Neurological diseases in horses encompass a range of disorders affecting the central and peripheral nervous systems. These conditions can arise from various etiologies, including infectious agents, genetic predispositions, trauma, or metabolic imbalances. Common neurological diseases in horses include equine protozoal myeloencephalitis (EPM), equine herpesvirus myeloencephalopathy (EHM), and cervical vertebral stenotic myelopathy (CVSM), also known as wobbler syndrome. Clinical signs associated with these diseases may include ataxia, weakness, altered gait, and changes in behavior or mental status. Diagnosis typically involves a combination of clinical evaluation, imaging techniques, and laboratory testing. This page compiles peer-reviewed research studies and scholarly articles that investigate the pathophysiology, diagnostic approaches, and treatment options for neurological diseases in equine populations.
MacKay RJ.Brain injury after impact to the head is due to both immediate mechanical effects and delayed responses of neural tissues. In horses, traumatic brain injury occurs in three main settings: (1) poll impact in horses that flip over backwards; (2) frontal/parietal impact in horses that run into a fixed object, and (3) injury to the vestibular apparatus secondary to temporohyoid osteoarthropathy. Distinct forebrain, vestibular, midbrain, hindbrain, or multifocal syndromes may be encountered in horses with traumatic brain injury. The most important components of treatment are those consistent with p...
Foreman JH, Constable PD, Waggoner AL, Levy M, Eppley RM, Smith GW, Tumbleson ME, Haschek WM.The objective of this experiment was to characterize a dose-dependent toxic effect of fumonisin B1 (FB1) and to document initial neurologic signs, clinical progression, and terminal cerebrospinal fluid (CSF) changes in horses administered FB1 IV. Seventeen healthy horses were administered 0.00 (n = 4), 0.01 (n = 3), 0.05 (n = 3), 0.10 (n = 3), or 0.20 mg (n = 4) of purified FB1 IV q24h. When neurologic abnormalities observed by a masked observer became severe, atlanto-occipital CSF taps were performed and CSF pressure, cell count, cytology, protein, albumin and glucose concentrations, and crea...
Smith JJ, Provost PJ, Paradis MR.To determine clinical features of horses with bacterial meningitis or brain abscesses secondary to infectious disease processes involving the head. Methods: Retrospective study. Methods: 7 adult horses. Methods: Medical records of Tufts University, the University of Pennsylvania, and the Livestock Disease Diagnostic Center (Lexington, Ky) were reviewed to identify adult (> 12 months old) horses in which a postmortem diagnosis of bacterial meningitis or brain abscess had been made. Horses were included in the study if an intracranial infection was confirmed, the horse had a primary infectious d...
Witonsky S, Morrow JK, Leger C, Dascanio J, Buechner-Maxwell V, Palmer W, Kline K, Cook A.A vaccine against Sarcocystis neurona, which induces equine protozoal myeloencephalitis (EPM), has received conditional licensure in the United States. A major concern is whether the immunoglobulin G (IgG) response elicited by the vaccine will compromise the use of Western blotting (WB) as a diagnostic tool in vaccinated horses with neurologic disease. Our goals were to determine if vaccination (1) causes seroconversion: (2) causes at least a transient increase in S neurona-specific IgG in the cerebrospinal fluid (CSF); and (3) induces an IgG response that can be differentiated from that induc...
van Biervliet J, Scrivani PV, Divers TJ, Erb HN, de Lahunta A, Nixon A.Different criteria have been described based on height reduction of the total myelographic contrast column and components of it as tests for compression of the spinal cord due to cervical stenotic myelopathy (CSM). Fifty percent height reduction of the dorsal myelographic column (DMC), <2 mm empiric height of the DMC and a 40% reduction of the ratio of stenosis calculated based on the height reduction of the entire dural diameter (DD) have been described as decision criteria for considering the test result positive. The reasons for selecting these decision criteria or their accuracies have ...
Nollet H, Deprez P, van Ham L, Dewulf J, Decleir A, Vanderstraeten G.Cervical spinal cord dysfunction is a common problem in equine medicine and the currently available tests give no objective information about the functionality of the nervous tracts. Therefore, transcranial magnetic stimulation (TMS) was performed in 84 healthy horses of different height in order to have an objective measure for the integrity of the descending motor tracts in normal horses. Objective: To obtain reference values for onset latency and peak-to-peak amplitude of magnetic motor evoked potentials (MMEPs) and to evaluate the possible effect of height, age and gender on the neurophysi...
Elsinghorst TA.In this fourth article of a series of papers listing first case reports of animal diseases published since 2000, the following six cases of horse diseases are discussed: Disseminated metastatic intramedullary melanoma. Lipoma of the extensor tendon sheaths. Meningoencephalomyelitis in a neonatal foal due to Salmonella agona infection. Neuronal ceroid lipofuscinosis. Placentitis due to Rhodococcus equi infection. Right atrial diverticulum in a foal. After a short introduction, the bibliographical data, the abstract of the author(s), and some additional information derived from the article are g...
Verdegaal EJ, Kroeze EJ, Dik KJ, van Oijen LA, Sloet van Oldruitenborgh-Oosterbaan MM.A 9-year-old Dutch Warmblood mare was presented with a history of abnormal behaviour and acute facial nerve paralysis on the left side. Clinical examination revealed a slight head tilt and a corneal ulcer of the left eye. The base of the left ear was warm and painful. Endoscopic examination of the left guttural pouch showed thickening of the proximal part of the stylohyoid bone. Computer tomography revealed a left-sided prominent bony enlargement of the middle and proximal part of the stylohyoid bone and the tympanic bulla, fusion of the temporrhoid joint, and osseous proliferation of the pars...
Muirhead T, McClure JT, Bourque A, Pack L.A lesion in the cervical region of a 14-month-old Belgian gelding with severe ataxia was suspected. Necropsy revealed symmetric focal cartilage defects compatible with osteochondrosis of the occipital condyles and atlanto-occipital dysplasia. To our knowledge this is the first equine report of symmetrical osteochondrosis of the occipital condyles causing neurologic signs.
Nollet H, Van Ham L, Verschooten F, Vanderstraeten G, Deprez P.To determine the usefulness of magnetic motor-evoked potentials (MMEPs) for assessing the integrity of the cervical, thoracic, and thoracolumbar spinal cord in horses with bilateral hind limb ataxia. Methods: 9 horses and 1 donkey with bilateral hind limb ataxia of various degrees. Methods: The motor cortex was stimulated magnetically, and MMEPs were recorded bilaterally from the extensor carpi radialis and cranial tibial muscles. Results: In 5 horses and 1 donkey, MMEPs with normal onset latencies and peak-to-peak amplitude were recorded from the extensor carpi radialis muscles, whereas abnor...
Clayton HM, Bialski DE, Lanovaz JL, Mullineaux DR.To assess the reliability of the center-of-pressure (COP) values obtained from a force platform for analysis of postural sway in horses. Methods: Six 2-year-old horses that were free from lameness and neurologic disease. Methods: Horses stood stationary with all 4 hooves on a force platform; COP data were collected at 1,000 Hz and 3-dimensional kinematics collected at 60 Hz for 10 seconds. Five trials were recorded at each of 3 time periods (15-minute intervals) or at 1 time period on 3 separate days. Mean values for each set of 5 trials and actual, normalized, and relative COP variables were ...
Studdert MJ, Hartley CA, Dynon K, Sandy JR, Slocombe RF, Charles JA, Milne ME, Clarke AF, El-Hage C.Five of 10 pregnant, lactating mares, each with a foal at foot, developed neurological disease. Three of them became recumbent, developed complications and were euthanased; of the two that survived, one aborted an equine herpesvirus type 1 (EHV-1)-positive fetus 68 days after the first signs were observed in the index case and the other gave birth to a healthy foal on day 283 but remained ataxic and incontinent. The diagnosis of EHV-1 myeloencephalitis was supported by postmortem findings, PCR identification of the virus and by serological tests with an EHV-1-specific ELISA. At the time of the...
Valentine BA, de Lahunta A, Divers TJ, Ducharme NG, Orcutt RS.Two Belgian geldings, 4 and 14 years old, respectively, with muscle atrophy, weakness, and abnormal gait characteristic of severe advanced shivers were examined clinically and on necropsy. Neurologic examination revealed no evidence of ataxia, and the clinical diagnosis was neuromuscular weakness and shivers. Necropsies of both horses, including examination of pituitary, brain, spinal cord, spinal roots and ganglia, and peripheral nerves, revealed no gross or histologic abnormalities. Examination of multiple skeletal muscle specimens revealed chronic myopathic changes and periodic acid-Schiff ...
Sisó S, Ferrer I, Pumarola M.Numerous swollen neurons and multiple dystrophic axons were observed in the gracillis and cuneatus nuclei of two male Arabian horses, aged six and 12 months of age, with equine degenerative myeloencephalopathy. Swollen neurons and dystrophic axons showed synaptophysin, synaptosomal-associated protein of 25 kDa, syntaxin-1 and alpha-synuclein immunoreactivity. Moreover, dystrophic axons were strongly immunopositive against the ubiquitin protein and against the anti-phosphorylated 200 kDa neurofilament protein. Abnormal expression of integral synaptic vesicle, synaptic vesicle-associated presyna...
Nollet H, Van Ham L, Dewulf J, Vanderstraeten G, Deprez P.The influence of coil position on the peak-to-peak amplitude and onset latency of transcranial magnetic motor evoked potentials (MMEPs) in the extensor carpi radialis and cranial tibial muscles of horses was evaluated. Seven different stimulating coil positions were obtained by constructing a frame on the forehead. Two stimulation intensities (80% and 100% of maximal stimulator output) and two different coil currents (clockwise and counter-clockwise) were tested. For both recording sites MMEPs with the shortest onset latency and the largest peak-to-peak amplitude were detected when the coil wa...
Guthrie AJ, Howell PG, Gardner IA, Swanepoel RE, Nurton JP, Harper CK, Pardini A, Groenewald D, Visage CW, Hedges JF, Balasuriya UB, Cornel AJ....West Nile virus (WNV) infection is endemic in southern Africa. With the recent emergence of WNV infection of horses in Europe and the USA the present study was performed to estimate the risk of seroconversion to WNV in a cohort of 488 young Thoroughbred (TB) horses. Objective: To estimate the risk of seroconversion to WNV among a cohort of South African TB yearlings sold at the 2001 National Yearling Sales (NYS) and to determine whether the risk varied geographically. Two horses were also infected with a recent South African isolate of WNV to evaluate its virulence in horses. Methods: Serum sa...
Rossano MG, Kaneene JB, Schott HC, Sheline KD, Mansfield LS.Equine protozoal myeloencephalitis (EPM) is a neurological disease of equids that is caused by infection of the central nervous system with Sarcocystis neurona. Veterinarians diagnose EPM by performing a neurological examination and by ordering Western blot tests for antibodies to S. neurona in the blood and/or cerebrospinal fluid (CSF). The negative predictive value of the Western blot test is generally accepted to be high for both serum and CSF. If the agreement between serum and CSF test results is strong, serum tests could be used to substitute for CSF tests in some cases. The purpose of t...
Loretti AP, Colodel EM, Gimeno EJ, Driemeier D.This study reports a neurological disease unrecognised until now in ponies in southern Brazil. Objective: Epidemiological data strongly suggests that the ingestion of Sida carpinifolia is involved in the aetiology. We tested the hypothesis that it is an acquired lyosomal storage disease. Methods: Following the death of 3 ponies, all ponies from the premises were closely monitored; epidemiological data and clinical findings carefully recorded. Fragments of several organs, including CNS, were fixed in neutral formalin and embedded in paraffin-wax. Sections were stained with haematoxylin and eosi...
Katayama Y, Wada R, Kanemaru T, Sasagawa T, Uchiyama T, Matsumura T, Anzai T.Equine protozoal myeloencephalitis developed in a three-year-old male Thoroughbred racehorse imported from the United States. The animal showed astasia five days after the onset of ataxia. Histopathologically, focal nonpurulent myelitis accompanied by hemorrhage and perivascular infiltration was observed in the fourth and fifth cervical spinal cord. Immunohistochemically, shizonts were occasionally observed and were positive for anti-Sarcocystis neurona (S. neurona) antiserum. S. neurona-specific antibodies were detected in the serum and cerebrospinal fluid by Western blot. This is the first e...
Peters M, Brandt K, Wohlsein P.An intracranial epidermoid cyst was diagnosed in a Haflinger gelding aged 12 years suffering from episodes of neurological disturbance, apathy and fever. The extracerebral cyst was located in the region of the tentorium cerebelli and measured 9 x 8 x 5 cm. It displaced the cerebral hemispheres anteriorly and compressed the cerebellum and brainstem underneath. Histologically, the cyst was lined by keratinizing, stratified squamous epithelium and contained keratin scales, debris, focal haemorrhages, and degenerating inflammatory cells. The epithelium was supported by a vascularized fibrous capsu...
Weese JS, Baird JD, DeLay J, Kenney DG, Staempfli HR, Viel L, Parent J, Smith-Maxie L, Poma R.West Nile virus encephalomyelitis was diagnosed in 28 horses presented to the Ontario Veterinary College Veterinary Teaching Hospital between August 20 and October 15, 2002. The age range of affected horses was 5 months to 20 years (mean 6.9 years, median 6 years). Clinical signs were highly variable. Duration of hospitalization ranged from < 1 to 12 days (mean 5 days, median 5.4 days). Overall, 16 of the 28 (57%) horses were discharged and, of the 14 from which follow-up information was available, 13 (93%) were reported to be clinically normal 4 to 6 weeks following discharge, while the other...
Nollet H, Van Ham L, Deprez P, Vanderstraeten G.Transcranial magnetic stimulation is rapidly developing as a powerful, non-invasive tool for studying the descending motor tracts in humans. The applications of the test in animals are for the moment restricted to small animals. However, this non-invasive, sensitive and painless technique appears promising as a test of motor tract function in horses where the neurological examination is mainly restricted to clinical evaluation and some ancillary tests, such as radiography, cerebrospinal fluid analysis and electromyography. In this review, we want to discuss the history, basic principles, techn...
Ionatamishvili NI, Tsverava DM, Loriia MSh, Avaliani LA.One hundred children with cerebral palsy, aged 3-14 years, were divided into two equal groups, the first one including 50 children assigned to ride therapy and the second one--to Bobath therapeutic gymnastics. All the patients underwent a functional examination, which was rated using score system worked out by the authors, thus enabling a quantitative evaluation of treatment efficacy. In all the cases, physical rehabilitation resulted in a positive but not the same effect, with ride therapy being significantly (p < 0.001) more beneficial treatment compared to therapeutic gymnastics. Ride thera...
Solbrig MV, Koob GF.Borna Disease Virus (BDV) is a neurotropic RNA virus that is worldwide in distribution, causing movement and behavior disorders in a wide range of animal species. BDV has also been reported to be associated with neuropsychiatric diseases of humans by serologic study and by recovery of nucleic acid or virus from blood or brain. Natural infections of horses and sheep produce encephalitis with erratic excited behaviors, hyperkinetic movement or gait abnormalities; naturally infected cats have ataxic "staggering disease." Experimentally infected primates develop hyperactivity, aggression, disinhib...
Finno C, Pusterla N, Aleman M, Mohr FC, Price T, George J, Holmberg T.A 4-month-old American Paint Horse colt was evaluated because of acute onset of ataxia, left-sided head tilt, and fever and a recently noticed heart murmur. Upper respiratory tract infection caused by Streptococcus equi subsp equi had been diagnosed at 3 months of age. Results: Hematologic abnormalities included leukocytosis, mature neutrophilia, monocytosis, and mild anemia. Analysis of a CSF sample revealed high total protein concentration and total nucleated cell count; nucleated cells consisted mainly of degenerate neutrophils. Results of a real-time PCR assay were positive for S equi subs...
Thomas DR, Chalmers RM, Crook B, Stagg S, Thomas HV, Lewis G, Salmon RL, Caul EO, Morgan KL, Coleman TJ, Morgan-Capner P, Sillist M, Kench SM....Borna disease is an infectious neurological disease of horses, sheep and possibly other animals. A role for Borna disease virus (BDV) in human neurological and psychiatric illness has been proposed, but this hypothesis remains controversial. Objective: To investigate the epidemiology of BDV in UK farming communities. Methods: Retrospective cohort study. Methods: We measured the seroprevalence of BDV in the PHLS Farm Cohort, a representative sample of those employed in agriculture in the UK, and investigated the clinical significance of our findings by comparing the prevalence of symptoms of ne...
Stadler P, van den Berg SS, Tustin RC.A Hansen type I cervical intervertebral disc prolapse was diagnosed in a 16-year-old American Saddler showing clinical signs of paresis and ataxia. An ante-mortem diagnosis was made by means of plain radiographs and a myelogram. The horse was euthanased and the diagnosis confirmed on a post-mortem examination.
Williamson LH, Farrell RL.A case of intracranial schwannoma is described in a young horse. Clinical signs developed slowly and were suggestive of a lesion involving the left cerebrum. The filly exhibited a change in mentation, and circled to the left. Visual impairment and decreased facial sensation were noted on the right side. A solitary schwannoma which compressed the left cerebrum was found at necropsy.
Rivas VN, Aleman M, Peterson JA, Dahlgren AR, Hales EN, Finno CJ.Juvenile idiopathic epilepsy (JIE) is an inherited disease characterized by recurrent seizures during the first year of life in Egyptian Arabian horses. Definitive diagnosis requires an electroencephalogram (EEG) performed by a veterinary specialist. A recent study has suggested that a 19 base-pair deletion, along with a triple-C insertion, in intron five of twelve (∆19InsCCC; chr20:29542397-29542425: GTTCAGGGGACCACATGGCTCTCTATAGA>TATCTTAAGACCC) of the () gene is associated with JIE. To confirm this association, a new sample set consisting of nine EEG-phenotyped affected and nine unaffec...
Blythe LL, Kitchell RL.The cutaneous innervation of the thoracic limb was investigated in 18 barbiturate-anesthetized horses, using electrophysiologic techniques. The cutaneous area (CA) innervated by each cutaneous nerve was delineated in at least 4 horses by stroking the hairs with a small watercolor brush while recording from the nerve. Mapping of adjacent CA revealed areas of considerable overlap. The part of a CA of a given nerve supplied only by that nerve is referred to as its autonomous zone (AZ). In contrast to the standard textbook illustrations cutaneous branches of the axillary, radial, musculocutaneous,...
Inui T, Yamada K, Itoh M, Yanagawa M, Higuchi T, Watanabe A, Imamura Y, Urabe M, Sasaki N.Temporohyoid osteoarthropathy (THO) is characterized by progressive osseous proliferation of the stylohyoid and petrous temporal bones. Generally, diagnosis is confirmed by guttural pouch endoscopy and skull radiography. In the present case, computed tomography (CT) and magnetic resonance imaging (MRI) were performed in a 6-month-old Thoroughbred foal showing signs of head tilt and unilateral ear droop, consistent with the presence of a vestibular disease and unilateral facial paralysis. CT revealed bony fusion and proliferation of the right temporohyoid joint, while MRI revealed that otitis m...
Pirie RS, Mayhew IG, Clarke CJ, Tremaine WH.Intraoperative brain ultrasonography is commonly used clinically
in human and canine neonates (Johnson and Rumack 1980;
Babock and Han 1981; Cappe and Lam 1985; Hudson et al. 1990,
1991) and a single report exists of its use to assist in defining
hydrocephalus in an equine neonate (Foreman et al. 1983). This
technique has also been reported to be clinically useful in human
adults (Rubenstein et al. 1984) and ultrasound-guided brain biopsy
has also been described in mature dogs (Thomas et al. 1993).
%ours of the central nervous system in the horse are
extremely rare, with the exception...
Lohmann KL, Sieg M, Landmann M, Ganzenberg S, Arnold C, Vahlenkamp T, Ulrich RG.The presenting complaints, clinical signs, diagnostic evaluation, therapy, and outcome of 12 horses with clinically apparent West-Nile-Virus (WNV) infection are described. Methods: Case series RESULTS: The adult horses (age 6-18 years, 7 mares, 5 geldings) from Saxony and Saxony-Anhalt were presented with various clinical histories between September 2018 and September 2020. All horses were presented in August or September and no horse was vaccinated against WNV. Fever as the most common general clinical sign was present in 8/12 horses. The most common neurological signs were muscle fascicula...
Hwang H, Ro Y, Lee H, Kim J, Lee K, Choi EJ, Bae YC, So B, Kwon D, Kim H, Lee I.Since 2013, the number of requests for diagnosis for horses based on neurological symptoms has increased rapidly in South Korea. The affected horses have commonly exhibited symptoms of acute seasonal hindlimb ataxia. A previous study from 2015-2016 identified as the causative agent. Objective: This study is an epidemiological investigation to find out risk factors related to the rapid increase in hindlimb ataxia of horses due to aberrant parasites in South Korea. Methods: An epidemiological investigation was conducted on 155 cohabiting horses in 41 horse ranches where the disease occurred. Th...
Fenger CK, Granstrom DE, Langemeier JL, Stamper S.To determine the clinical findings, course of treatment, and long-term outcome of horses on a farm in central Kentucky during an epizootic of equine protozoal myeloencephalitis (EPM). Methods: Cohort study. Methods: 21 horses on a farm in central Kentucky, 12 of which developed clinical signs of EPM. Methods: Horses on the farm were serially examined for signs of neurologic disease and serum and CSF antibodies to Sarcocystis neurona. Horses were considered to have EPM if they had neurologic signs and positive test results for antibodies to S neurona in CSF. Blood values were monitored for evid...
Madigan JE, Higgins RJ.Equine protozoal myeloencephalitis (EPM) is a disease that produces neurologic signs of brain or spinal cord dysfunction. The causative organism is believed to be a Sarcocystis species of protozoa. A definitive diagnosis can only be made on histopathology of affected spinal cord or brain. No preventive measures or documented treatment is available at this time for suspected cases of EPM.
Mendizábal Alonso P.Cerebral palsy is produced by nonprogressive injury to the developing brain. This lesion produces life-long motor impairments, disturbances in perception, speech, communication, cognition and competence. Physiotherapy is an important part of treatment, and may include hippotherapy, which uses the movement of the horse to stimulate the sensorial, neuromotor and cognitive systems to obtain functional results. Methods: We performed a literature search using distinct databases and the following Keywords: "hippotherapy"; "cerebral palsy"; "children"; "treatment" and "physiotherapy". After applicati...
Björnström A, Blomström AL, Singh MC, Hesson JC.A number of viruses transmitted by mosquitoes are well known to cause disease in both humans and horses, ranging from mild fevers to mortal neurological disease. A recently discovered connection between the alphavirus Sindbis virus (SINV) and neurological disease in horses in South Africa initiated this serological study in northern Europe, where the same genotype of SINV (SINV-I) is also highly endemic. We tested 171 serum samples, originally obtained from horses for other reasons from April to October 2019, for presence of SINV neutralising antibodies using a plaque reduction neutralisation ...
Toribio RE.A number of viruses transmitted by biological vectors or through direct contact, air, or ingestion cause neurologic disease in equids. Of interest are viruses of the Togaviridae, Flaviviridae, Rhabdoviridae, Herpesviridae, Bornaviridae, and Bunyaviridae families. Many are classified as arboviruses because they use arthropod vectors, whereas others are transmitted directly via ingestion, inhalation, or integument damage. The goal of this article is to provide an overview on pathophysiologic and clinical aspects of arboviruses of equine importance, including alphaviruses (Togaviridae) and flaviv...