Epidemiology in horses involves the study of the distribution and determinants of health-related states and events in equine populations. It encompasses the investigation of patterns, causes, and effects of diseases and health conditions within horse populations. This field of study aims to identify risk factors for disease and targets for preventive healthcare. Key components of equine epidemiology include disease surveillance, outbreak investigation, and the study of disease dynamics within herds or regions. Research in this area often focuses on infectious diseases, zoonotic diseases, and the impact of environmental factors on equine health. This page compiles peer-reviewed research studies and scholarly articles that explore various aspects of epidemiology in horses, including disease prevalence, transmission pathways, and strategies for disease prevention and control.
Lord CC, Venter GJ, Mellor PS, Paweska JT, Woolhouse ME.African horse sickness (AHS) and equine encephalosis (EE) viruses are endemic to southern Africa. AHS virus causes severe epidemics when introduced to naive equine populations, resulting in severe restrictions on the movement of equines between AHS-positive and negative countries. Recent zoning of South Africa has created an AHS-free zone to facilitate equine movement, but the transmission dynamics of these viruses are not fully understood. Here, we present further analyses of serosurveys of donkeys in South Africa conducted in 1983-5 and in 1993-5. Age-prevalence data are used to derive estim...
Jones PJ, Field WE.The Amish and other Old Order Anabaptists have been inseparably linked with agriculture since coming to America. However few efforts have been identified which analyze the issues involved with Old Order Anabaptist farm injuries or present best practices for addressing these problems. As part of an effort to develop culturally appropriate and effective injury prevention strategies for use within the Old Order Anabaptist community, this article identifies important cultural issues that should be considered in understanding and attempting to reduce farm injures in this population, summarizes stat...
Nell A, James SA, Bond CJ, Hunt B, Herrtage ME.This study aimed to investigate the distribution of Malassezia species yeasts on the skin of healthy horses. Acetate tape samples were obtained from the lip, axilla, interbulbar region, groin and anus of 12 healthy horses. The samples were stained and examined microscopically and sites harbouring yeast-like organisms were identified. Contact plates were applied to the skin at these sites and cultured at 26 degrees C and 32 degrees C. No growth was obtained on horse blood, Sabouraud's dextrose or modified Dixon's agar. A pure growth of a Malassezia-type organism was obtained on Sabouraud's dext...
Nagase N, Sasaki A, Yamashita K, Shimizu A, Wakita Y, Kitai S, Kawano J.From April 1999 to December 2000, a survey was made on the distribution of Staphylococcus species on the skin of 7 kinds of animals and humans. Staphylococci were isolated from 12 (100%) of 12 pigs, 17 (89.5%) of 19 horses, 30 (100%) of 30 cows, 73 (90.1%) of 81 chickens, 10 (40%) of 25 dogs, 23 (76.7%) of 30 laboratory mice, 20 (52.6%) of 38 pigeons, and 80 (88.9%) of 90 human beings. The predominant staphylococci isolated from a variety of animal species were novobiocin-resistant species, S. xylosus and S. sciuri regardless of the animal host species. The novobiocin-resistant species includi...
Earle CG, Kington HA, Coles GC.A telephone survey was conducted of the methods used to control parasitic worms at 106 thoroughbred training yards. Most of the horses were allowed access to grass and were therefore at risk of infection. The control methods relied primarily on the use of anthelmintics and appeared reasonably successful because only 44 per cent of trainers reported observing clinical signs of nematode infections. They dosed their horses frequently, 40 per cent treating every four to six weeks and 25 per cent treating every seven to eight weeks. New arrivals on yards were usually treated with anthelmintic but t...
Bunning ML, Bowen RA, Cropp CB, Sullivan KG, Davis BS, Komar N, Godsey MS, Baker D, Hettler DL, Holmes DA, Biggerstaff BJ, Mitchell CJ.A total of 12 horses of different breeds and ages were infected with West Nile virus (WNV) via the bites of infected Aedes albopictus mosquitoes. Half the horses were infected with a viral isolate from the brain of a horse (BC787), and half were infected with an isolate from crow brain (NY99-6625); both were NY99 isolates. Postinfection, uninfected female Ae. albopictus fed on eight of the infected horses. In the first trial, Nt antibody titers reached >1:320, 1:20, 1:160, and 1:80 for horses 1 to 4, respectively. In the second trial, the seven horses with subclinical infections developed Nt a...
Butcher MT, Ashley-Ross MA.Fetlock joint kinematics during galloping in 2-, 3-, 4-, and 5-year-old Thoroughbreds in race training were quantified to determine if differences due to age could account for the observation that 2-year old Thoroughbred racehorses incur a high number of injuries to the bones and soft tissues in the distal forelimbs during training and at the outset of racing. Twelve Thoroughbred racehorses were videotaped in the sagittal plane at 250 frames/s during their daily galloping workout on a 7/8 mile sand-surface training track. Four galloping strides were recorded for each horse and subsequently dig...
Dauphin G, Legay V, Pitel PH, Zientara S.For over two centuries, Borna disease (BD) has been described as a sporadically occurring infectious meningoencephalomyelitis affecting horses and sheep in Central Europe. Over the last decade, the BD epidemiology has been discussed. Firstly, its geographical distribution seems larger than what was previously thought. Secondly, the disease can affect a large number of warm-blooded animal species, including humans. The aetiological agent is the Boma disease virus (BDV), an enveloped, nonsegmented negative-stranded RNA virus classified in the new virus family Bornaviridae (Mononegavirales order)...
McDole MG, Gay JM.A case-control study of the association between the presence of serum antibodies against Neospora spp. and fetal loss was performed on serum samples submitted to a veterinary diagnostic laboratory in northwestern United States. Control sera were randomly selected from those submitted from healthy horses for routine equine infectious anemia testing required for regulatory health certification. Case sera were randomly selected from those submitted from aborting mares for diagnostic workup. Based on a 1:50 or greater titer on the indirect fluorescent antibody test, 8% of the 160 control sera and ...
Gunsen U, Yaroglu T.Aflatoxin levels were determined by ELISA in 18 dog and 20 horse feed samples, collected from different firms from June 2000 to June 2001 in Turkey. The minimum and maximum levels of total aflatoxin in the dog and horse feeds were <1.75-20 microg/kg and <1.75-14 microg/kg, respectively; 3/18 dog feed samples (16.7%) and 2/20 horse feed samples (10%) exceeded the Turkish tolerance limit of 10 microg/kg in food or feed.
Palombo EA.Rotaviruses are the major cause of severe gastroenteritis in young children and animals. The rotavirus genome is composed of eleven segments of double-stranded RNA and can undergo genetic reassortment during mixed infections, leading to progeny viruses with novel or atypical phenotypes. There are numerous descriptions of rotavirus strains isolated from human and animals that share genetic and antigenic features of viruses from heterologous species. In many cases, genetic analysis by hybridization has clearly demonstrated the genetic relatedness of gene segments to those from viruses isolated f...
Franklin RP, Kinde H, Jay MT, Kramer LD, Green EG, Chiles RE, Ostlund E, Husted S, Smith J, Parker MD.A yearling quarter horse, which was raised in southern California, received routine vaccinations for prevention of infection by Eastern equine encephalomyelitis virus (EEEV). One week later, severe neurologic signs developed, and the horse was humanely destroyed. A vaccine-related encephalomyelitis was later suspected. A final diagnosis of EEEV infection was established on the basis of acute onset of the neurologic signs, histopathologic and serologic testing, and isolation and molecular characterization of EEEV from brain tissue. The vaccine was extensively tested for viral inactivation. Nucl...
Kaaden OR, Eichhorn W, Essbauer S.There is continual variation in viral epidemics regarding clinical symptoms, duration and disappearance, and the emergence of new diseases. This can be observed in both human and animal diseases. This evolution of virus diseases is mainly related to three factors: aetiological agent, host and environment. As far as genetic alterations of the virus are concerned, two major mechanisms are involved: mutations such as recombination and reassortment; and selection for resistance or susceptibility. This review focuses on the epidemiology of newly emerged virus diseases in man and animals, such as ac...
van Duijkeren E, Wannet WJ, Heck ME, van Pelt W, Sloet van Oldruitenborgh-Oosterbaan MM, Smit JA, Houwers DJ.We studied 232 Salmonella strains from horses with salmonellosis in The Netherlands, isolated in the period from 1993 to 2000 in order to provide insight in the dynamics of sero-, phage types (pt) and antibiotic susceptibilities over time. The strains were tested for susceptibility to seven antimicrobial agents using the agar diffusion method. In addition, the isolates were sero typed and Salmonella enterica subspecies enterica Typhimurium and Enteritidis strains were further phage typed. S. Typhimurium strains of phage type 506 and 401 (both classified as DT 104 in the English phage typing sy...
Yilmaz H, Helps CR, Turan N, Uysal A, Harbour DA.The nucleoprotein of Borna disease virus (BDV-p40) was produced in a Baculovirus expression system using sf9 cells. The purity and specificity of the recombinant p40 was confirmed by SDS-PAGE and immunoblotting. The recombinant p40 was used in an ELISA to screen horse sera in Turkey. For this, 323 horses from selected cities in the Marmara region of Turkey were examined clinically and serum was collected from each. All horses were clinically healthy except for a few with wounds on the skin. Antibodies to BDV were detected in the sera of 82 (25%) of 323 horse sera. Six sera were selected that h...
Marsh AE, Hyun C, Barr BC, Tindall R, Lakritz J.Equine protozoal myeloencephalitis (EPM), caused by a protozoal parasite infection of the central nervous system, is the most commonly diagnosed neurologic disease of horses in North America. In specific regions of the United States approximately 50% of the horse population is seropositive to Sarcocystis neurona. However, not all seropositive horses develop clinical signs. Detailed clinical examination, along with cerebrospinal fluid antibody evaluation are often used to diagnose EPM. Postmortem evaluation of the brain stem and spinal cord for histopathologic lesions compatible with nonsuppura...
Labruna MB, Kasai N, Ferreira F, Faccini JL, Gennari SM.Natural tick infestations were assessed every 14 days on horses over a 2-year period. Amblyomma cajennense adult ticks were counted individually, without detachment from the horses. Larvae and nymphs of A. cajennense were collected using a rubber scraper that scratched engorged immature ticks from the host. Adult females of Anocentor nitens larger than 4mm length were counted on the horses. Blood samples were also obtained from the horses every 14 days and macroclimatic data were obtained for the study period. Infestations of A. cajennense demonstrated distinct peaks of activity for each of th...
Bjöersdorff A, Bagert B, Massung RF, Gusa A, Eliasson I.We report the isolation and partial genetic characterization of two equine strains of granulocytic Ehrlichia of the genogroup Ehrlichia phagocytophila. Frozen whole-blood samples from two Swedish horses with laboratory-verified granulocytic ehrlichiosis were inoculated into HL-60 cell cultures. Granulocytic Ehrlichia was isolated and propagated from both horses. DNA extracts from the respective strains were amplified by PCR using primers directed towards the 16S rRNA gene, the groESL heat shock operon gene, and the ank gene. The amplified gene fragments were sequenced and compared to known seq...
Butterwick DJ, Meeuwisse WH.To document injury rates, severity, and relative risk during five competitive seasons of Canadian professional rodeo, between experienced (saddle bronc [SB], bareback [BB], and bull riders [BR]) and inexperienced (novice saddle bronc [NSB], novice bareback [NBB], and boys' steer riders [BSR]) rough stock competitors. Methods: Prospective cohort study. Methods: Canadian professional rodeo competition. Methods: Experienced competitors included professional cowboys from Australia, Brazil, New Zealand, the United States, and Canada. Inexperienced competitors included cowboys from Canada and the Un...
Boucher C, Higgins R, Nadeau M, Vincent C.A sexagenarian couple operating a dairy farm, where there were also many horses, suffered a severe respiratory infection associated with the bacterium Streptococcus equi ssp. zooepidemicus. The investigation revealed that the source of infection was due to contacts with a horse having an infected wound from which we isolated this zoonotic agent. A sexagenarian couple operating a dairy farm, where there were also many horses, suffered a severe respiratory infection associated with the bacterium Streptococcus equi ssp. zooepidemicus. The investigation revealed that the source of infection was du...
Lucchesi PM, Parma AE, Arroyo GH.Horses infected with Leptospira present several clinical disorders, one of them being recurrent uveitis. A common endpoint of equine recurrent uveitis is blindness. Serovar pomona has often been incriminated, although others have also been reported. An antigenic relationship between this bacterium and equine cornea has been described in previous studies. A leptospiral DNA fragment that encodes cross-reacting epitopes was previously cloned and expressed in Escherichia coli. Results: A region of that DNA fragment was subcloned and sequenced. Samples of leptospiral DNA from several sources were a...
Holland AJ, Roy GT, Goh V, Ross FI, Keneally JP, Cass DT.To identify the frequency, spectrum and outcome of horse-related injuries in children. Methods: Retrospective case series of horse-related injuries in children admitted to the Children's Hospital at Westmead (CHW) from January 1988 to December 1999, the John Hunter Children's Hospital (JHCH) from January 1991 to December 1997 and deaths reported to the New South Wales Paediatric Trauma Death (NPTD) Registry from January 1988 to December 1999. Methods: Circumstances of injury; helmet use; adult supervision; type and number of injuries identified. Results: 232 children were admitted with horse-r...
Mott J, Muramatsu Y, Seaton E, Martin C, Reed S, Rikihisa Y.Upon ingestion of adult aquatic insects, horses developed clinical signs of Potomac horse fever, and Neorickettsia risticii was isolated from the blood. 16S rRNA and 51-kDa antigen gene sequences from blood, isolates, and caddis flies fed to the horses were identical, proving oral transmission of N. risticii from caddis flies to horses.
Morris LH, Allen WR.The findings of a retrospective survey of 1393 Thoroughbred mares visiting 22 studfarms in the Newmarket region of the UK during the 1998 mating season were compared with those of a similar study undertaken in 1983. The effects of mare age and status, stallion, month of mating, application of uterine treatments and other parameters on the rates of singleton and twin conception and subsequent pregnancy losses were analysed. Mare age and status significantly affected the per cycle pregnancy rate and the incidence of pregnancy loss. Overall, the mean number of matings per oestrus was 1.12 and the...
Walmsley JP, Pettersson H, Winberg F, McEvoy F.The surgical treatment of impingement of dorsal spinous processes (DSPs) at 2 equine veterinary hospitals following a similar diagnostic and surgical protocol is described with special reference to the diagnosis and case selection. The diagnosis was made from clinical examination and results of radiography and diagnostic analgesia of the affected sites. Scintigraphy was also used as an aid to diagnosis at one hospital. Surgical treatment was generally recommended when conservative treatment, which included 3-9 months rest, intralesional corticosteroids and physiotherapy, had failed. The DSPs w...
Laing JA, Leech FB.In a group of 852 Thoroughbred mares, 69-7% had foals which survived beyond 6 weeks, 7-1% had dead, premature or full-term foals and 1-1% had foals which died within 6 weeks after birth. Possible factors which may have influenced these data are mentioned.
Carnet F, Perrin-Cocon L, Paillot R, Lotteau V, Pronost S, Vidalain PO.Vaccination is one of the most widely used strategies to protect horses against pathogens. However, available equine vaccines often have limitations, as they do not always provide effective, long-term protection and booster injections are often required. In addition, research efforts are needed to develop effective vaccines against emerging equine pathogens. In this review, we provide an inventory of approved adjuvants for equine vaccines worldwide, and discuss their composition and mode of action when available. A wide range of adjuvants are used in marketed vaccines for horses, the main fami...
Mackenzie RM, de Siger J, Parra D.Two strains of Venezuelan equine encephalitis (VEE) virus were examined for the ability to replicate in, as well as to produce death among donkeys. One, a low passage strain known as strain P676 was originally isolated from mosquitos in Venezuela. The other, strain V-38 was isolated from a horse brain in 1938 and had undergone an unknown number of laboratory passages; it is used extensively for the preparation of inactivated VEE vaccine. Both strains were found to be approximately equal in their ability to infect donkeys. However, a quantity as small as 50% hamster intraperitoneal infectious u...
Gawor JJ.Autopsies and analyses of faecal samples from working horses have shown common occurrence of ascarids in foals, whereas 19.6% of adult horses have been found infected. No influence of season on EPG in adult horses has been found. Study based on faecal samples from stud horses has shown that 5-6-month old animals were most susceptible to the infection. 50% of foals have been found infected in spite of deworming with the use of bezimidazole compounds. It has been stated that the proper dose of an anthelminthic is a basic problem in the control of ascarids.
Bauerfeind R, Wieler LH, Weiss R, Baljer G.From April 1990 through June 1991 clinical salmonellosis and asymptomatic faecal excretion of Salmonella spp. were seen in hospitalized horses at two veterinary hospitals. 76 Salmonella strains from hospitalized horses and 18 strains from horses without any clinical contact were characterized by serotyping and plasmid profile analysis. From April 1990 through January 1991 97.8% of the hospitalized horses were infected with strains of S. typhimurium var. Copenhagen, which were closely related according to their similar plasmid patterns. Other strains of S. typhimurium var. Copenhagen and seroty...
Feder HM, Nelson RS, Cartter ML, Sadre I.A survey was performed to identify people who were exposed to a rabid pony and determine whether or not they received rabies postexposure prophylaxis (PEP). Sixty-one visitors who came in contact with the rabid pony were identified. These visitors heard about the rabid pony via the news media. Forty-five visitors were exposed during the 2 weeks before the pony died. Thirty-two of these 45 visitors received PEP. Thirty-one visitors had or may have had saliva contact to an open wound or mucosa and all 31 received PEP. Fourteen visitors had no saliva contact to a wound or mucosa and one received ...
Cavalcante AL, Dias LM, Alves JT, Veras AA, Guimarães LC, Rocha FS, Gala-García A, Retamal P, Ramos RT, Azevedo V, Silva A, Carneiro AR.Corynebacterium pseudotuberculosis is related to several diseases infecting horses and small ruminants, causing economic losses to agribusiness. Here, we present the genome sequence of C. pseudotuberculosis strain E19. The genome includes one circular chromosome 2,367,956 bp (52.1% G+C content), with 2,112 genes predicted, 12 rRNAs, and 48 tRNAs.
Wilson G, Cooper K, Williams J, Eastwood S, Peake C.The 2007 equine influenza (EI) outbreak in New South Wales (NSW) consisted of a central infected area that extended south from the lower New England Tableland, across the Hunter Valley, Central Coast and the Sydney basin, and a series of isolated clusters outside this area across rural NSW. The central area was assigned the status of a Purple Zone (Special Restricted Area, SRA) approximately 1 month after the outbreak commenced. Within this SRA, the eradication program's focus was to increase the proportion of horses immune to EI via vaccination, thus reducing the susceptible proportion to a l...
Spyrou V, Papanastassopoulou M, Koumbati M, Nikolakaki SV, Koptopoulos G.Molecular analysis of the regulatory and structurally important genetic segments of equine infectious anemia virus (EIAV) in mules is presented. We have previously reported clinicopathological and laboratory findings in mules infected with EIAV, both naturally and after experimental inoculation. In this study the fragment coding for integrase, gp90, tat and the fusion domain of gp45 of the proviral genome from these animals was sequenced and compared with one another and with that of EIAV strains already published in the literature. Significant variations were observed mainly in the sequences ...
Tanaka K, Asai Y, Kuwano A.At 114 ranches in the Hidaka District of Hokkaido, a total of 1,118 Thoroughbred foals that were born from January to June 2003 were examined at different times from May to September of the same year to ascertain the occurrence of clubfoot. Clubfoot was seen in a total of 179 foals (16%) at 89 ranches (78%). Also, 124 of the 179 foals (69.3%) had clubfoot of grade II or higher, and it was found that grade I was likely to be overlooked or rapidly advance. In the present study, the occurrence of clubfoot was higher than expected in the investigated region. Hence, it is necessary to establish acc...
Rivas VN, Aleman M, Peterson JA, Dahlgren AR, Hales EN, Finno CJ.Juvenile idiopathic epilepsy (JIE) is an inherited disease characterized by recurrent seizures during the first year of life in Egyptian Arabian horses. Definitive diagnosis requires an electroencephalogram (EEG) performed by a veterinary specialist. A recent study has suggested that a 19 base-pair deletion, along with a triple-C insertion, in intron five of twelve (∆19InsCCC; chr20:29542397-29542425: GTTCAGGGGACCACATGGCTCTCTATAGA>TATCTTAAGACCC) of the () gene is associated with JIE. To confirm this association, a new sample set consisting of nine EEG-phenotyped affected and nine unaffec...
Enders F, Weber A.Fecal samples of 146 horses were culturally investigated for occurrence of Prototheca spp. using a selective medium, developed by PORE (1973). Prototheca zopfii could be isolated in monoculture from 9 fecal samples (6.2%). The results of this pilot study show that horses too can harbour and shed Prototheca spp. in variable frequency.
Gorucu S, Murphy DJ, Kassab C.The purpose of this study was to investigate characteristics associated with farm equipment and horse and buggy roadway crashes in relation to person, incident, and injury characteristics to identify appropriate points for injury incident prevention. Information on crashes occurring on public roads during the years 2010-2013 was obtained from the Pennsylvania Department of Transportation (PennDOT) and analyzed. There were 344 farm equipment and 246 horse and buggy crashes during the 4-year study period. These crashes involved 666 and 504 vehicles and 780 and 838 people, respectively. In incide...