Analyze Diet

Topic:DNA

DNA in horses refers to the genetic material that carries the hereditary information necessary for the growth, development, functioning, and reproduction of equine species. It consists of sequences of nucleotides that encode the genetic instructions used in the development and functioning of horses. DNA analysis in horses can provide insights into genetic diversity, lineage, and breed characteristics. It is also utilized in identifying genetic disorders, understanding hereditary traits, and assisting in selective breeding programs. This page compiles peer-reviewed research studies and scholarly articles that explore the structure, function, and applications of DNA analysis in equine genetics and breeding.
First report of zoonotic Cryptosporidium parvum GP60 subtypes IIaA15G2R1 and IIaA16G3R1 in wild ponies from the northern Iberian Peninsula.
Parasitology research    November 22, 2019   Volume 119, Issue 1 249-254 doi: 10.1007/s00436-019-06529-x
Couso-Pérez S, de Limia FB, Ares-Mazás E, Gómez-Couso H.Studies on the prevalence and molecular characterization of Cryptosporidium spp. affecting feral horses are scarce. The highland areas of the northern Iberian Peninsula are home to a large population of wild ponies which generally roam free in the ancient natural range and are subjected to a traditional exploitation regime. In the present study, a total of 79 non-diarrhoeal faecal samples from the wild ponies were collected from the ground immediately after defecation. Cryptosporidium was detected in 10 of the samples (12.6%) by a direct immunofluorescence antibody test and DNA amplification a...
Changes of sires in a breeding farm enables maintenance of DNA-level genetic variation in a produced herd of Hokkaido Native Horses.
Animal science journal = Nihon chikusan Gakkaiho    November 21, 2019   Volume 91, Issue 1 e13318 doi: 10.1111/asj.13318
Amano T, Tozaki T, Takasu M, Onogi A, Yamada F, Kawai M, Ueda J.We investigated whether regular changes of the sire in a breeding farm of Hokkaido Native Horses (HKDs) enables the DNA-level genetic variation of the produced animals to be maintained. The genotypes of 31 microsatellite markers were identified and analyzed in 207 animals produced in a breeding farm in which the sire was replaced every 3 to 5 years. The mean allele number indicating the degree of genetic variation was 5.97 and was similar to those reported previously. The mean observed heterozygosity was 0.74 and was higher than the expected heterozygosity, 0.69; F was -0.07, indicating that ...
Isolation and identification of an isoflavone reducing bacterium from feces from a pregnant horse.
PloS one    November 18, 2019   Volume 14, Issue 11 e0223503 doi: 10.1371/journal.pone.0223503
Jinglong X, Xiaobin L, Fang Z, Chenchen W, Kailun Y.The aim of this research was to isolate bacteria capable of biotransforming daidzein from fresh feces from pregnant horses. A Hungate anaerobic roller tube was used for anaerobic culture. Single colonies were picked at random and incubated with daidzein. High performance liquid chromatography was used to detect whether the isolated bacteria were able to biotransform the substrate. A strain capable of reducing daidzein was selected and characterized using sequence analysis of 16S rDNA, and a phylogenetic tree was constructed. The morphological physiological and biochemical characteristics of th...
Leptin Receptor Gene Polymorphisms in Some Turkish Donkey Populations.
Journal of equine veterinary science    November 16, 2019   Volume 84 102823 doi: 10.1016/j.jevs.2019.102823
Işık R, Özdil F.Leptin receptor is a fundamental regulator in physiological functions of the regulation of food intake, energy homeostasis, immune function, and reproduction as well as on ovarian follicular cells on the placenta and lactating mammary glands. The aim of this study was to investigate the LEPR gene polymorphism in 60 donkeys reared in Thrace region of Turkey. A 585 bp long partial intron 6, exon 7, intron 7, and exon 8 regions of LEPR gene were amplified, and polymerase chain reaction products analyzed via DNA sequencing. A novel single-nucleotide polymorphism (SNP) was identified as g.713668A>...
Molecular characterization in the toll-like receptor 9 gene of Cape Mountain Zebra (Equus zebra zebra) from three populations.
Infection, genetics and evolution : journal of molecular epidemiology and evolutionary genetics in infectious diseases    November 14, 2019   Volume 78 104118 doi: 10.1016/j.meegid.2019.104118
Smith RM, Kotzé A, Grobler JP, Dalton DL.Toll-like receptors (TLR) are a family of proteins that signal activation of the innate immune response through the recognition of a variety of pathogen molecular compounds. Here, we characterized the complete TLR9 gene in Cape mountain zebra (Equus zebra zebra) from three populations in South Africa and compared sequences to a variety of horse and donkey breeds. Overall, we identified six single nucleotide polymorpHisms (SNPs). A single SNP (G586S) was non-synonymous, whereas the remaining SNPs were synonymous. The G586S alteration was detected in Cape mountain zebra populations with varying ...
First Report Regarding the Simultaneous Molecular Detection of Anaplasma marginale and Theileria annulata in Equine Blood Samples Collected from Southern Punjab in Pakistan.
Acta parasitologica    November 13, 2019   Volume 65, Issue 1 259-263 doi: 10.2478/s11686-019-00141-w
Asif M, Parveen A, Ashraf S, Hussain M, Aktas M, Ozubek S, Shaikh RS, Iqbal F.The present study was designed to check the molecular detection of Anaplasma marginale and Theileria annulata in blood samples of horses and donkeys collected from Dera Ghazi Khan District in Punjab and to document their phylogenetic origin and their association with studied epidemiological factors (sex and age) and complete blood count parameters, if any. Results: A total of 195 blood samples were collected from apparently healthy horses (N = 141) and donkeys (N = 54). A. marginale DNA was detected by PCR in 4.9% (7/141) horse and in 9.2% (5/54) of donkey blood samples. Prevalence of ...
Prevalence of the Mutations Responsible for Glanzmann Thrombasthenia in Horses in Brazil.
Animals : an open access journal from MDPI    November 13, 2019   Volume 9, Issue 11 doi: 10.3390/ani9110960
Leite RO, Ferreira JF, Araújo CET, Delfiol DJZ, Takahira RK, Borges AS, Oliveira-Filho JP.Glanzmann's thrombasthenia (GT) is an autosomal recessive inherited disorder characterized by changes in platelet aggregation, leading to hemorrhage and epistaxis. To date, two independent mutations have been described in horses and associated with this disorder, a point mutation (c.122G > C) and a 10-base-pair deletion (g.1456_1466del) in the Integrin subunit alpha2β gene (ITGA2B) of horses of different breeds (Quarter Horse, Thoroughbred, Oldenburg, and Peruvian Paso). ITGA2B codifies the αIIb subunit of the αIIbβ3 integrin, also termed platelet fibrinogen receptor. Horses with GT have b...
Establishment and application of a 10-plex liquid bead array for the simultaneous rapid detection of animal species.
Journal of the science of food and agriculture    November 6, 2019   Volume 100, Issue 1 325-334 doi: 10.1002/jsfa.10042
Mei M, Chen R, Gao X, Cao Y, Weng W, Duan Y, Tan X, Liu Z.Meat fraud and adulteration incidents occur frequently in almost all regions of the globe, especially with the increase in the world's population. To ensure the authenticity of meat products, we developed a 10-plex xMAP assay to simultaneously detect ten animal materials: bovine, caprine, poultry, swine, donkey, deer, horse, dog, fox and mink. Results: This method was investigated by analyzing DNA extracts from raw muscle, muscle mixtures, meat products and animal feeds. Our results indicated that the species of interest can be identified, differentiated and detected down to 1 g kg in bina...
CENP-A binding domains and recombination patterns in horse spermatocytes.
Scientific reports    November 1, 2019   Volume 9, Issue 1 15800 doi: 10.1038/s41598-019-52153-1
Centromeres exert an inhibitory effect on meiotic recombination, but the possible contribution of satellite DNA to this "centromere effect" is under debate. In the horse, satellite DNA is present at all centromeres with the exception of the one from chromosome 11. This organization of centromeres allowed us to investigate the role of satellite DNA on recombination suppression in horse spermatocytes at the stage of pachytene. To this aim we analysed the distribution of the MLH1 protein, marker of recombination foci, relative to CENP-A, marker of centromeric function. We demonstrated that the sa...
Application of embryo biopsy and sex determination via polymerase chain reaction in a commercial equine embryo transfer program in Argentina.
Reproduction, fertility, and development    October 28, 2019   Volume 31, Issue 12 1917-1925 doi: 10.1071/RD19228
Riera FL, Roldán JE, Espinosa JM, Fernandez JE, Ortiz I, Hinrichs K.Embryo biopsy for fetal sexing has clinical application, but few reports are available of its use within an active embryo transfer program. We evaluated results on biopsy of 459 embryos over one breeding season. There were no significant differences in pregnancy rate between biopsied and non-biopsied embryos (72% vs 73%) or for biopsied embryos recovered at the centre (73%) compared with those shipped overnight (72%). However, the pregnancy rate decreased significantly in shipped embryos biopsied ≥20h after collection. Overall, 86% of biopsies provided a sex diagnosis. The likelihood of a po...
Paving the way for more precise diagnosis of EcPV2-associated equine penile lesions.
BMC veterinary research    October 22, 2019   Volume 15, Issue 1 356 doi: 10.1186/s12917-019-2097-0
Ramsauer AS, Wachoski-Dark GL, Fraefel C, Tobler K, Brandt S, Knight CG, Favrot C, Grest P.There is growing evidence that equine papillomavirus type 2 (EcPV2) infection is causally associated with the development of equine genital squamous cell carcinomas (SCCs). Early stages of disease present clinically as plaques or wart-like lesions which can gradually progress to tumoural lesions. Histologically these lesions are inconsistently described as benign hyperplasia, papilloma, penile intraepithelial neoplasia (PIN), carcinoma in situ (CIS) or SCC. Guidelines for histological classification of early SCC precursor lesions are not precisely defined, leading to potential misdiagnosis. Th...
Telomere regulation: lessons learnt from mice and men, potential opportunities in horses.
Animal genetics    October 21, 2019   Volume 51, Issue 1 3-13 doi: 10.1111/age.12870
Denham J.Telomeres are genetically conserved nucleoprotein complexes located at the ends of chromosomes that preserve genomic stability. In large mammals, somatic cell telomeres shorten with age, owing to the end replication problem and lack of telomere-lengthening events (e.g. telomerase and ALT activity). Therefore, telomere length reflects cellular replicative reserve and mitotic potential. Environmental insults can accelerate telomere attrition in response to cell division and DNA damage. As such, telomere shortening is considered one of the major hallmarks of ageing. Much effort has been dedicate...
Relationship between DNA fragmentation of equine granulosa cells and oocyte meiotic competence after in vitro maturation.
Reproduction in domestic animals = Zuchthygiene    October 19, 2019   Volume 54 Suppl 4 78-81 doi: 10.1111/rda.13514
Pereira B, Dorado J, Diaz-Jimenez M, Consuegra C, Ortiz I, Gosalvez J, Hidalgo M.The acquisition of equine oocyte developmental capacity is ensured by the follicular environment, such as granulosa cells, which could reflect the meiotic development potential of immature oocytes. This study evaluated the relationship between DNA fragmentation of granulosa cells, using the chromatin dispersion test, and equine oocyte meiotic development after in vitro maturation. Granulosa cells and cumulus-oocytes complexes (n = 50) were recovered from slaughterhouse-derived ovaries. Oocytes were in vitro matured, stained and evaluated under fluorescence microscopy. Maturation rates were c...
Frameshift Variant in MFSD12 Explains the Mushroom Coat Color Dilution in Shetland Ponies.
Genes    October 19, 2019   Volume 10, Issue 10 826 doi: 10.3390/genes10100826
Tanaka J, Leeb T, Rushton J, Famula TR, Mack M, Jagannathan V, Flury C, Bachmann I, Eberth J, McDonnell SM, Penedo MCT, Bellone RR.Mushroom is a unique coat color phenotype in Shetland Ponies characterized by the dilution of the chestnut coat color to a sepia tone and is hypothesized to be a recessive trait. A genome wide association study (GWAS), utilizing the Affymetrix 670K array (MNEc670k) and a single locus mixed linear model analysis (EMMAX), identified a locus on ECA7 for further investigation ( = 2.08 × 10). This locus contained a 3 Mb run of homozygosity in the 12 mushroom ponies tested. Analysis of high throughput Illumina sequencing data from one mushroom Shetland pony compared to 87 genomes from horses of var...
Effects of Different Freezing Protocols on Motility, Viability, Mitochondrial Membrane Potential, Intracellular Calcium Level, and DNA Integrity of Cryopreserved Equine Epididymal Sperm.
Journal of equine veterinary science    October 17, 2019   Volume 82 102801 doi: 10.1016/j.jevs.2019.102801
Neuhauser S, Bollwein H, Siuda M, Handler J.The aim of the present study was to evaluate the effect of different freezing procedures on sperm motion, viability, the acrosome status, mitochondrial membrane potential (MMP), intracellular calcium content, and DNA integrity on epididymal stallion sperm. Therefore, the sperm of 10 healthy stallions was harvested by retrograde flushing after testectomy, diluted with a semen extender containing defined milk proteins and a freezing extender containing egg yolk and glycerol and frozen according to 4 different protocols, using a programmable freezer and a floating rack performing a slow (processe...
TRIM39-RPP21 Variants (∆19InsCCC) Are Not Associated with Juvenile Idiopathic Epilepsy in Egyptian Arabian Horses.
Genes    October 16, 2019   Volume 10, Issue 10 816 doi: 10.3390/genes10100816
Rivas VN, Aleman M, Peterson JA, Dahlgren AR, Hales EN, Finno CJ.Juvenile idiopathic epilepsy (JIE) is an inherited disease characterized by recurrent seizures during the first year of life in Egyptian Arabian horses. Definitive diagnosis requires an electroencephalogram (EEG) performed by a veterinary specialist. A recent study has suggested that a 19 base-pair deletion, along with a triple-C insertion, in intron five of twelve (∆19InsCCC; chr20:29542397-29542425: GTTCAGGGGACCACATGGCTCTCTATAGA>TATCTTAAGACCC) of the () gene is associated with JIE. To confirm this association, a new sample set consisting of nine EEG-phenotyped affected and nine unaffec...
Warmblood fragile foal syndrome type 1 mutation (PLOD1 c.2032G>A) is not associated with catastrophic breakdown and has a low allele frequency in the Thoroughbred breed.
Equine veterinary journal    October 4, 2019   Volume 52, Issue 3 411-414 doi: 10.1111/evj.13182
Bellone RR, Ocampo NR, Hughes SS, Le V, Arthur R, Finno CJ, Penedo MCT.Catastrophic fractures are among the most common cause of fatalities in racehorses. Several factors, including genetics, likely contribute to increased risk for fatal injuries. A variant in the procollagen-lysine, 2-oxoglutarate 5-dioxygenase1 gene (PLOD1 c.2032G>A) was shown to cause Warmblood fragile foal syndrome type 1 (WFFS), a fatal recessive defect of the connective tissue. Screening of multiple horse breeds identified the presence of the WFFS allele in the Thoroughbred. PLOD1 is involved in cross-linking of collagen fibrils and thus could potentially increase the risk of catastrophic b...
Extended-spectrum β-lactamase-producing Escherichia coli isolated from healthy Thoroughbred racehorses in Japan.
Journal of equine science    October 2, 2019   Volume 30, Issue 3 47-53 doi: 10.1294/jes.30.47
Sukmawinata E, Sato W, Mitoma S, Kanda T, Kusano K, Kambayashi Y, Sato T, Ishikawa Y, Goto Y, Uemura R, Sueyoshi M.Extended-spectrum β-lactamase-producing Escherichia coli (ESBLEC) have become a major health concern in both human and veterinary medicine. These bacteria could become a critical problem in equine medicine due to the limited number of antimicrobial drugs available. However, there are no previous reports of ESBLEC isolated from horses in Japan. The objectives of this study were to investigate the occurrence of ESBLEC isolated from feces in healthy Thoroughbred racehorses in Japan. Feces samples were collected from 147 healthy Thoroughbred racehorses by equine veterinarians at the Japan Racing ...
Ten years of the horse reference genome: insights into equine biology, domestication and population dynamics in the post-genome era.
Animal genetics    September 30, 2019   Volume 50, Issue 6 569-597 doi: 10.1111/age.12857
Raudsepp T, Finno CJ, Bellone RR, Petersen JL.The horse reference genome from the Thoroughbred mare Twilight has been available for a decade and, together with advances in genomics technologies, has led to unparalleled developments in equine genomics. At the core of this progress is the continuing improvement of the quality, contiguity and completeness of the reference genome, and its functional annotation. Recent achievements include the release of the next version of the reference genome (EquCab3.0) and generation of a reference sequence for the Y chromosome. Horse satellite-free centromeres provide unique models for mammalian centromer...
Genetic parameters and estimated breeding values for traits of raw and frozen-thawed semen in German Warmblood stallions.
Animal reproduction science    September 23, 2019   Volume 210 106194 doi: 10.1016/j.anireprosci.2019.106194
Greiser T, Sieme H, Martinsson G, Distl O.Objectives of the present study were to estimate genetic parameters for frozen-thawed semen traits of 271 fertile German Warmblood stallions and genetic correlations with raw semen quality traits. Semen samples were collected from stallions utilized for semen collection and artificial insemination (AI) on the Lower Saxon National Stud Celle and the North Rhine-Westphalian National Stud Warendorf. Semen quality variables were analyzed in 63,972 raw (gel-free volume, concentration, progressive motility, number of sperm) and 3681 frozen-thawed samples (motility, DNA fragmentation index (DFI), non...
Combined addition of superoxide dismutase, catalase and glutathione peroxidase improves quality of cooled stored stallion semen.
Animal reproduction science    September 23, 2019   Volume 210 106195 doi: 10.1016/j.anireprosci.2019.106195
Del Prete C, Stout T, Montagnaro S, Pagnini U, Uccello M, Florio P, Ciani F, Tafuri S, Palumbo V, Pasolini MP, Cocchia N, Henning H.During cold storage stallion spermatozoa experience undergo oxidative stress, which can impair sperm function and fertilizing capacity. Superoxide dismutase (SOD), catalase (CAT) and glutathione peroxidase (GPX) are the main endogenous enzymatic antioxidants in stallion seminal plasma, and counteract reactive oxygen species. Semen dilution reduces the endogenous antioxidant concentrations. The aim of this study was to investigate whether addition of 15 IU/mL each of SOD, CAT, and GPX to diluted stallion semen would ameliorate a reactive oxygen-mediated decrease in semen quality during 72 h o...
Complete Genome Sequence of Escherichia coli Podophage Penshu1.
Microbiology resource announcements    September 19, 2019   Volume 8, Issue 38 e01055-19 doi: 10.1128/MRA.01055-19
Pechacek D, Hwangbo M, Moreland R, Liu M, Ramsey J. 4s is a Gram-negative bacterium found in the equine intestinal ecosystem alongside diverse other coliform bacteria and bacteriophages. This announcement describes the complete genome of the T7-like 4s podophage Penshu1. From its 39,263-bp genome, 54 protein-encoding genes and a 179-bp terminal repeat were predicted.
Breed and stallion effects on frozen-thawed semen in warmblood, light and quarter horses.
Theriogenology    September 19, 2019   Volume 142 8-14 doi: 10.1016/j.theriogenology.2019.09.033
Greiser T, Sieme H, Martinsson G, Distl O.The objectives of the present study were to analyze systematic effects on semen quality traits from fresh and frozen-thawed semen collected in and outside season. A total of 4,681 reports on semen traits of 121 stallions representing Arabian, Thoroughbred, Quarter Horse and four warmblood breeds used for artificial insemination at the Lower Saxon National stud Celle were edited for analysis of gel-free volume, sperm concentration, total number of sperm and total number of motile sperm in fresh semen and in frozen-thawed semen progressive motility, DNA fragmentation index and non-viable sperm. ...
Effect of permeable cryoprotectant-free vitrification on DNA fragmentation of equine oocyte-cumulus cells.
Reproduction in domestic animals = Zuchthygiene    September 13, 2019   Volume 54 Suppl 3 53-56 doi: 10.1111/rda.13491
Pereira BC, Ortiz I, Dorado JM, Diaz-Jimenez MA, Consuegra C, Gosalvez J, Hidalgo M.DNA fragmentation of cumulus cells could be used as an indicator of oocyte vitrification success as an indirect indicator of the quality of the oocyte. This study was designed to compare the DNA fragmentation of post-mortem equine cumulus cells before or after vitrification in the absence of permeable cryoprotectant agents. Cumulus-oocyte complexes (COCs; n = 56) were recovered from slaughterhouse ovaries and subjected to in vitro maturation (42 hr/38.2°C/5%CO ) before (control group) or after a permeable cryoprotectant-free vitrification method using 1 M sucrose (vitrification group). Af...
Collagens and DNA methyltransferases in mare endometrosis.
Reproduction in domestic animals = Zuchthygiene    September 13, 2019   Volume 54 Suppl 3 46-52 doi: 10.1111/rda.13515
Alpoim-Moreira J, Fernandes C, Rebordão MR, Amaral A, Pinto-Bravo P, Bliebernicht M, Skarzynski DJ, Ferreira-Dias G.Inflammation and fibroproliferative diseases may be modulated by epigenetic changes. Therefore, we suggest that epigenetic mechanisms could be involved in equine endometrosis pathogenesis. DNA methylation is one of the methods to evaluate epigenetics, through the transcription of methyltransferases (DNMT1, DNMT3A, DNMT3B). The correlation between DNMTs and collagen (COL) transcripts was assessed for the different Kenney and Doig's (Current Therapy in Theriogenology. Philadelphia: WB Saunders; 1986) endometrium categories. Endometrial biopsies were randomly collected from cyclic mares. Histolog...
Erratum: Author Correction: Improved reference genome for the domestic horse increases assembly contiguity and composition.
Communications biology    September 11, 2019   Volume 2 342 doi: 10.1038/s42003-019-0591-3
Kalbfleisch TS, Rice ES, DePriest MS, Walenz BP, Hestand MS, Vermeesch JR, O'Connell BL, Fiddes IT, Vershinina AO, Saremi NF, Petersen JL, Finno CJ....[This corrects the article DOI: 10.1038/s42003-018-0199-z.].
Resiliency of equid H19 imprint to somatic cell reprogramming by oocyte nuclear transfer and genetically induced pluripotency†.
Biology of reproduction    September 11, 2019   Volume 102, Issue 1 211-219 doi: 10.1093/biolre/ioz168
Poirier M, Smith OE, Therrien J, Rigoglio NN, Miglino MA, Silva LA, Meirelles FV, Smith LC.Cell reprogramming by somatic cell nuclear transfer and in induced pluripotent stem cells is associated with epigenetic modifications that are often incompatible with embryonic development and differentiation. For instance, aberrant DNA methylation patterns of the differentially methylated region and biallelic expression of H19-/IGF2-imprinted gene locus have been associated with abnormal growth of fetuses and placenta in several mammalian species. However, cloned horses are born with normal sizes and with no apparent placental anomalies, suggesting that H19/IGF2 imprinting may be epigenetical...
Equine fetal genotyping via aspiration of yolk-sac fluid at 22-28 days of gestation.
Theriogenology    September 8, 2019   Volume 142 34-40 doi: 10.1016/j.theriogenology.2019.09.012
Ripley AM, Penedo MCT, Grahn RA, Martinez de Andino EV, Walbornn SR, Serafini R, Love CC, Hinrichs K.Fetal genotyping has important applications in the horse, but currently necessitates embryo recovery and biopsy. We investigated whether fetal genotyping could be performed on yolk-sac fluid recovered from pregnant mares via transvaginal aspiration. Fluid was collected before Day 30 to provide results before establishment of the endometrial cups (Day 37). Genotyping and assessment of maternal DNA contamination was performed by analyzing histograms of PCR results for 19 loci. In Exp. 1, mares underwent yolk-sac aspiration on Days 22-28 of gestation. Fluid (0.56-1.02 mL) was recovered from fiv...
A novel 13-plex STR typing system for individual identification and parentage testing of donkeys (Equus asinus).
Equine veterinary journal    September 5, 2019   Volume 52, Issue 2 290-297 doi: 10.1111/evj.13158
Dang W, Shang S, Zhang X, Yu Y, Irwin DM, Wang Z, Zhang S.Previous studies investigating donkey parentage and genetic diversity used horse-specific multiplex systems. However, several mis-allele and null-allele issues were found with some of the horse primers when used in donkeys. In 2017, the International Society for Animal Genetics (ISAG) recommended 13 dinucleotide short tandem repeats (STRs) (AHT4, ASB23, HMS2, HMS3, HMS6, HMS7, HMS18, HTG7, HTG10, TKY297, TKY312, TKY337 and TKY343) as a core panel that should be used to identify individuals and to test for parentage in donkeys. To date, no single multiplex STR typing system containing all 13 do...
A novel PCR protocol for detection and differentiation of neuropathogenic and non-neuropathogenic equid alphaherpesvirus 1. Lechmann J, Schoster A, Ernstberger M, Fouché N, Fraefel C, Bachofen C.Equid alphaherpesvirus 1 (EHV-1) infections can have a major impact on the horse industry and equine welfare by causing abortion or respiratory or neurologic disease. A single nucleotide polymorphism (A→G) in open reading frame (ORF) 30, encoding the catalytic subunit of the DNA polymerase, has been shown to be a strong predictive marker for neuropathogenicity. Given that a previously established real-time PCR (rtPCR) protocol yielded unsatisfactory results concerning determination of the EHV-1 genotype, we developed and evaluated a new conventional PCR protocol enabling identification of th...
1 22 23 24 25 26 87