Veterinary care in horses encompasses the medical and preventive measures taken to maintain and improve the health and well-being of equine patients. It includes a wide range of practices such as routine health examinations, vaccinations, dental care, parasite control, and management of injuries and diseases. Veterinary care also involves diagnostic procedures, surgical interventions, and therapeutic treatments tailored to the specific needs of horses. This page gathers peer-reviewed research studies and scholarly articles that explore various aspects of equine veterinary care, including advancements in diagnostic techniques, treatment protocols, and health management strategies to support the well-being and performance of horses.
Lowden S, Gray S, Dawson K.The horse biting louse (Werneckiella equi) is a common global equine ectoparasite. To our knowledge, benzoyl(phenyl)urea insecticides (triflumuron, diflubenzuron) commonly used as sheep lousicides, have not been evaluated for efficacy against W. equi. The aim of this study was to determine louse control efficacy, general wellness and dermal safety following triflumuron application as a backline pour-on to horses. Two efficacy trials using 25 adult naturally infested lousy horses, and a dermal safety trial using 10 adult louse-free horses were conducted over a 14-month period. Lousy animals wer...
Pauwels FF, Hawkins JF, MacHarg MA, Rothenbuhler RD, Baird DK, Moulton JS.3 Horses were examined and treated because of sudden onset of signs of abdominal pain. Results: All horses had a retrosternal (Morgagni) hernia involving the right side of the diaphragm. In each horse, the large colon was incarcerated in a right muscular defect in the diaphragm with a large hernial sac. Results: Definitive surgical repair of the hernia was not performed during the initial celiotomy. The hernia was repaired with mesh herniorrhaphy, but without resection of the hernia sac in 2 horses. For 1 horse, conservative management was applied. In the 2 horses treated with surgical correct...
Westermann CM, Dorland L, Wijnberg ID, van der Kolk JH.This review gives an overview of the presently known human and equine metabolic myopathies with emphasis on the diagnostic approach. Metabolic myopathies are muscle disorders caused by a biochemical defect of the skeletal muscle energy system, which results in inefficient muscle performance. Myopathies can arise in different levels of the metabolic system. In this review the metabolic myopathies are categorized in disorders of the carbohydrate metabolism, lipid metabolism, mitochondrial myopathies (other than those described in lipid metabolism), disorders of purine metabolism, primary disorde...
Oki H, Kusunose R, Nakaoka H, Nishiura A, Miyake T, Sasaki Y.Genetic variation of the behaviour of racehorses is one of the major concerns for racehorse breeders. In this study, the heritabilities of behavioural responses to the inspections of conjunctiva, auscultation and blood sampling and the genetic correlations among them were estimated in the Thoroughbred racehorse. The estimation was done with Bayesian analysis with Gibbs sampling based on the univariate or bivariate threshold animal models. The behavioural responses were scored with four categories at the first entrance quarantine in Miho Training Center of Japan Racing Association from 1993 to ...
Rivero JL.The main goal of any conditioning programme in athletic horses is to improve performance by inducing physiological changes within the animal's body. Equine skeletal muscles have a considerable potential to adapt during training and these adaptations have important physiological implications that influence stamina, strength and speed. Although there is an extensive specialized literature in this regard, scientific based muscle conditioning methods have not been introduced sufficiently in the equine sport practice. After a brief synopsis of both equine muscle exercise physiology and muscular ada...
Mealey RH, Littke MH, Leib SR, Davis WC, McGuire TC.Although CTL are important for control of lentiviruses, including equine infectious anemia virus (EIAV), it is not known if CTL can limit lentiviral replication in the absence of CD4 help and neutralizing antibody. Adoptive transfer of EIAV-specific CTL clones into severe combined immunodeficient (SCID) foals could resolve this issue, but it is not known whether exogenous IL-2 administration is sufficient to support the engraftment and proliferation of CTL clones infused into immunodeficient horses. To address this question we adoptively transferred EIAV Rev-specific CTL clones into four EIAV-...
Feary DJ, Magdesian KG, Aleman MA, Rhodes DM.To investigate the clinical, clinicopathologic, and diagnostic characteristics; treatment; and outcome associated with acute traumatic brain injury (TBI) in horses and assess risk factors for nonsurvival in TBI-affected horses. Methods: Retrospective case series. Methods: 34 horses with TBI. Procedures-Medical records of horses that had sustained trauma to the head and developed neurologic signs were reviewed. Data that included signalment, clinicopathologic findings, diagnosis, treatment, and outcome were analyzed. Clinicopathologic variables among horses in survivor and nonsurvivor groups we...
Paltrinieri S, Giordano A, Villani M, Manfrin M, Panzani S, Veronesi MC.A field study was undertaken to investigate plasma protein electrophoresis (PPE) and serum amyloid A (SAA) concentrations at 1, 3 and 7 days of age in foals born by oxytocin-induced (group A, n =17) or spontaneous (group B, n =12) parturition. The putative diagnostic role of PPE and SAA in four septicaemic foals was also examined. At birth, beta-gamma-globulins were higher in group B, and then increased in both groups, probably due to colostrum intake. At day 3, no significant differences between the groups were detectable. In both groups, SAA values increased from day 0 to day 3, then decreas...
Penell JC, Egenvall A, Bonnett BN, Pringle J.The aim was to evaluate the agreement between computerized insurance data in a large Swedish horse insurance database and the information in the corresponding clinical records (CR). A random sample of 400 veterinary care and 140 life claims was included. Information on name of the horse, breed and gender, year of birth, specific diagnosis and system diagnosis (e.g. joints, digestive and skeletal) was compared between sources. The concordance for demographic variables was categorized as agreement, disagreement or data missing. For diagnostic information, the categories were agreement, minor dis...
Hurcombe SD, Mudge MC, Hinchcliff KW.To determine clinical and clinicopathologic abnormalities in horses administered a blood transfusion and evaluate effects of blood transfusion on these variables. Methods: Retrospective case series. Methods: 31 adult horses that received > or = 1 blood transfusion. Procedures-Medical records of horses receiving a blood transfusion were reviewed to obtain clinical findings, laboratory test results before and after transfusion, adjunctive treatments, transfusion type and volume, response to transfusion, results of donor-recipient compatibility testing, adverse reactions, and outcome. Results:...
Strand E, Braathen LC, Hellsten MC, Huse-Olsen L, Bjornsdottir S.The Icelandic horse is a pristine breed of horse which has a pure gene pool established more than a thousand years ago, and is approximately the same size as living and extinct wild breeds of horses. This study was performed to compare the length of the skeletal growth period of the "primitive" Icelandic horse relative to that reported for large horse breeds developed over the recent centuries. This information would provide practical guidance to owners and veterinarians as to when the skeleton is mature enough to commence training, and would be potentially interesting to those scientists inve...
Gandini M.To compare 3 dorsal techniques for arthrocentesis of the distal interphalangeal joint in horses with regard to ease of performing the technique and to determine the role of operator experience in ease of performing these techniques. Methods: Observational study. Sample Population-Forelimbs from 17 equine cadavers and 12 horses (16 joints) undergoing arthrocentesis for therapeutic or diagnostic purposes. Methods: In both forelimbs from 7 of the equine cadavers, 3 arthrocentesis techniques (dorsal perpendicular, dorsolateral, and dorsal inclined) were performed in random order by a single experi...
Bigley RF, Gibeling JC, Stover SM, Hazelwood SJ, Fyhrie DP, Martin RB.Materials, including bone, often fail due to loading in the presence of critical flaws. The relative amount, location, and interaction of these flaws within a stressed volume of material play a role in determining the failure properties of the structure. As materials are generally imperfect, larger volumes of material have higher probabilities of containing a flaw of critical size than do smaller volumes. Thus, larger volumes tend to fail at fewer cycles compared with smaller volumes when fatigue loaded to similar stress levels. A material is said to exhibit a volume effect if its failure prop...
Dynowski J, Wasowska-Królikowska K, Modzelewska-Hołyńska M, Tomaszewska M, Funkowicz M.Atopic dermatitis is a disease of multifactorial pathogenesis. Objective: of the study was to establish the most common allergens responsible for development of atopic symptoms in children with atopic dermatitis. Methods: the study complied 36 children aged 4 months - 3 years treated in the Department of Children Allergology, Gastroenterology and Nutrition because of atopic dermatitis. With each case the patient and family history of atopy was collected and basic laboratory tests were conducted (including total IgE and specific IgE using Polly Check system). Results: eosinophilia was found in ...
Barquero N, Gilkerson JR, Newton JR.Evidence of vaccine efficacy is essential for practitioners when giving advice to clients about the relative merits of different vaccines or when trying to evaluate the economic benefits of instituting a vaccine program. In equine veterinary medicine, this sort of data, which are necessary to make informed decisions about vaccine use and effectiveness, are often not available. Veterinarians need to consider the epidemiology of the disease in question, the type of vaccine that they are administering to the animal, the immunologic constraints of the vaccine technology, and the available evidence...
Carmalt JL.Dental problems are some of the most common reasons for a horse to be presented to an equine veterinarian. Despite the importance of anecdotal evidence as a starting point, the science of equine dentistry (especially prophylactic dentistry) has remained poorly supported by evidence-based approaches to diagnosis and treatment. In the 21st century, veterinarians have an ethical responsibility to promote and use the results of evidence-based research and not propagate statements attesting to the purported benefits of intervention without supporting research. Consider also that society is becoming...
Bedenice D.One of the fundamental skills required for practicing evidence-based medicine is the development of a well-built clinical question, which specifies the patient group or problem, intervention, and outcome of interest. For this purpose, various "levels of evidence" have been developed in the human literature, which rank the validity of evidence. Our established conclusions and advice are thus supported by specific "grades of recommendations," which are intended to give an indication of the "strength" of a clinical recommendation. This article was compiled with these principles in mind.
Messer NT, Johnson PJ.The evidence-based literature pertaining to thyroid dysfunction and Cushing's syndrome is discussed in this article. Summaries of and recommendations for the treatment of these conditions are made. There is a need for reliable diagnostic tests for these conditions in horses.
Bertone JJ.The nature of the equine industry and equine veterinary medicine often requires veterinarians to prescribe drugs with little evidence for a drug's formulation safety or efficacy, or even assurance of the chemistry of the drug used. This means that equine veterinarians must remain skeptics and understand the limitations in their ability to attribute safety and efficacy to a particular drug or treatment. An evidence-based approach to pharmacology demands rigorous testing and an unbiased analysis of results.
Caston SS, Reinertson EL.Musculoskeletal disorders comprise a large portion of the conditions treated by equine veterinarians. Surgical intervention is the treatment of choice in many cases. The body of literature describing and exploring surgical correction of musculoskeletal disorders in horses is steadily growing but still lacking. At this juncture, we can use what information we have with the understanding that as the quality of research advances, we should apply stricter standards to the evidence we use to answer our clinical questions.
Eliashar E.The first aim of this article is to review the progress made in the field of distal limb biomechanics. By understanding limb biomechanics, it is then possible to review the rationale behind a few of the more common techniques that veterinarians routinely use when treating their patients and to evaluate the evidence in support of them.
Richardson DW, Loinaz R.There is an enormous volume of published material about most of the agents used to treat or prevent arthritis in horses. Unfortunately, most of the claims made by nearly all purveyors of arthritis medications in such media are largely unsubstantiated. In addition, the quality of the available information is highly inconsistent, making evidence-based recommendations difficult. This article concentrates on injectable polysulfated glycosaminoglycan, injectable hyaluronan, and the common oral "nutraceuticals".
Nolen-Walston R, Paxson J, Ramey DW.The use of an evidence-based approach allows veterinary clinicians to assess questions that are clinically relevant to the diagnosis and treatment of equine gastrointestinal tract disease. This approach involves formulating a clinical question, searching the literature, and answering the question with the best available evidence, with the results summarized as a clinical "bottom line." This article is organized to reinforce the principle that the cornerstone of evidence-based medicine is the clinical question. Specific questions are further categorized as to topic, with epidemiologic risk fact...
Brinsko SP.Many procedures performed as part of routine broodmare practice are based on sound clinical judgment and experience or scientific evidence; however, others are based on perceived problems and needs to address them. This article presents four procedures commonly used in broodmare practice, for which there is questionable evidence to substantiate their use.
Ayala I, Rodríguez MJ, Martos N, Zilberschtein J, Ruíz I, Motas M.Fatal brodifacoum poisoning in a pony is described; this condition has not previously been reported in ponies. Discussion of what factors in the pony's history and treatment may have predisposed to the severity and ultimate death is provided. Cet article décrit un empoisonnement mortel au brodifacoum chez un poney, condition jamais rapportée auparavant. La discussion porte sur les liens entre les divers éléments de l’anamnèse et les traitements reçus par rapport à la sévérité de la condition et ultimement à la mort de l’animal. (Traduit par Docteur André Blouin)
Uhlinger CA.This article focuses on what has been established concerning the interaction of equine parasites and their hosts, highlighting those issues for which convincing data are still lacking. There is a compelling need for the participation of the veterinarian in the design of appropriate anthelmintic treatments and prevention strategies.
Soma LR, Beech J, Gerber NH.The effect of disodium cromoglycate (cromolyn) in preventing the pulmonary dysfunction caused by the inhalation of barn and hay dust was studied in 5 horses with confirmed chronic obstructive pulmonary disease (COPD). The horses were studied before (Con) and after exposure to hay and dust allergens (Expos) and after pretreatment with cromolyn followed by exposure (Cr-Expos). There was a significant reduction in PaO2 from 86.8 +/- 8.3 to 73.1 +/- 8.8 when the horses were exposed to hay and dust allergens. The PaO2 after pretreatment with cromolyn and exposures was 78.1 +/- 5.5. There were no si...
Wenker C, Hoby S, Steck BL, Ramsauer AS, Blatter S, Tobler K.Equine sarcoids (ES) were diagnosed in 12 Somali wild asses (SWA) () from 10 different institutions of the SWA European Endangered Species Programme from 1976 to 2019. Samples of surgically excised masses, biopsies, or necropsy samples were submitted for histologic and virologic analysis. In addition, tissue samples from one onager (), one kulan (), and two Hartmann's mountain zebras (HMZ) () were examined. Histology confirmed the diagnosis of ES exhibiting the typical microscopic features. Polymerase chain reaction detected bovine papillomavirus type 1 (BPV1) DNA in eight SWA samples and bovi...
Caporale VP, Biancifiori F, Frescura F, Di Matteo A, Nannini D, Urbani G.Comparative tests such as FAT, ELISA, RIA, IEO and CF in the diagnosis of dourine in the horse have proved a satisfactory concordance ratio of the ELISA with CF, which seems to be the most reliable test. Discrepancies have been observed as to the other tests which appear less sensitive than CF test.
Williamson LH, Farrell RL.A case of intracranial schwannoma is described in a young horse. Clinical signs developed slowly and were suggestive of a lesion involving the left cerebrum. The filly exhibited a change in mentation, and circled to the left. Visual impairment and decreased facial sensation were noted on the right side. A solitary schwannoma which compressed the left cerebrum was found at necropsy.
Rivas VN, Aleman M, Peterson JA, Dahlgren AR, Hales EN, Finno CJ.Juvenile idiopathic epilepsy (JIE) is an inherited disease characterized by recurrent seizures during the first year of life in Egyptian Arabian horses. Definitive diagnosis requires an electroencephalogram (EEG) performed by a veterinary specialist. A recent study has suggested that a 19 base-pair deletion, along with a triple-C insertion, in intron five of twelve (∆19InsCCC; chr20:29542397-29542425: GTTCAGGGGACCACATGGCTCTCTATAGA>TATCTTAAGACCC) of the () gene is associated with JIE. To confirm this association, a new sample set consisting of nine EEG-phenotyped affected and nine unaffec...
Sutton DG, Bahr A, Preston T, Cohen ND, Love S, Roussel AJ.The 13C-octanoic acid breath test has been correlated significantly to radioscintigraphy for measurement of gastric emptying indices in healthy horses. The objective of this study was to investigate the validity of the test for measurement of equine delayed gastric emptying, prior to its potential clinical application for this purpose. A model of atropine-induced gastroparesis was used. Gastric emptying rate was measured twice in 8 horses using concurrent radioscintigraphy and/or breath test after treatment i.v. with either atropine (0.035 mg/kg bwt) or saline in randomised order. Analysis of ...
Turner AS, Yovich JV, White NA, Embertson RE, Santschi EM, Slone DE.A retrospective study was performed to evaluate the healing of ventral midline abdominal incisions, closed with a simple continuous suture pattern using absorbable suture material, in 139 horses and foals. Dehiscence and incisional hernia developed separately in two horses. The low incidence of dehiscence and incisional hernia, compared with their reported incidence following the use of interrupted suture repair, leads the authors to recommend this alternative method of abdominal incision closure in horses. The security of closure is not sacrificed and the advantages of a rapid closure are des...
Beard WL, Robertson JT, Leeth B.Congenital frontal sinus cysts were found bilaterally in the frontal sinuses of a one-year-old miniature horse. Diagnosis was based on radiography of the head and cytologic examination of tissue aspirated from the frontal sinuses. The cysts were surgically removed, using a hinged bone flap technique bilaterally over the frontal sinuses.
Patil DB, Adamiak Z, Piórek A.The present review informs about the current status regarding use of interlocking nailing for fracture repair in animals. The clinical limitations of interlocking nailing and its subsequent improvement by evolving novel nail design or supplementation with type I ESF using hybrid nail bolt/ESF pin has been dealt. The biomechanical and clinical evaluation of novel interlocking nail supplements and its possible clinical use is included.
Hinton M.The literature published over the last 150 years provides confusing and often conflicting advice on the ideal way to water horses. Many of the problems associated with watering appear to be caused by either mismanagement or ignorance. An obvious way to prevent trouble is to provide adequate water at all times when a horse is at rest and to allow sufficient opportunity to drink while working.
Riley CB, McCallum S, MacDonald JA, Hill KE.To determine the period prevalence of needlestick injury (NSI) at the Massey University Veterinary Teaching Hospital (VTH) and to identify handling and disposal practices that may contribute to the risk of NSI. Methods: Observations of personnel were conducted in the equine (EVH) and companion animal (CAH) clinics of the VTH during scheduled clinical activities over 9- and 10-day periods, respectively. The number and type of NSI incidents, needle uncapping, capping and disposal events were recorded for veterinarians, nurses and other personnel (visitors and students). The number of needle-rela...
Fjordbakk CT, Kenney DG, Rodriguez-Palacios A, Keller S, Stalker M.An inflammatory aural polyp was identified in a 1-year-old standardbred filly, which presented with otorrhea and head rubbing. The polyp was removed by traction-avulsion, and the filly showed no subsequent signs of otorrhea. Aural polyps have not been reported in horses, but they are commonly seen in companion animals and humans. Un polype auditif inflammatoire a été identifié chez une pouliche Standardbred d’un an présentée pour otorrhée et frottage de tête. Le polype a été retiré par traction-avulsion et la pouliche n’a pas manifesté de signes subséquents d’otorrhée. Les ...
Düsterdieck-Zellmer KF.Systemic administration of tiludronate or clodronate decreases lameness in some horses suffering from navicular syndrome within 2-6 months of treatment. In horses that fail to respond to the first treatment, a follow-up treatment may still improve the lameness. Horses with a lameness duration of less than 6 months have better odds of experiencing improvement in lameness. Bisphosphonate (BP) treatment can result in renal damage, and it is recommended to assess renal function prior to and after treatment. Horses with pre-existing renal compromise should not be treated with BP, as this may promot...