Analyze Diet

Topic:Veterinary Research

Veterinary research in horses encompasses the study of diseases, health management, and medical treatments specific to equine species. This field investigates various aspects of horse health, including infectious diseases, metabolic disorders, and musculoskeletal conditions. Researchers focus on understanding the pathophysiology of equine ailments, developing diagnostic tools, and evaluating therapeutic interventions. The study of horse health also involves examining preventive measures such as vaccination protocols and nutritional management to promote overall well-being. This page collects peer-reviewed research studies and scholarly articles that explore the diverse areas of veterinary science related to horses, providing insights into disease mechanisms, treatment strategies, and advancements in equine healthcare.
Transendoscopic correction of epiglottic entrapment with a silicone-covered laser guide and diode laser in 29 horses.
Veterinary surgery : VS    October 21, 2019   Volume 49, Issue 1 131-137 doi: 10.1111/vsu.13338
Beste KJ, Ortved KF, Rossignol F, Ducharme NG.To describe the use of a silicone-covered laser guide and diode laser for surgical correction of epiglottic entrapment and report postoperative outcomes in horses with epiglottic entrapment. Methods: Retrospective case series. Methods: Thoroughbred and standardbred racehorses (n = 29) with epiglottic entrapment. Methods: A silicone-covered laser guide was placed endoscopically to direct the diode laser cutting action during transection of the entrapping subepiglottic membrane and to act as a physical barrier between the membrane and the epiglottic cartilage. Postoperative complications and tra...
Possible dysmetabolic hyperferritinemia in hyperinsulinemic horses.
Open veterinary journal    October 21, 2019   Volume 9, Issue 4 287-293 doi: 10.4314/ovj.v9i4.2
Kellon EM, Gustafson KM.Hyperinsulinemia associated with equine metabolic syndrome and pituitary pars intermedia dysfunction is a risk factor for laminitis. Research in other species has shown elevated body iron levels as both a predictor and consequence of insulin resistance. In humans, this is known as dysmetabolic hyperferritinemia. To explore the relationship between equine hyperinsulinemia and body iron levels. We reviewed case histories and laboratory results from an open access database maintained by the Equine Cushing's and Insulin Resistance Group Inc. (ECIR). We identified 33 horses with confirmed hyperinsu...
Longitudinal study of electrical, functional and structural remodelling in an equine model of atrial fibrillation.
BMC cardiovascular disorders    October 21, 2019   Volume 19, Issue 1 228 doi: 10.1186/s12872-019-1210-4
Hesselkilde EZ, Carstensen H, Flethøj M, Fenner M, Kruse DD, Sattler SM, Tfelt-Hansen J, Pehrson S, Braunstein TH, Carlson J, Platonov PG....Large animal models are important in atrial fibrillation (AF) research, as they can be used to study the pathophysiology of AF and new therapeutic approaches. Unlike other animal models, horses spontaneously develop AF and could therefore serve as a bona fide model in AF research. We therefore aimed to study the electrical, functional and structural remodelling caused by chronic AF in a horse model. Nine female horses were included in the study, with six horses tachypaced into self-sustained AF and three that served as a time-matched sham-operated control group. Acceleration in atrial fibrilla...
Species-specific and collection method-dependent differences in endometrial susceptibility to seminal plasma-induced RNA degradation.
Scientific reports    October 21, 2019   Volume 9, Issue 1 15072 doi: 10.1038/s41598-019-51413-4
Fernandez-Fuertes B, Sánchez JM, Bagés-Arnal S, McDonald M, Yeste M, Lonergan P.This study aimed to determine the effect of bull seminal plasma (SP) and sperm on endometrial function. Bovine endometrial explants were incubated with: ejaculated sperm with or without SP, epididymal sperm, or SP alone. Neither ejaculated nor epididymal sperm induced differential expression of IL1A, IL1B, IL6, IL8, PTGES2, TNFA, and LIF. Interestingly, SP had a detrimental effect on endometrial RNA integrity. Addition of an RNase inactivation reagent to SP blocked this effect, evidencing a role for a SP-RNase. Because bulls deposit the ejaculate in the vagina, we hypothesized that the bovine ...
Seroprevalence of Toxoplasma gondii in horses: A global systematic review and meta-analysis.
Acta tropica    October 19, 2019   Volume 201 105222 doi: 10.1016/j.actatropica.2019.105222
Li X, Ni HB, Ren WX, Jiang J, Gong QL, Zhang XX.Toxoplasmosis, one of the most common zoonoses worldwide, is caused by Toxoplasma gondii. T. gondii can infect almost all warm-blooded animals, including humans. Horses are an intermediate host of T. gondii, representing a potential risk for humans. To determine the T. gondii seroprevalence in horses worldwide, a global meta-analysis was conducted. A total of 35 publications were obtained by searching the PubMed, ScienceDirect, Chinese Web of knowledge (CNKI) and Wanfang databases. A total of 12,354 horses were assessed, of which 1580 were positive for T. gondii. The pooled overall seroprevale...
Relationship between DNA fragmentation of equine granulosa cells and oocyte meiotic competence after in vitro maturation.
Reproduction in domestic animals = Zuchthygiene    October 19, 2019   Volume 54 Suppl 4 78-81 doi: 10.1111/rda.13514
Pereira B, Dorado J, Diaz-Jimenez M, Consuegra C, Ortiz I, Gosalvez J, Hidalgo M.The acquisition of equine oocyte developmental capacity is ensured by the follicular environment, such as granulosa cells, which could reflect the meiotic development potential of immature oocytes. This study evaluated the relationship between DNA fragmentation of granulosa cells, using the chromatin dispersion test, and equine oocyte meiotic development after in vitro maturation. Granulosa cells and cumulus-oocytes complexes (n = 50) were recovered from slaughterhouse-derived ovaries. Oocytes were in vitro matured, stained and evaluated under fluorescence microscopy. Maturation rates were c...
Alternatives in Donkey semen cryopreservation: Mare vs. Jenny Colostrum.
Reproduction in domestic animals = Zuchthygiene    October 19, 2019   Volume 54 Suppl 4 94-97 doi: 10.1111/rda.13516
Álvarez C, González N, Luño V, Martínez F, Gil L.The aim of this study was to test and compare two new components in extenders for freezing donkey semen: mare colostrum and jenny colostrum. Colostrum was obtained from four mares and four jennies right after the foal's birth. Ejaculates were collected from five fertile donkeys. Sperm samples were pooled, diluted and cryopreserved in three different experimental extender groups: lactose supplemented with egg yolk extender (20%) as the control group, lactose supplemented with jenny colostrum extender (20%), and lactose supplemented with mare colostrum extender (20%). After thawing, we evaluated...
Frameshift Variant in MFSD12 Explains the Mushroom Coat Color Dilution in Shetland Ponies.
Genes    October 19, 2019   Volume 10, Issue 10 826 doi: 10.3390/genes10100826
Tanaka J, Leeb T, Rushton J, Famula TR, Mack M, Jagannathan V, Flury C, Bachmann I, Eberth J, McDonnell SM, Penedo MCT, Bellone RR.Mushroom is a unique coat color phenotype in Shetland Ponies characterized by the dilution of the chestnut coat color to a sepia tone and is hypothesized to be a recessive trait. A genome wide association study (GWAS), utilizing the Affymetrix 670K array (MNEc670k) and a single locus mixed linear model analysis (EMMAX), identified a locus on ECA7 for further investigation ( = 2.08 × 10). This locus contained a 3 Mb run of homozygosity in the 12 mushroom ponies tested. Analysis of high throughput Illumina sequencing data from one mushroom Shetland pony compared to 87 genomes from horses of var...
Influence of Obesity on Serum Concentrations of Acute-Phase Proteins in Horses.
Journal of equine veterinary science    October 18, 2019   Volume 83 102810 doi: 10.1016/j.jevs.2019.102810
Girardi FM, da Fonseca LA, Ribeiro Filho JD, Souto PC, Ferreira DAC, Dornelas LRSM, Bento LD, de Carvalho Filho WP.Obesity in human and veterinary medicine is one of the most complex challenges within emerging diseases in the context of health. The problem of obesity in horses results in severe comorbidities; therefore, acute-phase proteins should be investigated for fluctuations increasing or decreasing by at least 25% in response to inflammation; these are candidates for future biomarkers and might provide new perspectives on early diagnosis and prognosis. Serum samples were analyzed in nine healthy animals (C) and nine obese animals (O). The proteins were separated by sodium dodecyl sulfate-polyacrylami...
Non-Coding RNA Sequencing of Equine Endometrium During Maternal Recognition of Pregnancy.
Genes    October 18, 2019   Volume 10, Issue 10 821 doi: 10.3390/genes10100821
Klohonatz KM, Coleman SJ, Cameron AD, Hess AM, Reed KJ, Canovas A, Medrano JF, Islas-Trejo AD, Kalbfleisch T, Bouma GJ, Bruemmer JE.Maternal recognition of pregnancy (MRP) in the mare is not well defined. In a non-pregnant mare, prostaglandin F (PGF) is released on day 14 post-ovulation (PO) to cause luteal regression, resulting in loss of progesterone production. Equine MRP occurs prior to day 14 to halt PGF production. Studies have failed to identify a gene candidate for MRP, so attention has turned to small, non-coding RNAs. The objective of this study was to evaluate small RNA (<200 nucleotides) content in endometrium during MRP. Mares were used in a cross-over design with each having a pregnant and non-mated cycle. Ea...
Characterization of Equine Parvovirus in Thoroughbred Breeding Horses from Germany.
Viruses    October 18, 2019   Volume 11, Issue 10 doi: 10.3390/v11100965
Meister TL, Tegtmeyer B, Brüggemann Y, Sieme H, Feige K, Todt D, Stang A, Cavalleri JV, Steinmann E.An equine parvovirus-hepatitis (EqPV-H) has been recently identified in association with equine serum hepatitis, also known as Theiler's disease. The disease was first described by Arnold Theiler in 1918 and is often observed with parenteral use of blood products in equines. However, natural ways of viral circulation and potential risk factors for transmission still remain unknown. In this study, we investigated the occurrence of EqPV-H infections in Thoroughbred horses in northern and western Germany and aimed to identify potential risk factors associated with viral infections. A total of 392...
Piroplasmosis in Italian Standardbred Horses: 15 Years of Surveillance Data.
Journal of equine veterinary science    October 18, 2019   Volume 83 102813 doi: 10.1016/j.jevs.2019.102813
Padalino B, Rosanowski SM, Di Bella C, Lacinio R, Rubino GTR.This study aimed to document the prevalence of chronic equine piroplasmosis (EP) in poorly performing Standardbred racehorses and to explore associations between the disease and sex, age, and hematological parameters. Blood was collected between 2004 and 2018; blood cell counts were performed using a cell counter analyzer, biochemical parameters using a photometer, and serum proteins using agarose gel electrophoresis. Blood smears were prepared, colored with a modified Giemsa, and an experienced technician identified the presence of protozoa. The horses were categorized into piroplasmosis posi...
Characterization of abortion, stillbirth and non-viable foals homozygous for the Warmblood Fragile Foal Syndrome.
Animal reproduction science    October 17, 2019   Volume 211 106202 doi: 10.1016/j.anireprosci.2019.106202
Aurich C, Müller-Herbst S, Reineking W, Müller E, Wohlsein P, Gunreben B, Aurich J.Warmblood fragile foal syndrome (WFFS) is a monogenetic defect with autosomal recessive inheritance. The WFFS homozygosity is non-compatible with extra-uterine life. Although as many as 15% of Warmblood horses are WFFS carriers, there has been little veterinary focus on this condition. The aim of this study was to determine outcomes and symptoms of clinical signs and pathological abnormalities during pregnancies when there were WFFS homozygous foetuses. Diagnostic material of 15 abortion or stillbirth cases with suspected diagnosis of WFFS was available for this study. Additionally, there were...
TRIM39-RPP21 Variants (∆19InsCCC) Are Not Associated with Juvenile Idiopathic Epilepsy in Egyptian Arabian Horses.
Genes    October 16, 2019   Volume 10, Issue 10 816 doi: 10.3390/genes10100816
Rivas VN, Aleman M, Peterson JA, Dahlgren AR, Hales EN, Finno CJ.Juvenile idiopathic epilepsy (JIE) is an inherited disease characterized by recurrent seizures during the first year of life in Egyptian Arabian horses. Definitive diagnosis requires an electroencephalogram (EEG) performed by a veterinary specialist. A recent study has suggested that a 19 base-pair deletion, along with a triple-C insertion, in intron five of twelve (∆19InsCCC; chr20:29542397-29542425: GTTCAGGGGACCACATGGCTCTCTATAGA>TATCTTAAGACCC) of the () gene is associated with JIE. To confirm this association, a new sample set consisting of nine EEG-phenotyped affected and nine unaffec...
Ultrasonographic assessment of normal jugular veins in Standardbred horses.
BMC veterinary research    October 16, 2019   Volume 15, Issue 1 343 doi: 10.1186/s12917-019-2104-5
Pasolini MP, Spinella G, Del Prete C, Valentini S, Coluccia P, Auletta L, Greco M, Meomartino L.Ultrasonography (US) is the recommended imaging technique to evaluate jugular veins. This prospective randomized clinical study was designed to collect a series of B-mode US measurements of manually distended jugular veins in healthy Italian Standardbreds and to find possible correlations between ultrasound measurements and animal morphometric characteristics. Forty-two horses, eight males and 34 females (range 3-22 years; bodyweight 494.4 ± 41.7 kg), were included in the study. The diameters and wall thicknesses of both jugular veins were measured at three different sites of the neck...
Immunoreactive insulin stability in horses at risk of insulin dysregulation.
Journal of veterinary internal medicine    October 16, 2019   Volume 33, Issue 6 2746-2751 doi: 10.1111/jvim.15629
Leschke DH, Muir GS, Hodgson JK, Coyle M, Horn R, Bertin FR.Diseases associated with insulin dysregulation (ID), such as equine metabolic syndrome and pituitary pars intermedia dysfunction, are of interest to practitioners because of their association with laminitis. Accurate insulin concentration assessment is critical in diagnosing and managing these diseases. Objective: To determine the effect of time, temperature, and collection tube type on insulin concentrations in horses at risk of ID. Methods: Eight adult horses with body condition score >6/9. Methods: In this prospective study, subjects underwent an infeed oral glucose test 2 hours before...
Vaccination of foals with a modified live, equid herpesvirus-1 gM deletion mutant (RacHΔgM) confers partial protection against infection.
Vaccine    October 16, 2019   Volume 38, Issue 2 388-398 doi: 10.1016/j.vaccine.2019.09.106
Kydd JH, Hannant D, Robinson RS, Bryant N, Osterrieder N.Equid herpesvirus-1 (EHV-1) causes respiratory and neurological disease and late gestation abortion in pregnant mares. Current vaccines contain either inactivated or live EHV-1, but fail to provide complete clinical or virological protection, namely prevention of nasopharyngeal shedding and cell-associated viraemia. Thus, the development of novel products, such as modified live virus (MLV) vaccines which stimulate virus-specific, humoral and cell mediated immune responses more effectively remains a priority. Two groups of weaned foals (n = 6 each group) were used in a longitudinal, prospec...
The effect of different grazing conditions on the insulin and incretin response to the oral glucose test in ponies.
BMC veterinary research    October 16, 2019   Volume 15, Issue 1 345 doi: 10.1186/s12917-019-2088-1
Fitzgerald DM, Pollitt CC, Walsh DM, Sillence MN, de Laat MA.The oral glucose test (OGT) is a useful tool for diagnosing insulin dysregulation (ID) and is somewhat repeatable in ponies under consistent management. This study aimed to determine whether the insulin and incretin responses to an OGT in ponies differed after short-term access to fertilised pasture, compared to unfertilised pasture, by using a randomised, repeated measures study design. Sixteen mixed-breed ponies were classified as severely insulin-dysregulated (SD; post-prandial insulin ≥80 μIU/mL) or not severely insulin-dysregulated (NSD; post-prandial insulin < 80 μIU/mL) using an O...
Inflammatory mediators are potential biomarkers for extracorporeal shockwave therapy in horses.
Equine veterinary journal    October 16, 2019   Volume 52, Issue 3 449-454 doi: 10.1111/evj.13183
Chen JW, Stefanovski D, Haughan J, Jiang Z, Boston R, Soma LR, Robinson MA.Extracorporeal shockwave therapy (ESWT) can potentially mask painful injuries in equine athletes. Tests to detect whether a horse has received ESWT prior to competition are needed. Extracorporeal shockwave therapy is known to affect inflammatory mediators in other species, and if these mediators are altered in the horse, these could serve as biomarkers of ESWT. Objective: To test the hypothesis that a single application of ESWT will alter the circulating protein concentrations of 10 inflammatory mediators in horse plasma. Methods: Prospective repeated measures experimental study. Methods: Elev...
Dimethyl sulfoxide maintains structure and function of cryopreserved equine endometrial explants.
Cryobiology    October 15, 2019   Volume 91 90-96 doi: 10.1016/j.cryobiol.2019.10.006
Thompson RE, Johnson AK, Prado TM, Premanandan C, Brown ME, Whitlock BK, Pukazhenthi BS.Availability of viable frozen-thawed endometrial tissues could facilitate detailed studies into physiologic and disease processes influencing the endometrium. This study was designed to investigate the cryosurvival of equine endometrial tissue. Previous studies in the human and horse have focused on cryopreservation of dissociated endometrial cells. To our knowledge, there are no studies on cryopreservation of endometrial explants. Our objectives were to 1) determine the influence of differing concentrations of the permeating cryoprotectant dimethyl sulfoxide (MeSO) on viability, structural in...
Clonal Confinement of a Highly Mobile Resistance Element Driven by Combination Therapy in Rhodococcus equi.
mBio    October 15, 2019   Volume 10, Issue 5 e02260-19 doi: 10.1128/mBio.02260-19
Álvarez-Narváez S, Giguère S, Anastasi E, Hearn J, Scortti M, Vázquez-Boland JA.Antibiotic use has been linked to changes in the population structure of human pathogens and the clonal expansion of multidrug-resistant (MDR) strains among healthcare- and community-acquired infections. Here we present a compelling example in a veterinary pathogen, , the causative agent of a severe pulmonary infection affecting foals worldwide. We show that the (46) gene responsible for emerging macrolide resistance among equine isolates in the United States is part of a 6.9-kb transposable element, Tn, actively mobilized by an IS family transposase. Tn is carried on an 87-kb conjugative pla...
Leishmania spp. and leishmaniasis on the Caribbean islands.
Transactions of the Royal Society of Tropical Medicine and Hygiene    October 15, 2019   Volume 114, Issue 2 73-78 doi: 10.1093/trstmh/trz076
Yao C.The kinetoplastid protozoan Leishmania spp. cause leishmaniasis, which clinically exhibit mainly as a cutaneous, mucocutanous or visceral form depending upon the parasite species in humans. The disease is widespread geographically, leading to 20 000 annual deaths. Here, leishmaniases in both humans and animals, reservoirs and sand fly vectors on the Caribbean islands are reviewed. Autochthonous human infections by Leishmania spp. were found in the Dominican Republic, Guadeloupe and Martinique as well as Trinidad and Tobago; canine infections were found in St. Kitts and Grenada; and equine infe...
The First Detection of Equine Coronavirus in Adult Horses and Foals in Ireland.
Viruses    October 14, 2019   Volume 11, Issue 10 946 doi: 10.3390/v11100946
Nemoto M, Schofield W, Cullinane A.The objective of this study was to investigate the presence of equine coronavirus (ECoV) in clinical samples submitted to a diagnostic laboratory in Ireland. A total of 424 clinical samples were examined from equids with enteric disease in 24 Irish counties between 2011 and 2015. A real-time reverse transcription polymerase chain reaction was used to detect ECoV RNA. Nucleocapsid, spike and the region from the p4.7 to p12.7 genes of positive samples were sequenced, and sequence and phylogenetic analyses were conducted. Five samples (1.2%) collected in 2011 and 2013 tested positive for ECoV. Po...
A candidate-SNP retrospective cohort study for fracture risk in Japanese Thoroughbred racehorses.
Animal genetics    October 14, 2019   Volume 51, Issue 1 43-50 doi: 10.1111/age.12866
Tozaki T, Kusano K, Ishikawa Y, Kushiro A, Nomura M, Kikuchi M, Kakoi H, Hirota K, Miyake T, Hill EW, Nagata S.Fractures are medical conditions that compromise the athletic potential of horses and/or the safety of jockeys. Therefore, the reduction of fracture risk is an important horse and human welfare issue. The present study used molecular genetic approaches to determine the effect of genetic risk for fracture at four candidate SNPs spanning the myostatin (MSTN) gene on horse chromosome 18. Among the 3706 Japanese Thoroughbred racehorses, 1089 (29.4%) had experienced fractures in their athletic life, indicating the common occurrence of this injury in Thoroughbreds. In the case/control association st...
Thermal, mechanical and electrical stimuli in antinociceptive studies in standing horses: an update.
Veterinary anaesthesia and analgesia    October 13, 2019   Volume 47, Issue 1 15-27 doi: 10.1016/j.vaa.2019.09.003
Gozalo-Marcilla M, Luna SPL, Gasthuys F, Schauvliege S.To perform a literature review of the thermal and mechanical antinociceptive devices used in pharmacological studies in standing horses published after 2011 (2012-2019). To complete a full literature review about electrical stimulation used for evaluation in similar studies. Methods: PubMed, Google Scholar and Web of Science. Conclusions: A high level of standardization has been reached in antinociceptive studies in standing horses using thermal and mechanical stimuli in most recent years. Commercially available testing devices to deliver thermal, mechanical and electrical stimuli, with observ...
A Bivalent Live-Attenuated Vaccine for the Prevention of Equine Influenza Virus.
Viruses    October 11, 2019   Volume 11, Issue 10 933 doi: 10.3390/v11100933
Blanco-Lobo P, Rodriguez L, Reedy S, Oladunni FS, Nogales A, Murcia PR, Chambers TM, Martinez-Sobrido L.Vaccination remains the most effective approach for preventing and controlling equine influenza virus (EIV) in horses. However, the ongoing evolution of EIV has increased the genetic and antigenic differences between currently available vaccines and circulating strains, resulting in suboptimal vaccine efficacy. As recommended by the World Organization for Animal Health (OIE), the inclusion of representative strains from clade 1 and clade 2 Florida sublineages of EIV in vaccines may maximize the protection against presently circulating viral strains. In this study, we used reverse genetics tech...
Sacrococcygeal luxation and complete tail amputation following a tail pull injury in a horse.
The Canadian veterinary journal = La revue veterinaire canadienne    October 11, 2019   Volume 60, Issue 10 1094-1098 
Riddell LP, Yoshimura S, MacKay AV, Wilson DG.A 17-year-old Quarter horse mare was presented because of traumatic luxation of the fifth sacral and first coccygeal vertebrae resulting in loss of sensation, motor function, and perfusion of the tail. The case was complicated by an associated tail head hematoma. Due to the severity of the injury, tail amputation was performed at the level of the luxation. Tail amputations in horses at the sacrococcygeal junction following a suspected tail pull injury are infrequently reported in the literature. . Une jument Quarter horse âgée de 17 ans fut présentée pour cause de luxation traumatique de l...
Intrabladder pressure as predictor of intra-abdominal pressure in horses.
PloS one    October 10, 2019   Volume 14, Issue 10 e0223705 doi: 10.1371/journal.pone.0223705
de Paula VB, Canola PA, Rivera GG, Z Filho D, Amaral GPD, Ferraz GC, Ferraudo AS, Canola JC.To investigate effects of postural changes and bladder distention on intrabladder pressure whilst estimating intra-abdominal pressure in horses. Two-year cohort study. Patients admitted for elective surgical procedures unrelated to gastrointestinal or genitourinary tract. School of Agricultural and Veterinarian Sciences, Jaboticabal, SP, Brazil. 20 adult horses, 11 males (stallions and geldings) and 9 females; between 3.5 and 12 years, weighing 350 to 500 kg. Intra-abdominal pressure was directly-recorded through abdominocentesis at the ventral midline with a fluid-filled system. Intrabladder ...
Equine uveitis in the UK: a retrospective study (2008-2018).
The Veterinary record    October 9, 2019   Volume 186, Issue 3 92 doi: 10.1136/vr.105423
Malalana F, Ireland JL, Pinchbeck G, McGowan CM.Uveitis appears to be less prevalent in the UK compared with other parts of the world and studies characterising the disease in the UK are lacking. The objectives of this retrospective study were to describe acute and recurrent cases presenting for management of uveitis in a referral hospital on the North West of England and compare the signalment of horses presenting with uveitis with the equine hospital population during the same period. Methods: Medical records of horses presented to the referral Equine Hospital, University of Liverpool with signs of uveitis between 2008 and 2018 were revie...
Assessing pathological changes within the nucleus ambiguus of horses with recurrent laryngeal neuropathy: An extreme, length-dependent axonopathy.
Muscle & nerve    October 9, 2019   Volume 60, Issue 6 762-768 doi: 10.1002/mus.26699
Draper ACE, Cahalan SD, Goodwin D, Perkins J, Piercy RJ.Equine recurrent laryngeal neuropathy (RLN) is a naturally occurring model of length-dependent axonopathy characterized by asymmetrical degeneration of recurrent laryngeal nerve axons (RLn). Distal RLn degeneration is marked, but it is unclear whether degeneration extends to include cell bodies (consistent with a neuronopathy). With examiners blinded to RLN severity, brainstem location, and side, we examined correlations between RLN severity (assessed using left distal RLn myelinated axon count) and histopathological features (including chromatolysis and glial responses) in the nucleus ambiguu...