (MSTN) gene as a model to detect potential gene editing events in Thoroughbred horses. MSTN is a negative regulator of muscle development, making the gene a prime candidate target for gene doping. By sequencing the complete gene in one PCR product, we can catalogue all mutations without the need to produce short-fragment libraries. A panel of reference material fragments with defined mutations was constructed and successfully sequenced by both Oxford Nanopore and Illumina-based methods, showing that gene doping editing ...