Veterinary research in horses encompasses the study of diseases, health management, and medical treatments specific to equine species. This field investigates various aspects of horse health, including infectious diseases, metabolic disorders, and musculoskeletal conditions. Researchers focus on understanding the pathophysiology of equine ailments, developing diagnostic tools, and evaluating therapeutic interventions. The study of horse health also involves examining preventive measures such as vaccination protocols and nutritional management to promote overall well-being. This page collects peer-reviewed research studies and scholarly articles that explore the diverse areas of veterinary science related to horses, providing insights into disease mechanisms, treatment strategies, and advancements in equine healthcare.
Li X, Ni HB, Ren WX, Jiang J, Gong QL, Zhang XX.Toxoplasmosis, one of the most common zoonoses worldwide, is caused by Toxoplasma gondii. T. gondii can infect almost all warm-blooded animals, including humans. Horses are an intermediate host of T. gondii, representing a potential risk for humans. To determine the T. gondii seroprevalence in horses worldwide, a global meta-analysis was conducted. A total of 35 publications were obtained by searching the PubMed, ScienceDirect, Chinese Web of knowledge (CNKI) and Wanfang databases. A total of 12,354 horses were assessed, of which 1580 were positive for T. gondii. The pooled overall seroprevale...
Pereira B, Dorado J, Diaz-Jimenez M, Consuegra C, Ortiz I, Gosalvez J, Hidalgo M.The acquisition of equine oocyte developmental capacity is ensured by the follicular environment, such as granulosa cells, which could reflect the meiotic development potential of immature oocytes. This study evaluated the relationship between DNA fragmentation of granulosa cells, using the chromatin dispersion test, and equine oocyte meiotic development after in vitro maturation. Granulosa cells and cumulus-oocytes complexes (n = 50) were recovered from slaughterhouse-derived ovaries. Oocytes were in vitro matured, stained and evaluated under fluorescence microscopy. Maturation rates were c...
Álvarez C, González N, Luño V, Martínez F, Gil L.The aim of this study was to test and compare two new components in extenders for freezing donkey semen: mare colostrum and jenny colostrum. Colostrum was obtained from four mares and four jennies right after the foal's birth. Ejaculates were collected from five fertile donkeys. Sperm samples were pooled, diluted and cryopreserved in three different experimental extender groups: lactose supplemented with egg yolk extender (20%) as the control group, lactose supplemented with jenny colostrum extender (20%), and lactose supplemented with mare colostrum extender (20%). After thawing, we evaluated...
Tanaka J, Leeb T, Rushton J, Famula TR, Mack M, Jagannathan V, Flury C, Bachmann I, Eberth J, McDonnell SM, Penedo MCT, Bellone RR.Mushroom is a unique coat color phenotype in Shetland Ponies characterized by the dilution of the chestnut coat color to a sepia tone and is hypothesized to be a recessive trait. A genome wide association study (GWAS), utilizing the Affymetrix 670K array (MNEc670k) and a single locus mixed linear model analysis (EMMAX), identified a locus on ECA7 for further investigation ( = 2.08 × 10). This locus contained a 3 Mb run of homozygosity in the 12 mushroom ponies tested. Analysis of high throughput Illumina sequencing data from one mushroom Shetland pony compared to 87 genomes from horses of var...
Girardi FM, da Fonseca LA, Ribeiro Filho JD, Souto PC, Ferreira DAC, Dornelas LRSM, Bento LD, de Carvalho Filho WP.Obesity in human and veterinary medicine is one of the most complex challenges within emerging diseases in the context of health. The problem of obesity in horses results in severe comorbidities; therefore, acute-phase proteins should be investigated for fluctuations increasing or decreasing by at least 25% in response to inflammation; these are candidates for future biomarkers and might provide new perspectives on early diagnosis and prognosis. Serum samples were analyzed in nine healthy animals (C) and nine obese animals (O). The proteins were separated by sodium dodecyl sulfate-polyacrylami...
Klohonatz KM, Coleman SJ, Cameron AD, Hess AM, Reed KJ, Canovas A, Medrano JF, Islas-Trejo AD, Kalbfleisch T, Bouma GJ, Bruemmer JE.Maternal recognition of pregnancy (MRP) in the mare is not well defined. In a non-pregnant mare, prostaglandin F (PGF) is released on day 14 post-ovulation (PO) to cause luteal regression, resulting in loss of progesterone production. Equine MRP occurs prior to day 14 to halt PGF production. Studies have failed to identify a gene candidate for MRP, so attention has turned to small, non-coding RNAs. The objective of this study was to evaluate small RNA (<200 nucleotides) content in endometrium during MRP. Mares were used in a cross-over design with each having a pregnant and non-mated cycle. Ea...
Meister TL, Tegtmeyer B, Brüggemann Y, Sieme H, Feige K, Todt D, Stang A, Cavalleri JV, Steinmann E.An equine parvovirus-hepatitis (EqPV-H) has been recently identified in association with equine serum hepatitis, also known as Theiler's disease. The disease was first described by Arnold Theiler in 1918 and is often observed with parenteral use of blood products in equines. However, natural ways of viral circulation and potential risk factors for transmission still remain unknown. In this study, we investigated the occurrence of EqPV-H infections in Thoroughbred horses in northern and western Germany and aimed to identify potential risk factors associated with viral infections. A total of 392...
Padalino B, Rosanowski SM, Di Bella C, Lacinio R, Rubino GTR.This study aimed to document the prevalence of chronic equine piroplasmosis (EP) in poorly performing Standardbred racehorses and to explore associations between the disease and sex, age, and hematological parameters. Blood was collected between 2004 and 2018; blood cell counts were performed using a cell counter analyzer, biochemical parameters using a photometer, and serum proteins using agarose gel electrophoresis. Blood smears were prepared, colored with a modified Giemsa, and an experienced technician identified the presence of protozoa. The horses were categorized into piroplasmosis posi...
Aurich C, Müller-Herbst S, Reineking W, Müller E, Wohlsein P, Gunreben B, Aurich J.Warmblood fragile foal syndrome (WFFS) is a monogenetic defect with autosomal recessive inheritance. The WFFS homozygosity is non-compatible with extra-uterine life. Although as many as 15% of Warmblood horses are WFFS carriers, there has been little veterinary focus on this condition. The aim of this study was to determine outcomes and symptoms of clinical signs and pathological abnormalities during pregnancies when there were WFFS homozygous foetuses. Diagnostic material of 15 abortion or stillbirth cases with suspected diagnosis of WFFS was available for this study. Additionally, there were...
Rivas VN, Aleman M, Peterson JA, Dahlgren AR, Hales EN, Finno CJ.Juvenile idiopathic epilepsy (JIE) is an inherited disease characterized by recurrent seizures during the first year of life in Egyptian Arabian horses. Definitive diagnosis requires an electroencephalogram (EEG) performed by a veterinary specialist. A recent study has suggested that a 19 base-pair deletion, along with a triple-C insertion, in intron five of twelve (∆19InsCCC; chr20:29542397-29542425: GTTCAGGGGACCACATGGCTCTCTATAGA>TATCTTAAGACCC) of the () gene is associated with JIE. To confirm this association, a new sample set consisting of nine EEG-phenotyped affected and nine unaffec...
Pasolini MP, Spinella G, Del Prete C, Valentini S, Coluccia P, Auletta L, Greco M, Meomartino L.Ultrasonography (US) is the recommended imaging technique to evaluate jugular veins. This prospective randomized clinical study was designed to collect a series of B-mode US measurements of manually distended jugular veins in healthy Italian Standardbreds and to find possible correlations between ultrasound measurements and animal morphometric characteristics. Forty-two horses, eight males and 34 females (range 3-22 years; bodyweight 494.4 ± 41.7 kg), were included in the study. The diameters and wall thicknesses of both jugular veins were measured at three different sites of the neck...
Leschke DH, Muir GS, Hodgson JK, Coyle M, Horn R, Bertin FR.Diseases associated with insulin dysregulation (ID), such as equine metabolic syndrome and pituitary pars intermedia dysfunction, are of interest to practitioners because of their association with laminitis. Accurate insulin concentration assessment is critical in diagnosing and managing these diseases. Objective: To determine the effect of time, temperature, and collection tube type on insulin concentrations in horses at risk of ID. Methods: Eight adult horses with body condition score >6/9. Methods: In this prospective study, subjects underwent an infeed oral glucose test 2 hours before...
Kydd JH, Hannant D, Robinson RS, Bryant N, Osterrieder N.Equid herpesvirus-1 (EHV-1) causes respiratory and neurological disease and late gestation abortion in pregnant mares. Current vaccines contain either inactivated or live EHV-1, but fail to provide complete clinical or virological protection, namely prevention of nasopharyngeal shedding and cell-associated viraemia. Thus, the development of novel products, such as modified live virus (MLV) vaccines which stimulate virus-specific, humoral and cell mediated immune responses more effectively remains a priority. Two groups of weaned foals (n = 6 each group) were used in a longitudinal, prospec...
Fitzgerald DM, Pollitt CC, Walsh DM, Sillence MN, de Laat MA.The oral glucose test (OGT) is a useful tool for diagnosing insulin dysregulation (ID) and is somewhat repeatable in ponies under consistent management. This study aimed to determine whether the insulin and incretin responses to an OGT in ponies differed after short-term access to fertilised pasture, compared to unfertilised pasture, by using a randomised, repeated measures study design. Sixteen mixed-breed ponies were classified as severely insulin-dysregulated (SD; post-prandial insulin ≥80 μIU/mL) or not severely insulin-dysregulated (NSD; post-prandial insulin < 80 μIU/mL) using an O...
Chen JW, Stefanovski D, Haughan J, Jiang Z, Boston R, Soma LR, Robinson MA.Extracorporeal shockwave therapy (ESWT) can potentially mask painful injuries in equine athletes. Tests to detect whether a horse has received ESWT prior to competition are needed. Extracorporeal shockwave therapy is known to affect inflammatory mediators in other species, and if these mediators are altered in the horse, these could serve as biomarkers of ESWT. Objective: To test the hypothesis that a single application of ESWT will alter the circulating protein concentrations of 10 inflammatory mediators in horse plasma. Methods: Prospective repeated measures experimental study. Methods: Elev...
Thompson RE, Johnson AK, Prado TM, Premanandan C, Brown ME, Whitlock BK, Pukazhenthi BS.Availability of viable frozen-thawed endometrial tissues could facilitate detailed studies into physiologic and disease processes influencing the endometrium. This study was designed to investigate the cryosurvival of equine endometrial tissue. Previous studies in the human and horse have focused on cryopreservation of dissociated endometrial cells. To our knowledge, there are no studies on cryopreservation of endometrial explants. Our objectives were to 1) determine the influence of differing concentrations of the permeating cryoprotectant dimethyl sulfoxide (MeSO) on viability, structural in...
Álvarez-Narváez S, Giguère S, Anastasi E, Hearn J, Scortti M, Vázquez-Boland JA.Antibiotic use has been linked to changes in the population structure of human pathogens and the clonal expansion of multidrug-resistant (MDR) strains among healthcare- and community-acquired infections. Here we present a compelling example in a veterinary pathogen, , the causative agent of a severe pulmonary infection affecting foals worldwide. We show that the (46) gene responsible for emerging macrolide resistance among equine isolates in the United States is part of a 6.9-kb transposable element, Tn, actively mobilized by an IS family transposase. Tn is carried on an 87-kb conjugative pla...
Yao C.The kinetoplastid protozoan Leishmania spp. cause leishmaniasis, which clinically exhibit mainly as a cutaneous, mucocutanous or visceral form depending upon the parasite species in humans. The disease is widespread geographically, leading to 20 000 annual deaths. Here, leishmaniases in both humans and animals, reservoirs and sand fly vectors on the Caribbean islands are reviewed. Autochthonous human infections by Leishmania spp. were found in the Dominican Republic, Guadeloupe and Martinique as well as Trinidad and Tobago; canine infections were found in St. Kitts and Grenada; and equine infe...
Nemoto M, Schofield W, Cullinane A.The objective of this study was to investigate the presence of equine coronavirus (ECoV) in clinical samples submitted to a diagnostic laboratory in Ireland. A total of 424 clinical samples were examined from equids with enteric disease in 24 Irish counties between 2011 and 2015. A real-time reverse transcription polymerase chain reaction was used to detect ECoV RNA. Nucleocapsid, spike and the region from the p4.7 to p12.7 genes of positive samples were sequenced, and sequence and phylogenetic analyses were conducted. Five samples (1.2%) collected in 2011 and 2013 tested positive for ECoV. Po...
Tozaki T, Kusano K, Ishikawa Y, Kushiro A, Nomura M, Kikuchi M, Kakoi H, Hirota K, Miyake T, Hill EW, Nagata S.Fractures are medical conditions that compromise the athletic potential of horses and/or the safety of jockeys. Therefore, the reduction of fracture risk is an important horse and human welfare issue. The present study used molecular genetic approaches to determine the effect of genetic risk for fracture at four candidate SNPs spanning the myostatin (MSTN) gene on horse chromosome 18. Among the 3706 Japanese Thoroughbred racehorses, 1089 (29.4%) had experienced fractures in their athletic life, indicating the common occurrence of this injury in Thoroughbreds. In the case/control association st...
Gozalo-Marcilla M, Luna SPL, Gasthuys F, Schauvliege S.To perform a literature review of the thermal and mechanical antinociceptive devices used in pharmacological studies in standing horses published after 2011 (2012-2019). To complete a full literature review about electrical stimulation used for evaluation in similar studies. Methods: PubMed, Google Scholar and Web of Science. Conclusions: A high level of standardization has been reached in antinociceptive studies in standing horses using thermal and mechanical stimuli in most recent years. Commercially available testing devices to deliver thermal, mechanical and electrical stimuli, with observ...
Blanco-Lobo P, Rodriguez L, Reedy S, Oladunni FS, Nogales A, Murcia PR, Chambers TM, Martinez-Sobrido L.Vaccination remains the most effective approach for preventing and controlling equine influenza virus (EIV) in horses. However, the ongoing evolution of EIV has increased the genetic and antigenic differences between currently available vaccines and circulating strains, resulting in suboptimal vaccine efficacy. As recommended by the World Organization for Animal Health (OIE), the inclusion of representative strains from clade 1 and clade 2 Florida sublineages of EIV in vaccines may maximize the protection against presently circulating viral strains. In this study, we used reverse genetics tech...
Riddell LP, Yoshimura S, MacKay AV, Wilson DG.A 17-year-old Quarter horse mare was presented because of traumatic luxation of the fifth sacral and first coccygeal vertebrae resulting in loss of sensation, motor function, and perfusion of the tail. The case was complicated by an associated tail head hematoma. Due to the severity of the injury, tail amputation was performed at the level of the luxation. Tail amputations in horses at the sacrococcygeal junction following a suspected tail pull injury are infrequently reported in the literature. . Une jument Quarter horse âgée de 17 ans fut présentée pour cause de luxation traumatique de l...
de Paula VB, Canola PA, Rivera GG, Z Filho D, Amaral GPD, Ferraz GC, Ferraudo AS, Canola JC.To investigate effects of postural changes and bladder distention on intrabladder pressure whilst estimating intra-abdominal pressure in horses. Two-year cohort study. Patients admitted for elective surgical procedures unrelated to gastrointestinal or genitourinary tract. School of Agricultural and Veterinarian Sciences, Jaboticabal, SP, Brazil. 20 adult horses, 11 males (stallions and geldings) and 9 females; between 3.5 and 12 years, weighing 350 to 500 kg. Intra-abdominal pressure was directly-recorded through abdominocentesis at the ventral midline with a fluid-filled system. Intrabladder ...
Malalana F, Ireland JL, Pinchbeck G, McGowan CM.Uveitis appears to be less prevalent in the UK compared with other parts of the world and studies characterising the disease in the UK are lacking. The objectives of this retrospective study were to describe acute and recurrent cases presenting for management of uveitis in a referral hospital on the North West of England and compare the signalment of horses presenting with uveitis with the equine hospital population during the same period. Methods: Medical records of horses presented to the referral Equine Hospital, University of Liverpool with signs of uveitis between 2008 and 2018 were revie...
Draper ACE, Cahalan SD, Goodwin D, Perkins J, Piercy RJ.Equine recurrent laryngeal neuropathy (RLN) is a naturally occurring model of length-dependent axonopathy characterized by asymmetrical degeneration of recurrent laryngeal nerve axons (RLn). Distal RLn degeneration is marked, but it is unclear whether degeneration extends to include cell bodies (consistent with a neuronopathy). With examiners blinded to RLN severity, brainstem location, and side, we examined correlations between RLN severity (assessed using left distal RLn myelinated axon count) and histopathological features (including chromatolysis and glial responses) in the nucleus ambiguu...
Bourély C, Cazeau G, Jarrige N, Jouy E, Haenni M, Lupo A, Madec JY, Leblond A, Gay E.To examine the relevance of co-resistance to amoxicillin and tetracycline as an indicator of multidrug resistance (MDR) in animal health. Methods: isolates collected between 2012 and 2016 by the French surveillance network for antimicrobial resistance in diseased animals (RESAPATH) were analyzed. The proportions of MDR isolates and the proportions of isolates presenting co-resistance to amoxicillin and tetracycline were calculated for seven animal species (cattle, horse, dog, swine, poultry, duck, and turkey). The degree of agreement between these two proportions was estimated by calculating ...
Lindenberg F, Krych L, Kot W, Fielden J, Frøkiær H, van Galen G, Nielsen DS, Hansen AK.Shortly after birth the mammalian gut is colonized, by a transient microbiota, highly susceptible to environment and diet, that eventually stabilizes and becomes the resident gut microbiota. In a window of opportunity during the colonization, oral tolerance is established towards resident bacteria. In this study, the development of the equine gut microbiota was investigated in ten foals from parturition until post weaning. We found great differences in the core species of the gut microbiota composition between time-matched samples on Day 7 and 20 post-partum. Between day 20 and Day 50 post-par...
Cuervo-Arango J, Claes AN, Stout TAE.In recent years, the number of equine invitro-produced embryos (IVP) has increased markedly; as yet, there are few reports on what constitutes an 'ideal' recipient for an IVP embryo. This study retrospectively investigated the effects of recipient mare oestrous cycle characteristics on the likelihood of pregnancy after transfer of IVP (n=264) and invivo-derived embryos (n=262). IVP embryos tolerated only a narrow window of recipient mare 'synchrony', with transfer on Day 4 after ovulation resulting in a higher likelihood of ongoing pregnancy (69%) than transfer on Days 3, 5 or 6 (53.2%, 41.3% ...
McClellan A, Paterson YZ, Paillot R, Guest DJ.In horses and humans, tendon injuries are a significant problem. Not only can they occur in both athletes and nonathletes, they require lengthy periods of recuperation and undergo poor natural regeneration, which leads to high reinjury rates. Embryonic stem cells (ESCs) may provide a renewable source of allogeneic cells to use in clinical applications to aid tissue regeneration. Equine ESCs can undergo tenocyte differentiation in vivo and in vitro, but the immune properties of tenocytes isolated from either ESCs or tissues have not previously been characterized. Here, we demonstrate that equin...
Klouth E, Zablotski Y, Petersen JL, de Bruijn M, Gröndahl G, Müller S, Goehring LS.Equid Herpesvirus Myeloencephalopathy (EHM) is a multifactorial disease following an EHV-1 infection in Equidae. We investigated a total of 589 horses on 13 premises in Europe in search of risk factors for the development of EHM. We found that fever ( < 0.001), increasing age ( = 0.032), and female sex ( = 0.042) were risk factors for EHM in a logistic mixed model. Some breeds had a decreased risk to develop EHM compared to others (Shetland and Welsh ponies; = 0.017; = 0.031), and fewer EHV-1-vaccinated horses were affected by EHM compared to unvaccinated horses ( = 0.02). Data evaluation...
Yoshihara E, Takahashi T, Otsuka N, Isayama T, Tomiyama T, Hiraga A, Wada S.It has been suggested that the heel of the horse's hoof expands in the stance phase and this reduces the concussion at impact and helps pump blood into the hoof. Therefore, farriers usually leave a gap in the heel region when using the traditional nailed shoe. Recently glued shoes which are attached firmly to the heel have been developed and these could restrict heel movement. Objective: To compare the degree of mediolateral heel movement between glued and nailed shoes. Methods: Seven Thoroughbreds were used. Either their fore- or hind hooves were shod with plain aluminium shoes, attached firs...
Veraa S, Bergmann W, Wijnberg ID, Back W, Vernooij H, Nielen M, van den Belt AM.Morphology of the equine cervical intervertebral disc is different from that in humans and small companion animals and published imaging data are scarcely available. The objectives of this exploratory, methods comparison study were (a) to describe MRI features of macroscopically nondegenerated and degenerated intervertebral discs (b) to test associations between spinal location and macroscopic degeneration or MRI-detected annular protrusion and between MRI-detected annular protrusion and macroscopic degeneration, and (c) to define MRI sequences for characterizing equine cervical intervertebral...
Oakenfull EA, Buckle VJ, Clegg JB.The alpha-globin gene complex in Equus caballus has been mapped by fluorescence in situ hybridization to the telomeric region of the long arm of chromosome 13. This is the first equine gene to be mapped to this chromosome.
Hardeman AM, Egenvall A, Serra Bragança FM, Koene MHW, Swagemakers JH, Roepstorff L, van Weeren R, Byström A.The increasing popularity of objective gait analysis makes application in prepurchase examinations (PPE) a logical next step. Therefore, there is a need to have more understanding of asymmetry during a PPE in horses described on clinical evaluation as subtly lame. Objective: The objective of this study is to objectively compare asymmetry in horses raising minor vet concerns in a PPE and in horses raising major vet concerns with that found in horses presented with subtle single-limb lameness, and to investigate the effect of age/discipline on the clinicians' interpretation of asymmetry on the c...
Browning GF, Studdert MJ.The BamHI, EcoRI, and HindIII physical maps of the genomes of 14 isolates of equine herpesvirus 2 (EHV 2) were determined by Southern blot analysis using DNA fragments of a previously mapped EHV 2 strain 86/67. No two isolates had identical maps for all 3 enzymes, the number of differing cleavage sites between pairs of isolates varying from 3 to 21. Overall 75 cleavage sites were mapped, of which 40 were variable. Cleavage sites occurred throughout the genome, including within the terminal repeat regions. Additionally, fragment length polymorphisms, independent of cleavage site loss or gain, w...
Jones RL, Adney WS, Alexander AF, Shideler RK, Traub-Dargatz JL.Severe hemorrhagic necrotizing enterocolitis was determined to be the cause of death for 4 foals. Toxigenic Clostridium difficile was isolated form the intestine of each foal, and large, gram-positive, rod-shaped bacteria lined the surface of necrotic villi. This finding of toxigenic C difficile associated with enteritis in foals adds another possible cause to the list of infectious agents that should be considered when evaluating foals with enteritis. Definitive diagnosis requires a thorough diagnostic evaluation, including procedures that will identify the organism and demonstrate its toxige...
Smith MA, Dyson SJ, Murray RC.The appearance of the equine metacarpophalangeal (MCP) joint on high-field (1.5 T) vs. low-field standing (0.27 T) magnetic resonance (MR) images was evaluated. Objectives were (1) to describe the MR appearance of anatomic structures of clinical interest on images of the equine MCP joint obtained from 20 equine cadaver limbs from horses without lameness using high-field and low-field systems, (2) to categorize the clarity of appearance of anatomic structures on low-field MR images in comparison to high-field images as a gold standard. We found that larger anatomic structures were visible with ...
Billinghurst RC, Brama PA, van Weeren PR, Knowlton MS, McIlwraith CW.To determine whether serum concentrations of biomarkers of skeletal metabolism can, in conjunction with radiographic evaluation, indicate severity of osteochondrosis in developing horses. Methods: 43 Dutch Warmblood foals with varying severity of osteochondrosis. Methods: 24 foals were monitored for 5 months and 19 foals were monitored for 11 months. Monthly radiographs of femoropatellar-femorotibial and tibio-tarsal joints were graded for osteochondral abnormalities. Serial blood samples were assayed for 8 cartilage and bone biomarkers. At the end of the monitoring period, foals were examined...
Bonelli F, Rota A, Aurich C, Ille N, Camillo F, Panzani D, Sgorbini M.Salivary cortisol provides information about free plasma cortisol concentration, and salivary sampling is a noninvasive well-tolerated procedure. The aim of this study was to validate a commercial enzyme immunoassay for the determination of salivary cortisol in donkeys. Saliva samples were collected in four donkey stallions on 13 nonconsecutive days at 8:30 AM to avoid circadian variation. Animals were already accustomed to be handled. Saliva was collected using a swab inserted at the angle of the lips, placed onto the tongue for 1 minute and returned into a polypropylene tube. Tubes were cen...
Pearson GR, Davies LW, White AL, O'Brien JK.The intestinal tracts of 20 horses, killed at a local abattoir and of unknown age, sex and previous clinical history were examined for the presence of Anoplocephala perfoliata attached to the ileo-caecal junction. Four horses had no tape-worms, nine had one to 20 tapeworms attached to the mucosa and seven had more than 100 attached to the mucosa. The histological changes of thickening, ulceration and eosinophil infiltration of the mucosa at the ileo-caecal junction were more severe when more than 100 parasites were present.
Steinman A, Peer G, Klement E.The variations with breed, gender, age and coat colour in the prevalence of Culicoides hypersensitivity were studied in 408 horses on 18 farms in Israel. Data were gathered by means of questionnaires and the diagnoses were confirmed by direct physical examinations. The prevalence of Culicoides hypersensitivity was 28 per cent. The disease was rare on farms more than 800 m above sea level but was more prevalent at lower altitudes. The most important factors affecting the prevalence of Culicoides hypersensitivity were the farm, breed and age, but gender and colour were not significantly correlat...
Amann RP.Apparent fertility of a male or group of females is considered frequently by veterinarians or animal scientists. Unfortunately, concepts of experimental design and statistics impacting validity and interpretation of values for average pregnancy rate frequently are ignored. The magnitude of this problem was documented by examination of published papers; 51 of 67 (76%) were considered flawed for one or more reasons. The discussion considers why: (a) conclusions from most published fertility studies reporting no significant difference due to treatment(s) are suspect, because too few males and/or ...
Mosing M, Auer U, MacFarlane P, Bardell D, Schramel JP, Böhm SH, Bettschart-Wolfensberger R, Waldmann AD.The aim of this study was to evaluate the effect of continuous positive airway pressure (CPAP) on regional distribution of ventilation and dead space in anaesthetized horses. Methods: Randomized, experimental, crossover study. Methods: A total of eight healthy adult horses. Methods: Horses were anaesthetized twice with isoflurane in 50% oxygen and medetomidine as continuous infusion in dorsal recumbency, and administered in random order either CPAP (8 cmHO) or NO CPAP for 3 hours. Electrical impedance tomography (and volumetric capnography (VCap) measurements were performed every 30 minutes. L...
Dubey JP.Thirteen 6-month- to 13-year-old equids were each inoculated orally with 10,000 infective Toxoplasma gondii oocysts. The equids remained clinically normal. Equids were euthanatized on postinoculation days 33, 45, 90, 104, 120, 140, 162, 183, 197, 204, 211, 294, and 476. Their tissues were bioassayed for viable oocysts by feeding muscles to Toxoplasma-free cats and by inoculation of pepsin digests of 13 organs into mice. Using mouse inoculation, T gondii was recovered from tissues of the 9 equids euthanatized on each of postinoculation days 33, 45, 120, 140, 183, 197, 211, 294, and 476. Toxopla...
Scala A, Tamponi C, Sanna G, Predieri G, Meloni L, Knoll S, Sedda G, Dessì G, Cappai MG, Varcasia A.Equine ascariosis, caused by Parascaris spp., is a worldwide endoparasitic disease affecting young horses in particular. Despite the great number of horses reared in Italy, large-scale epidemiological surveys dealing with ascariosis prevalence in the country are not reported in the current literature. For this reason, the present survey aims to describe, for the first time, the spread and infestation of Parascaris spp. in a large population of Italian horses (6896 animals) using faecal egg counts, and further to identify risk factors associated with ascarid egg shedding. Methods: Individual re...
Preziuso S, Pinho MD, Attili AR, Melo-Cristino J, Acke E, Midwinter AC, Cuteri V, Ramirez M.Streptococcus dysgalactiae subsp. equisimilis (SDSE) can be severely pathogenic in humans and is increasingly isolated from horses with respiratory, reproductive or other diseases, although it is often considered a commensal bacterium. Here a PCR protocol is described for identifying SDSE recovered from humans. A multiplex PCR targeting the 16S rRNA and the streptokinase precursor gene has been optimized for differentiating between SDSE strains isolated from humans and those isolated from horses. Previously, the sequence of the streptokinase precursor gene of SDSE recovered from horses has bee...
Bruce V, Turek RJ.The gluteus medius of two killed Thoroughbred horses were sampled along the muscle and across the muscle at four different depths. The distribution of fibre types in these two horses was assessed by staining cross sections of the muscle sample for ATPase. A non-uniform distribution of fibre types was found within the gluteus medius in both horses and there was a significant increase in percentage of slow twitch (ST) fibres from the surface to the deeper regions of the muscle. The rate of increase, however, depended on the individual site along the muscle. Averages ranges from a low of 2.4 per ...
Blanchard TL, Kenney RM, Timoney PJ.Equine venereal infections of concern in the United States include EHV-3, T. equigenitalis, P. aeruginosa, and K. pneumoniae. Stallions may also harbor EAV in the genital tract and transmit the virus to mares during coitus. With the exception of EHV-3, the stallion generally remains asymptomatic while transmitting infections to mares during breeding. Methods for diagnosis, treatment, and control of these infections are discussed.
Jörg A, Portmann P, Fellay G, Dreyer JL, Meyer J.An improved and short method is described for the isolation of intact eosinophilic leukocytes from horse blood with high yield (1--1.5 g/20 l). Viability and purity of the preparations were verified by light and electron microscopy and by the trypan blue exclusion test. Isolated eosinophils were 98--100% pure, intact and viable, and they could be shown to phagocytise immune-complexes.
McDonell WN, Hall LW, Jeffcott LB.Studies in conscious and anaesthetised ponies demonstrated that starvation, anaesthesia and changes in body position influence the radiographic appearance of the lungs in the lateral and dorsoventral views. Radiographic appearances could not be closely correlated with blood gas values, but they suggested that the volume of the lowermost lung of the laterally recumbent animal is greatly reduced.
Epp TY, Waldner C, Berke O.The objective of this study was to develop a model using equine data from geographically limited surveillance locations to predict risk categories for West Nile virus (WNV) infection in horses in all geographic locations across the province of Saskatchewan. The province was divided geographically into low-, medium-, or high-risk categories for WNV, based on available serology information from 923 horses obtained through 4 studies of WNV infection in horse populations in Saskatchewan. Discriminant analysis was used to build models using the observed risk of WNV in horses and geographic division...
Reichert C, Kästner SB, Hopster K, Rohn K, Rötting AK.To evaluate the use of a micro-lightguide tissue spectrophotometer for measurement of tissue oxygenation and blood flow in the small and large intestines of horses under anesthesia. Methods: 13 adult horses without gastrointestinal disease. Methods: Horses were anesthetized and placed in dorsal recumbency. Ventral midline laparotomy was performed. Intestinal segments were exteriorized to obtain measurements. Spectrophotometric measurements of tissue oxygenation and regional blood flow of the jejunum and pelvic flexure were obtained under various conditions that were considered to have a potent...
Akter R, Stent AW, Sansom FM, Gilkerson JR, Burden C, Devlin JM, Legione AR, El-Hage CM.Chlamydia psittaci was detected by PCR in the lung and equine foetal membranes of two aborted equine foetuses and one weak foal from two different studs in Victoria, Australia. The abortions occurred in September 2019 in two mares sharing a paddock northeast of Melbourne. The weak foal was born in October 2019 in a similar geographical region and died soon after birth despite receiving veterinary care. The detection of C. psittaci DNA in the lung and equine foetal membranes of the aborted or weak foals and the absence of any other factors that are commonly associated with abortion or neonatal ...
Nielsen SS, Bicout DJ, Calistri P, Canali E, Drewe JA, Garin-Bastuji B, Gonzales Rojas JL, Gortazar Schmidt C, Herskin M, Michel V, Miranda Chueca MA....In this opinion, the antimicrobial-resistant bacteria responsible for transmissible diseases that constitute a threat to the health of horses have been assessed. The assessment has been performed following a methodology composed of information collected via an extensive literature review and expert judgement. Details on the methodology used for this assessment are explained in a separate opinion. A global state of play of antimicrobial-resistant spp. spp. and subsp and subsp. and subsp. has been provided. Among those bacteria, EFSA identified , and with more than 66% certainty as the mo...
Groppelli E, Tuthill TJ, Rowlands DJ.Equine rhinitis A virus (ERAV) is genetically closely related to foot-and-mouth disease virus (FMDV), and both are now classified within the genus Aphthovirus of the family Picornaviridae. For disease security reasons, FMDV can be handled only in high-containment facilities, but these constraints do not apply to ERAV, making it an attractive alternative for the study of aphthovirus biology. Here, we show, using immunofluorescence, pharmacological agents, and dominant negative inhibitors, that ERAV entry occurs (as for FMDV) via clathrin-mediated endocytosis and acidification of early endosomes...
Pusterla N, Wilson WD, Conrad PA, Barr BC, Ferraro GL, Daft BM, Leutenegger CM.This study was designed to determine the relative levels of gene transcription of selected pathogens and cytokines in the brain and spinal cord of 12 horses with equine protozoal myeloencephalitis (EPM), 11 with equine herpesvirus type 1 (EHV-1) myeloencephalopathy, and 12 healthy control horses by applying a real time pcr to the formalin-fixed and paraffin-embedded tissues. Total rna was extracted from each tissue, transcribed to complementary dna (cDNA) and assayed for Sarcocystis neurona, Neospora hughesi, EHV-1, equine GAPDH (housekeeping gene), tumour necrosis factor (TNF)-alpha, interfer...
Elghryani N, Duggan V, Relf V, de Waal T.Knowledge regarding helminth control strategies and nematode infection of horses in Ireland is limited and only one study has been published recently. This present study was designed to investigate the current helminth control strategies followed by horse owners in Ireland. A questionnaire was formulated to collect data on general grazing, pasture management and deworming strategies including the use of fecal egg counts. Questionnaires were emailed to 700 members of the Irish Thoroughbred Breeders Association and Horse Sport Ireland. Only 78 questionnaires were returned. Respondents indicated ...
Dierks C, Komm K, Lampe V, Distl O.In this study, we refine a quantitative trait locus for equine osteochondrosis (OC) on horse chromosome (ECA) 2 to a genome-wide significant interval at 20.08-30.94 Mb. The marker set contained 27 newly developed microsatellites equidistantly distributed over ECA2 and 44 nucleotide polymorphisms, located in 16 positional candidate genes for OC. Genotyping was performed in 211 Hanoverian horses from 14 paternal half-sib groups. A NCDN-associated SNP and haplotype were significantly associated with OC in fetlock and/or hock joints. This study is a further step towards the identification of genes...
Moloney BJ.This overview of the equine influenza (EI) epidemic as it occurred in two Australian states, New South Wales and Queensland, in 2007 describes the functions and activities of the epidemiology teams that were engaged during the outbreak and also identifies key features of the epidemiology of EI during the outbreak.
