Veterinary research in horses encompasses the study of diseases, health management, and medical treatments specific to equine species. This field investigates various aspects of horse health, including infectious diseases, metabolic disorders, and musculoskeletal conditions. Researchers focus on understanding the pathophysiology of equine ailments, developing diagnostic tools, and evaluating therapeutic interventions. The study of horse health also involves examining preventive measures such as vaccination protocols and nutritional management to promote overall well-being. This page collects peer-reviewed research studies and scholarly articles that explore the diverse areas of veterinary science related to horses, providing insights into disease mechanisms, treatment strategies, and advancements in equine healthcare.
Love S, Wyse CA, Stirk AJ, Stear MJ, Calver P, Voute LC, Mellor DJ.The assessment of belief that equine conformation is associated with performance and durability is a fundamental concept of horsemanship. Surprisingly, there is almost no quantitative evidence to support these beliefs. Objective: To assess the prevalence and heritability of conformational traits in Thoroughbred yearlings, and investigate their significance for subsequent turf flat-racing performance and durability. Methods: Nine selected conformational traits were assessed in a consistent, qualitative manner by a single veterinary observer and entered into a database together with details of p...
Parsons KJ, Wilson AM.MP3 recorders are readily available, small, lightweight and low cost, providing the potential for logging analogue hoof mounted accelerometer signals for the characterisation of equine locomotion. These, however, require testing in practice. Objective: To test whether 1) multiple MP3 recorders can maintain synchronisation, giving the ability to synchronise independent recorders for the logging of multiple limbs simultaneously; and 2) features of a foot mounted accelerometer signal attributable to foot-on and foot-off can be accurately identified from horse foot mounted accelerometers logged di...
Gnagey L, Clayton HM, Lanovaz JL.The tarsal joint is a frequent site of lameness, but little objective information is available regarding the effects of tarsal conformation on joint movements or forces. Objective: To compare tarsal kinematics and kinetics in horses with large, intermediate and small tarsal angles. Methods: Sagittal plane standing angle of the right tarsal joint was measured in 16 horses as they stood squarely with the hind hooves vertically beneath the hip joint. Tarsal angles were classified as small (< 155.5 degrees), intermediate (155.5-165.5 degrees) or large (> 165.5 degrees). Reflective markers, attache...
Cassart D, Baise E, Cherel Y, Delguste C, Antoine N, Votion D, Amory H, Rollin F, Linden A, Coignoul F, Desmecht D.There is a lack of well documented studies about muscular lesions in equine atypical myopathy (EAM). Objective: To characterise morphopathological changes of striated muscles and myocardium, to progress understanding of this disease. Methods: Thirty-two horses age 0.5-7 years kept on pasture were referred for a sudden ataxia/myoglobinuria syndrome. Clinical examination (stiffness, muscle pain, muscle fasciculations, abnormal gait, recumbency, myoglobinuria, tachycardia, sweating) and plasma CPK, LDH and AST levels were consistent with extensive myonecrosis and, together with anamnestic data, w...
Weller R, Pfau T, Babbage D, Brittin E, May SA, Wilson AM.The importance of a reliable method for conformation studies is generally acknowledged, but there are only limited data on the accuracy and precision of current assessment methods. Objective: To assess (1) the accuracy and repeatability of marker placement, (2) influence of stance of the horse on conformational parameters, (3) practicality of a computerised motion analysis system and (4) to compare the computerised motion analysis system to photographic systems of assessment. Methods: Twenty-eight reflective markers placed over anatomical landmarks were located in 3D using a computerised motio...
Loftus JP, Belknap JK, Stankiewicz KM, Black SJ.REASONS FOR STUDY: Xanthine oxidase (XO)-dependent production of superoxide anion and hydrogen peroxide, a characteristic of ischaemia-reperfusion injury, may contribute to the development of equine laminitis. Objective: To determine the levels of XO and antioxidant enzymes (catalase, superoxide dismutase [SOD]) in the digital laminae of normal horses (CON) and horses in the developmental stage of laminitis using the black walnut extract (BWE) model. Methods: Healthy horses (n = 12) were administered BWE (BWE group, n = 6), or water (CON group, n = 6) through a nasogastric tube. At the onset o...
Schnabel LV, Bramlage LR, Mohammed HO, Embertson RM, Ruggles AJ, Hopper SA.Studies on arthroscopic removal of apical proximal sesamoid fracture fragments in Thoroughbred (TB) horses age > or = 2 years have reported a high success rate. However, there are no reports documenting the racing prognosis of TB horses that undergo such surgery as weanlings or yearlings. Objective: To describe the incidence of apical proximal sesamoid fractures in immature TB horses, age < 2 years and determine probability and quality of racing performance after arthroscopic removal of such fractures in 151 TB weanlings and yearlings. Methods: The medical records of TB horses age < 2 years th...
Chaney KP, Holcombe SJ, LeBlanc MM, Hauptman JG, Embertson RM, Mueller PO, Beard WL.Anecdotal speculation suggests that prognosis for survival of mares and foals following correction of uterine torsion has improved over the past 30 years. Objective: To determine statistically the outcome of uterine torsion according to duration of clinical signs, stage of gestation, parity, physical examination findings, method of correction, prognosis for survival and reproductive health of the mare, and prospects for the foal within the neonatal period. Methods: This retrospective study combined cases from 4 equine referral hospitals. Results: The stage of gestation at which uterine torsion...
Taha S, Johansson O, Rivera Jonsson S, Heimer D, Krovacek K.Clostridium difficile is a common nosocomial pathogen in humans and animals that causes diarrhea and colitis following antibiotic therapy. Isolates of C. difficile obtained from faecal material from 20 human patients and 6 equine subjects with antibiotic-associated diarrhea were investigated regarding production of toxins A and B, their capacity to adhere to the human intestinal Caco-2 cell line and equine intestinal cells, and for the presence of fimbriae. The results showed that most (17/20) of the human clinical isolates produced both toxins A and B. One of the human isolates proved toxin A...
Santschi EM, Leibsle SR, Morehead JP, Prichard MA, Clayton MK, Keuler NS.There is little information available about conformational changes in the forelimbs of growing foals. Objective: To describe the conformation of the carpus and fetlock of Thoroughbred foals from birth to yearling sale age. Methods: Subjective assessments of the fetlock and carpal conformation of 119 Thoroughbred foals were made within the first month of life and then at 30 day intervals until at least age 120 days. At least 70 subjects were examined further at 60 day intervals until September of their second year. Conformation grades are reported for 5 age groups: first 7 days and at a mean of...
van Heel MC, Kroekenstoel AM, van Dierendonck MC, van Weeren PR, Back W.Conformational traits are important in breeding, since they may be indicative for performance ability and susceptibility to injuries. Objective: To study whether certain desired conformational traits of foals are related to lateralised behaviour while foraging and to the development of uneven feet. Methods: Twenty-four Warmblood foals, born and raised at the same location, were studied for a year. Foraging behaviour was observed by means of weekly 10 min scan-sampling for 8 h. A preference test (PT) was developed to serve as a standardised tool to determine laterality. The foals were evaluated...
Ryan CT, Schaer BL, Nunamaker DM.A device is needed to safely and wirelessly evaluate accelerations experienced by the horse hoof under a variety of surface conditions with the horse exercising at training or racing speeds. Objective: To develop a miniaturised wireless data acquisition system (WDAS) which reliably records hoof accelerations and the times over which they occur in a minimally invasive manner in the exercising Thoroughbred. Methods: The following criteria were set for device development: production of a lightweight and minimally invasive system, which provides an adequate acceleration range, appropriate frequenc...
van Grevenhof EM, Ducro B, Heuven HC, Bijma P.It is expected that climate and habitat factors influence the prevalence of culicoides and, therefore, the prevalence of insect bite hypersensitivity (IBH), but very little is described in the literature to prove the association of these factors. Prevalence varies widely from 3% in certain areas of Great Britain to 60% in certain parts of Australia. Objective: To describe the influence of environmental factors on the prevalence of IBH in Shetland ponies and Friesian horses in The Netherlands. Methods: Data on 3284 Shetland and 2824 Friesian mares (n = 6108) were collected in The Netherlands, b...
Maes A, Weiland L, Sandersen C, Gasthuys F, De Backer P, Croubels S.A sensitive method for the quantification of lidocaine and its metabolites, monoethylglycinexylidide (MEGX) and glycinexylidide (GX), in animal plasma using high-performance liquid chromatography combined with electrospray ionization mass spectrometry is described. The sample preparation includes a liquid-liquid extraction with methyl tert-butylmethyl ether after addition of 2M sodium hydroxide. Ethylmethylglycinexylidide (EMGX) is used as an internal standard. For chromatographic separation, an ODS Hypersil column was used. Isocratic elution was achieved with 0.01 M ammonium acetate and aceto...
Mathie RT, Hansen L, Elliott MF, Hoare J.Targeted research development in veterinary homeopathy is properly informed by the systematic collection and analysis of relevant clinical data obtained by its practitioners. We organised a pilot data collection study, in which 8 Faculty of Homeopathy veterinarians collected practice-based clinical and outcomes data over a 6-month period. Methods: A specifically designed Excel spreadsheet enabled recording of consecutive clinical appointments under the following headings: date; identity of patient and owner (anonymised); age, sex and species of patient; medical condition/complaint treated; whe...
Alvarez I, Gutierrez G, Vissani A, Rodriguez S, Barrandeguy M, Trono K.We developed and validated an agar gel immunodiffusion test (AGID) test for the diagnosis of equine infectious anemia (EIA) using as antigen the p26 protein of equine infectious anemia virus (EIAV) produced in the Escherichia coli expression system. The developed rp26-AGID test showed an excellent diagnostic relative sensitivity (100%) and specificity (100%) compared to a commercial AGID assay when 1855 field serum samples were analyzed. In addition, the rp26-AGID demonstrated to be a precise assay with excellent repeatability and reproducibility. In the analytical sensitivity trial, positive ...
Jenkinson DM, Elder HY, Bovell DL.The condition of anhidrosis is described in this review, and the latest theories on the causal factors are explored. The evidence supports the hypothesis that anhidrosis is an inappropriate response to prolonged climatic stress (generally combined heat and high humidity), which can be evoked in a small (approximately 10 +/- 5%) proportion of the equine population. It is caused by gradual failure of the glandular secretory cell processes, initiated by desensitization and subsequent down-regulation of the cell receptors as a result of continued adrenaline-driven hyperactivity. It progresses thro...
MacLachlan NJ, Balasuriya UB, Davis NL, Collier M, Johnston RE, Ferraro GL, Guthrie AJ.Viral diseases constitute an ever growing threat to the horse industry worldwide because of the rapid movement of large numbers of horses for competition and breeding. A number of different types of vaccines are available for protective immunization of horses against viral diseases. Traditional inactivated and live-attenuated (modified live virus, MLV) virus vaccines remain popular and efficacious but recombinant vaccines are increasingly being developed and used, in part because of the perceived deficiencies of some existing products. New generation vaccines include MLVs with deletions and/or...
Pusterla N, Mapes S, Leutenegger CM.A questionnaire was developed to document the knowledge base of large-animal diplomates of the American College of Veterinary Internal Medicine (ACVIM) regarding polymerase chain reaction (PCR) technology and to identify the common use of this technology in equine practice. Ninety-three of the 278 mailed questionnaires were returned, for an overall response rate of 33.4%. Ninety respondents (99%) reported being familiar with the general principles of nucleic acid probe technology; however, only 52 (57%) knew the difference between conventional (traditional) and real-time (second-generation) PC...
Machnik M, Hegger I, Kietzmann M, Thevis M, Guddat S, Schänzer W.The Federation Equestre Internationale has permitted the use of altrenogest in mares for the control of oestrus. However, altrenogest is also suspicious to misuse in competition horses for its potential anabolic effects and suppression of typical male behaviour, and thus is a controlled drug. To investigate the pharmacokinetics of altrenogest in horses we conducted an elimination study. Five oral doses of 44 mug/kg altrenogest were administered to 10 horses at a dose interval of 24 h. Following administration blood and urine samples were collected at appropriate intervals. Altrenogest concentr...
Garré B, van der Meulen K, Nugent J, Neyts J, Croubels S, De Backer P, Nauwynck H.Equine herpesvirus 1 (EHV-1) is an important equine pathogen that causes respiratory disease, abortion, neonatal death and paralysis. Although vaccines are available, they are not fully protective and outbreaks of disease may occur in vaccinated herds. Therefore, there is an urgent need for effective antiviral treatment. For three abortigenic (94P247, 97P70 and 99P96) and three neuropathogenic isolates (97P82, 99P136 and 03P37), the effect of acyclovir, ganciclovir, cidofovir, adefovir, 9-(2-phosphonylmethoxyethyl)-2,6-diaminopurine (PMEDAP) and foscarnet on plaque number was studied. Addition...
Anderson ME, Weese JS.Screening for nasal colonization is an important aspect of many methicillin-resistant Staphylococcus aureus (MRSA) control programs. Real-time polymerase chain reaction (RT-PCR) is an attractive alternative to standard culture techniques because of the considerably shorter turnaround time. An assay has been validated for diagnostic purposes in humans, however this methodology has not been evaluated in horses. The purpose of this study was to compare an RT-PCR assay for rapid identification of MRSA directly from nasal swabs in horses to standard culture techniques. Nasal swabs collected from 29...
Panasophonkul S, Lohachit C, Sirivaidyapong S.To study the postpartum ovarian activities for investigation of first postpartum oestrus, twenty-five Thai crossbred native mares were monitored after parturition by oestrous detection, transrectal palpation and reproductive ultrasonography. Blood samplings were also taken for estradiol-17beta (E2) analysis. The first ovulation occurred within 20 days postpartum in 92% (23/25) of the mares. The mean intervals of foaling to first oestrus and to first ovulation were 10.3 +/- 2.9 and 13.4 +/- 2.6 days (mean +/- SD) respectively. Serum E2 increased from 7.0 +/- 2.9 to a peak of 10.8 +/- 3.3 pg/ml ...
Caston SS, McClure SR, Martens RJ, Chaffin MK, Miles KG, Griffith RW, Cohen ND.This study evaluated the prophylactic effectiveness of hyperimmune plasma (HIP) as an aid in the prevention of pneumonia caused by experimental infection with Rhodococcus equi. Thirty neonatal foals were administered R. equi HIP or saline at 2 days of age and were infected with virulent R. equi at 7 days. All foals developed signs or symptoms of respiratory disease. Radiographic scores on day 28 and neutrophil concentrations on day 49 were significantly greater in control foals, and time to respiratory effort score of 2 or higher was significantly shorter for control foals. Three foals, all in...
Hedenström UO, Olsson U, Holm AW, Wattle OS.It has not yet been shown that ossification of ungular cartilages (OUC) is a pathological condition. Beside heredity, factors such as sex, age, repeated concussion, local trauma, hoof and body size have been suggested as contributing factors for OUC development. By comparing radiographs of front hooves from cold-blooded trotters with different age we wanted to evaluate when development of OUC in cold-blooded trotters occurs and if and when it stabilizes in relation to age and workload. Diagnosis and grading of OUC were based on radiological field examinations of 649 Swedish and Norwegian cold-...
Fuller CJ, Barr AR, Dieppe PA.An explant system was used to investigate the hypothesis that cartilage from different equine joints might respond differently to challenge with interleukin-1alpha (IL-1alpha). Pairs of normal cartilage samples were taken from the metacarpophalangeal, proximal interphalangeal and distal interphalangeal joints of six horses. One of each pair was stimulated with 10 ng/ml human recombinant IL-1alpha for three days, and the supernatants and remaining cartilage explants were analysed for their total content of glycosaminoglycans. A significantly higher percentage of glycosaminoglycans was released ...
Rivas VN, Aleman M, Peterson JA, Dahlgren AR, Hales EN, Finno CJ.Juvenile idiopathic epilepsy (JIE) is an inherited disease characterized by recurrent seizures during the first year of life in Egyptian Arabian horses. Definitive diagnosis requires an electroencephalogram (EEG) performed by a veterinary specialist. A recent study has suggested that a 19 base-pair deletion, along with a triple-C insertion, in intron five of twelve (∆19InsCCC; chr20:29542397-29542425: GTTCAGGGGACCACATGGCTCTCTATAGA>TATCTTAAGACCC) of the () gene is associated with JIE. To confirm this association, a new sample set consisting of nine EEG-phenotyped affected and nine unaffec...
Bailey RE, Dyson SJ, Parkin TD.The aims of this study were to establish the frequency of occurrence, intensity and symmetry of focal increased radiopharmaceutical uptake in the dorsoproximal aspect of the diaphysis of the proximal phalanx; to determine if this focal increased radiopharmaceutical uptake was related to age, height, gender, breed, bodyweight, or discipline of the horse, and if there was any relationship with lameness. Scintigraphic images from 690 horses were analyzed subjectively and objectively. Age, breed, discipline, height, weight, gender, and lame limb(s) or reasons for presentation were recorded for all...
Turner AS, Yovich JV, White NA, Embertson RE, Santschi EM, Slone DE.A retrospective study was performed to evaluate the healing of ventral midline abdominal incisions, closed with a simple continuous suture pattern using absorbable suture material, in 139 horses and foals. Dehiscence and incisional hernia developed separately in two horses. The low incidence of dehiscence and incisional hernia, compared with their reported incidence following the use of interrupted suture repair, leads the authors to recommend this alternative method of abdominal incision closure in horses. The security of closure is not sacrificed and the advantages of a rapid closure are des...
Enders F, Weber A.Fecal samples of 146 horses were culturally investigated for occurrence of Prototheca spp. using a selective medium, developed by PORE (1973). Prototheca zopfii could be isolated in monoculture from 9 fecal samples (6.2%). The results of this pilot study show that horses too can harbour and shed Prototheca spp. in variable frequency.
Unt VE, Evans J, Reed SR, Pfau T, Weller R.Conformation in horses is often considered an indicator of athletic ability, performance and resistance to orthopaedic disease. Evaluation is performed in the standing horse and repeatability influenced by stance. Ground reaction forces increase in the moving horse as speed increases. Objective: To determine the effect of locomotion on equine carpus, tarsus, metacarpophalangeal (MCP) and metatarsophalangeal (MTP) joints in the frontal plane. Objective: Valgus/varus angulation will change when moving. Methods: Kinematic data were collected standing, walking and trotting for 2 groups of horses. ...
Beard WL, Robertson JT, Leeth B.Congenital frontal sinus cysts were found bilaterally in the frontal sinuses of a one-year-old miniature horse. Diagnosis was based on radiography of the head and cytologic examination of tissue aspirated from the frontal sinuses. The cysts were surgically removed, using a hinged bone flap technique bilaterally over the frontal sinuses.
van Veggel ECS, Selberg KT, van der Velde-Hoogelander B, Vanderperren K, Cokelaere SM, Bergman HJ. To describe the MRI findings for 13 horses with deep digital flexor tendon (DDFT) injury at the proximal phalanx where the tendon goes from ovoid to bilobed in frontlimbs with tendon sheath distension. In addition, the prognosis of this lesion was assessed. Retrospective case series. Thirteen client-owned horses. Medical records were reviewed, and data were collected regarding signalment, history, MRI findings, and outcomes of horses. Findings of MRI were recorded and whether the case was confirmed with tenoscopy. A diagnosis of DDFT injury at the junction between ovoid and bilobed portio...
Lemes KM, Silva LA, Alonso MA, Celeghini ECC, Pugliesi G, Carvalho HF, Affonso FJ, Silva DF, Leite TG, de Arruda RP.Follicular development and deviation processes during the postpartum period are not completely known in horses. Thus, we aimed to study the characteristics of follicular dynamics and ovarian vascular perfusion during the postpartum period in mares that demonstrated estrous behavior and had early ( 0.1) was detected between the groups when the data were normalized for the days preceding the first postpartum ovulation (from D-7 to D-1). However, when the data were normalized to days postpartum, the dominant follicle was larger (P 25 mm diameter was greater (P 0.1) was detected between grou...
Nichols JL, Robinson JS, Hiney KM, Terry R, Ramsey JW.This study investigated equine nutrition knowledge and educational needs of licensed veterinarians in the United States who were exclusively or predominately equine practitioners. It found veterinarians regard their peers as an important resource of nutritional knowledge, ranking ahead of all other sources except a PhD equine nutritionist. Interestingly, only 21% of veterinarians felt good about their knowledge level in equine nutrition after graduating from veterinary school. Although veterinarians in this study reported equine nutrition to be an area of weakness, 75% had not pursued continui...
Fourie LJ, Kok DJ, Krugel L, Snyman A, Van Der Lingen F.Karoo paralysis, caused by feeding Ixodes rubicundus females, is a major disease of small stock in South Africa. Control methods currently practised are almost exclusively chemical based. To limit overdependance on chemicals, vegetation management was investigated as a possible method for control, to be incorporated in an integrated tick management system. Laboratory and field experiments were conducted to determine, firstly, the extent of vertical migration and survival of ticks on long and short copper rods which simulated grasses as questing substrates; secondly, the infestation burdens of ...
Campbell TM, Studdert MJ, Ellis WM, Paton CM.A foal with primary severe combined immunodeficiency, diagnosed within the first two weeks of life, was maintained with its dam in semi-isolation. The foal received continuous prophylactic antibiotic therapy, plasma from a sibling hyperimmunised with equine adenovirus vaccine, and intensive general nursing care. A full sibling female was selected as a bone marrow donor on the basis of red blood cell cross-matching and mixed lymphocyte reactions. Cyclophosphamide was given before two bone marrow transfusions at 35 and 73 days of age. To prevent graft versus host disease graft versus host diseas...
Lloyd S.Between 30 and 70 per cent of horses at 18 stables had their anthelmintic treatments withdrawn for a year. Three of the stables (group 1) had used no anthelmintics for many years, 10 (group 2) had treated their horses with anthelmintics approximately twice a year, and five (group 3) had used anthelmintics five to seven times a year. A total of 1068 samples of faeces were collected from the 267 untreated horses and faecal egg counts were carried out four times during the year. Overall 50.2 per cent of the samples contained less than 200 epg. When the four counts from individual horses were coll...
Kalsow CM, Dwyer AE, Smith AW, Nifong TP.Although experimental models of autoimmune uveitis predict pinealitis coincident with uveitis, there is no direct evidence of pineal pathology accompanying a human uveitis. Horses with naturally occurring uveitis are a potential source of eye and pineal tissues that are not available from human patients with active uveitis. We have observed pinealitis in a mare with equine recurrent uveitis. By immunohistochemistry we demonstrated immunoglobulin and MHC Class II antigen on infiltrating and resident cells of eye and pineal gland. These results support the relevance of the animal models and sugg...
Cirak VY, Güleğen E, Yildirim F, Durmaz M.The aim of the present study was to determine the efficacy and the so-called "egg reappearance period" (ERP) of doramectin in horses naturally infected with strongyles during a period of 34 weeks. A group of yearlings of 10 animals was treated intramuscularly with doramectin at a dose rate of 0.2 mg/kg bodyweight (BW) at the begin of the grazing season. To obtain comparable data, another group of yearlings (n = 10) was treated orally with ivermectin at a dose rate of 0.2 mg/kg BW. Individual faecal samples were examined for strongyle egg counts per gram of faeces (EPG) in two-week intervals. T...
Patil DB, Adamiak Z, Piórek A.The present review informs about the current status regarding use of interlocking nailing for fracture repair in animals. The clinical limitations of interlocking nailing and its subsequent improvement by evolving novel nail design or supplementation with type I ESF using hybrid nail bolt/ESF pin has been dealt. The biomechanical and clinical evaluation of novel interlocking nail supplements and its possible clinical use is included.
Zerpa H, Berhane Y, Elliott J, Bailey SR.The vasculature of the equine digit fulfils an important role in thermoregulation. In other species, it has been found that cooling may enhance the response of cutaneous vessels to 5-hydroxytryptamine (5-HT) and alpha(2)-adrenoceptor agonists. Translocation of alpha(2)-adrenoceptors to the smooth muscle cell membrane, mediated by Rho kinase, is thought to be involved in the cooling-enhanced response in mouse tail arteries. However, little is known about the effect of cooling on 5-HT receptor function. The present investigation compared the response of 5-bromo-6-(2-imidazolin-2-ylamino) quinoxa...
Krook L, Whalen JP, Lesser GV, Berens DL.Nutritional secondary hyperparathyroidism (NSH) defines a spontaneous and experimental disease in most domesticated and in some wild animals, caused by dietary calcium deficiency and/or phosphorus excess. Calcium deficiency results directly in hypocalcemia, and phosphorus excess induces hyperphosphatemia which causes hypocalcemia. Secondary hyperparathyroidism thus results and the plasma parameters return to normal and are maintained but only at the expense of progressive bone loss. The bone loss is generalized but the bones are not uniformly affected. The hierarchy of bone loss is, in decreas...
Arfuso F, Giannetto C, Giudice E, Fazio F, Piccione G.The physiological role of L-carnitine in equine species is worthy of investigation; however, the systemic content of free L-carnitine and its dynamic change in growing foals as well as in exercising horses are still poorly investigated. In this study, the influence of age and exercise on free serum L-carnitine levels was evaluated in equine species. Ten foals were monitored from 6 up to 18 months of age (group 1), whereas 60 horses were divided in six groups in accordance with their age: group 2, 2-year-old; group 3, 3-year-old; group 4, 4-year-old; group 5, 5-year-old; group 6, 6-year-old; g...
Kotze SH, Van Aswegen G.The ileocaecal junctions of 5 horses and 2 donkeys were examined by using antisera to the following peptides: somatostatin, glucagon, gastrin, neurotensin, vasoactive intestinal peptide (VIP), peptide histidine isoleucine (PHI), calcitonin gene-related peptide (CGRP), substance P (SP) and neuropeptide Y (NPY). Antisera to somatostatin, neurotensin and NPY demonstrated endocrine cells in the ileal- and caecal parts of the ileocaecal junction, while immunoreactivity for glucagon was demonstrated in endocrine cells of the ileal part only. Nerve cell bodies showing immunoreactivity to SP, VIP, CGR...
Vostry L, Vostra-Vydrova H, Citek J, Gorjanc G, Curik I.Inbreeding depression is the reduction of performance caused by mating of close relatives. In livestock populations, inbreeding depression has been traditionally estimated by regression of phenotypes on pedigree inbreeding coefficients. This estimation can be improved by utilising genomic inbreeding coefficients. Here we estimate inbreeding depression for insect bite hypersensitivity (IBH) prevalence, the most common allergic horse disease worldwide, in Old Kladruber horse. In a deep pedigree with 3214 horses (187 genotyped), we used a generalised linear mixed model with IBH phenotype from 558...
Fjordbakk CT, Kenney DG, Rodriguez-Palacios A, Keller S, Stalker M.An inflammatory aural polyp was identified in a 1-year-old standardbred filly, which presented with otorrhea and head rubbing. The polyp was removed by traction-avulsion, and the filly showed no subsequent signs of otorrhea. Aural polyps have not been reported in horses, but they are commonly seen in companion animals and humans. Un polype auditif inflammatoire a été identifié chez une pouliche Standardbred d’un an présentée pour otorrhée et frottage de tête. Le polype a été retiré par traction-avulsion et la pouliche n’a pas manifesté de signes subséquents d’otorrhée. Les ...
Bony S, Durix A, Leblond A, Jaussaud P.The toxicokinetics of ergovaline (an ergopeptine mycotoxin present in some grasses infected with endophytic fungus of the genus Neotyphodium) were studied after intravenous administration of a single dose of 15 microg/kg bwt in four gelding horses. Plasma ergovaline concentrations were measured by high performance liquid chromatography, and the kinetic data were described by a three-compartment model. The elimination half-life and the total clearance of ergovaline were found to be 56.83 +/- 13.48 min and 0.020 +/- 0.004 L/min x kg, respectively. According to the toxicological data previously r...
