Epidemiology in horses involves the study of the distribution and determinants of health-related states and events in equine populations. It encompasses the investigation of patterns, causes, and effects of diseases and health conditions within horse populations. This field of study aims to identify risk factors for disease and targets for preventive healthcare. Key components of equine epidemiology include disease surveillance, outbreak investigation, and the study of disease dynamics within herds or regions. Research in this area often focuses on infectious diseases, zoonotic diseases, and the impact of environmental factors on equine health. This page compiles peer-reviewed research studies and scholarly articles that explore various aspects of epidemiology in horses, including disease prevalence, transmission pathways, and strategies for disease prevention and control.
Pollard D, Wylie CE, Newton JR, Verheyen KLP.Euthanasia is a complex topic, with animal owners using multiple factors to shape their decision-making process. Previous epidemiological studies have described causes of equine mortality in specific populations, but there is limited evidence regarding factors contributing specifically to equine euthanasia in Great Britain (GB). This observational study used a prospective cohort design: the objectives were to describe owner-reported reasons for euthanasia, estimate the rate of euthanasia and identify associated factors in horses/ponies enrolled in a web-based epidemiological study of laminitis...
Barbosa Costa G, Marinho PES, Vilela APP, Saraiva-Silva AT, Crispim APC, Borges IA, Dutra AGS, Lobato ZIP, Dos Reis JKP, de Oliveira DB, Drumond BP....Saint Louis encephalitis virus (SLEV) is a mosquito-borne flavivirus that occurs throughout the Americas, and is considered a public health threat. In Brazil, SLEV has been detected from human cases associated with dengue-like disease, but no neurological symptoms were reported. Furthermore, the epidemiology of SLEV in human populations is still poorly explored in the country. We reported serological and molecular detection of SLEV in a healthy population of equids and humans from rural areas in Southeast Brazil. A plaque reduction neutralization test was applied, and neutralizing antibodies w...
Khalili M, Sakhaee E, Bagheri Amiri F, Safat AA, Afshar D, Esmaeili S.Leptospirosis is a neglected infectious zoonotic disease that affects domestic animals and wildlife as well as humans. Although leptospirosis is known as an endemic disease in Iran, there is no accurate information on the overall prevalence of this disease in humans and animals. The aim of this systematic review and meta-analysis was to estimate the seroprevalence of leptospirosis among human and domestic and wild animals in Iran. A systematic review of English and Persian articles (since 1998 to December 2017) was conducted using Google Scholar, Medline/PubMed, Science Direct, Scopus, Web of ...
Fougerolle S, Fortier C, Legrand L, Jourdan M, Marcillaud-Pitel C, Pronost S, Paillot R.Every year, several epizooties of equine influenza (EI) are reported worldwide. However, no EI case has been identified in France between 2015 and late 2018, despite an effective field surveillance of the pathogen and the disease. Vaccination against equine influenza virus (EIV) remains to this day one of the most effective methods to prevent or limit EI outbreaks and the lack of detection of the pathogen could be linked to vaccination coverage. The aim of this study was to evaluate EI immunity and vaccine coverage in France through a large-scale serological study. A total of 3004 archived sur...
Oladunni FS, Reedy S, Balasuriya UBR, Horohov DW, Chambers TM.Equine herpesvirus type 4 (EHV-4) is mildly pathogenic but is a common cause of respiratory disease in horses worldwide. We previously demonstrated that unlike EHV-1, EHV-4 is not a potent inducer of type-I IFN and does not suppress that IFN response, especially during late infection, when compared to EHV-1 infection in equine endothelial cells (EECs). Here, we investigated the impact of EHV-4 infection in EECs on type-I IFN signaling molecules at 3, 6, and 12 hpi. Findings from our study revealed that EHV-4 did not induce nor suppress TLR3 and TLR4 expression in EECs at all the studied time...
Aziz KJ, Al-Barwary LTO.Equine piroplasmosis is a major tick-borne disease that can lead to serious health problems and economic losses in horse industry. The aim of the study is to determine the prevalence of and in different species of Equus namely (Horse, mule, donkey and pony) by Giemsa stained blood films and competitive ELISA. Methods: This study was conducted at various geographic areas of Erbil governorate. A total of 349 blood samples from equine (209 horses, 62 mule, 57 donkey and 21 ponies) were collected to estimate the prevalence rate of and by using Giemsa stained blood smear and competitive ELISA. ...
Badenhorst M, de Heus P, Auer A, Rümenapf T, Tegtmeyer B, Kolodziejek J, Nowotny N, Steinmann E, Cavalleri JV.Prevalence studies have demonstrated a global distribution of equine hepacivirus (EqHV), a member of the family Flaviviridae. However, apart from a single case of vertical transmission, natural routes of EqHV transmission remain elusive. Many known flaviviruses are horizontally transmitted between hematophagous arthropods and vertebrate hosts. This study represents the first investigation of potential EqHV transmission by mosquitoes. More than 5000 mosquitoes were collected across Austria and analyzed for EqHV ribonucleic acid (RNA) by reverse transcription quantitative polymerase chain reacti...
Menezes RC, Campos MP, Popielarczyk M, Kiupel M.We report a new case of cutaneous leishmaniosis caused by Leishmania (Mundinia) martiniquensis in a horse in Florida, USA. A 10-year-old neutered male Quarter horse was presented with multifocal to coalescing, raised, ulcerated and oozing, non-healing wounds on both pinnae of several weeks' duration. After a few months, the lesions regressed spontaneously. Biopsies of the lesions were performed with microscopical findings of epidermal hyperplasia with multifocal ulceration and focally extensive, dermal pyogranulomatous inflammation with numerous intact and degenerate neutrophils being surround...
Porphyre T, Grewar JD.African horse sickness (AHS) is a disease of equids that results in a non-tariff barrier to the trade of live equids from affected countries. AHS is endemic in South Africa except for a controlled area in the Western Cape Province (WCP) where sporadic outbreaks have occurred in the past 2 decades. There is potential that the presence of zebra populations, thought to be the natural reservoir hosts for AHS, in the WCP could maintain AHS virus circulation in the area and act as a year-round source of infection for horses. However, it remains unclear whether the epidemiology or the ecological cond...
Escobar TA, Dowich G, Dos Santos TP, Zuravski L, Duarte CA, Lübeck I, Manfredini V.Leishmaniosis, zoonosis that produces significant public health impacts, is caused by Leishmania infantum. Canines are the main domestic reservoir and, besides humans, other species of mammals could be infected when living in endemic areas. In this study, we detected equine Leishmania infantum infections in a canine visceral leishmaniosis transmission area and evaluated the clinical, haematological, biochemical and oxidative stress disorders. This study was conducted in Uruguaiana, Rio Grande do Sul, south of Brazil. Peripheral blood samples were collected from 124 animals (98 horses and 26 do...
Schnabel CL, Babasyan S, Rollins A, Freer H, Wimer CL, Perkins GA, Raza F, Osterrieder N, Wagner B.Equine herpesvirus type 1 (EHV-1) outbreaks continue to occur despite widely used vaccination. Therefore, development of EHV-1 vaccines providing improved immunity and protection is ongoing. Here, an open reading frame 2 deletion mutant of the neuropathogenic EHV-1 strain Ab4 (Ab4ΔORF2) was tested as a vaccine candidate. Three groups of horses ( = 8 each) were infected intranasally with Ab4ΔORF2 or the parent Ab4 virus or were kept as noninfected controls. Horses infected with Ab4ΔORF2 had reduced fever and nasal virus shedding compared to those infected with Ab4 but mounted similar ada...
The UK has never experienced an outbreak of African horse sickness but, as Matthew Robin of the Fyrnwy Equine Clinic explains, there is still a risk of a case occurring.
Budiono NG, Satrija F, Ridwan Y, Handharyani E, Murtini S.Schistosomiasis is endemic in Indonesia and is found in three remote areas in Central Sulawesi Province. Non-human mammals serve as reservoir hosts, meaning the disease is zoonotic. The previous schistosomiasis studies in animals from the Lindu Subdistrict did not determine which domestic animal species can serve as the primary source of transmission. No animals have been treated in Indonesia to control the disease; therefore, the parasite's life cycle is not blocked entirely. This study aimed to determine the prevalence and identify the risk factors associated with, infection in animals, and...
Park J, Kim EB.The ecosystem of an animal farm is composed of various elements, such as animals, farmers, plants, feed, soil, and microorganisms. A domesticated animal's health is largely connected with the reservoir of bacteria and viruses in animal farms. Although a few studies have focused on exploring the gut microbiome of animals, communities of microbiota and viruses in feedlots have not been thoroughly investigated. Methods: Here, we collected feces and dust samples (4 groups: cattle feces, C_F; horse feces, H_F; cattle dust, C_D; and horse dust, H_D) from cattle and horse farms sharing the same housi...
Galinelli N, Wambacq W, Broeckx BJG, Hesta M.Equine gastric ulcer syndrome (EGUS) is a pathological condition affecting the glandular and squamous regions of the stomach. It is characterized by non-specific clinical signs, behavioural changes or can also be found without any overt clinical manifestations. Nutritional factors such as intermittent feeding, high sugars and starch intake, large amounts of straw as forage and prolonged time without access to forage have all been associated with an increased risk of equine squamous gastric disease (ESGD). The aim of this study was to investigate which nutritional practices are commonly seen in...
Dahmani M, Davoust B, Sambou M, Bassene H, Scandola P, Ameur T, Raoult D, Fenollar F, Mediannikov O.Our study aimed to assess the diversity of the species of Anaplasmataceae in Senegal that infect animals and ticks in three areas: near Keur Momar Sarr (northern region), Dielmo and Diop (Sine Saloum, central region of Senegal), and in Casamance (southern region of Senegal). Methods: A total of 204 ticks and 433 blood samples were collected from ruminants, horses, donkeys and dogs. Ticks were identified morphologically and by molecular characterization targeting the 12S rRNA gene. Molecular characterization of species of Anaplasmataceae infecting Senegalese ticks and animals was conducted usin...
Knight PK.This study analysed the race day veterinary reports from harness racing meetings controlled by the New South Wales Greyhound and Harness Racing Regulatory Authority between 1 September 2008 and 30 June 2009. The findings of all prerace and postrace examinations were analysed, and the frequency of observations was recorded. Chi-square testing was used to determine whether the incidence of abnormalities differed between age groups and tracks. A total of 542 meetings were conducted during the period of the study, with veterinary examinations conducted at 395 of these meetings. A total of 520 vete...
Li X, Ni HB, Ren WX, Jiang J, Gong QL, Zhang XX.Toxoplasmosis, one of the most common zoonoses worldwide, is caused by Toxoplasma gondii. T. gondii can infect almost all warm-blooded animals, including humans. Horses are an intermediate host of T. gondii, representing a potential risk for humans. To determine the T. gondii seroprevalence in horses worldwide, a global meta-analysis was conducted. A total of 35 publications were obtained by searching the PubMed, ScienceDirect, Chinese Web of knowledge (CNKI) and Wanfang databases. A total of 12,354 horses were assessed, of which 1580 were positive for T. gondii. The pooled overall seroprevale...
Meister TL, Tegtmeyer B, Brüggemann Y, Sieme H, Feige K, Todt D, Stang A, Cavalleri JV, Steinmann E.An equine parvovirus-hepatitis (EqPV-H) has been recently identified in association with equine serum hepatitis, also known as Theiler's disease. The disease was first described by Arnold Theiler in 1918 and is often observed with parenteral use of blood products in equines. However, natural ways of viral circulation and potential risk factors for transmission still remain unknown. In this study, we investigated the occurrence of EqPV-H infections in Thoroughbred horses in northern and western Germany and aimed to identify potential risk factors associated with viral infections. A total of 392...
Padalino B, Rosanowski SM, Di Bella C, Lacinio R, Rubino GTR.This study aimed to document the prevalence of chronic equine piroplasmosis (EP) in poorly performing Standardbred racehorses and to explore associations between the disease and sex, age, and hematological parameters. Blood was collected between 2004 and 2018; blood cell counts were performed using a cell counter analyzer, biochemical parameters using a photometer, and serum proteins using agarose gel electrophoresis. Blood smears were prepared, colored with a modified Giemsa, and an experienced technician identified the presence of protozoa. The horses were categorized into piroplasmosis posi...
Rivas VN, Aleman M, Peterson JA, Dahlgren AR, Hales EN, Finno CJ.Juvenile idiopathic epilepsy (JIE) is an inherited disease characterized by recurrent seizures during the first year of life in Egyptian Arabian horses. Definitive diagnosis requires an electroencephalogram (EEG) performed by a veterinary specialist. A recent study has suggested that a 19 base-pair deletion, along with a triple-C insertion, in intron five of twelve (∆19InsCCC; chr20:29542397-29542425: GTTCAGGGGACCACATGGCTCTCTATAGA>TATCTTAAGACCC) of the () gene is associated with JIE. To confirm this association, a new sample set consisting of nine EEG-phenotyped affected and nine unaffec...
Clark JM, Adanty K, Post A, Hoshizaki TB, Clissold J, McGoldrick A, Hill J, Annaidh AN, Gilchrist MD.Equestrian helmets are designed to pass certification standards based on linear drop tests onto rigid steel surfaces. However, concussions in equestrian sports occur most commonly when a rider is thrown off a horse and obliquely impacts a compliant surface such as turf or sand. This paper seeks to elucidate the mechanics of such impacts and thereby propose corresponding thresholds for the occurrence of concussion that can improve equestrian helmet standards and designs. Methods: The present study examined the biomechanics of real-world equestrian accidents and developed thresholds for the occu...
Yao C.The kinetoplastid protozoan Leishmania spp. cause leishmaniasis, which clinically exhibit mainly as a cutaneous, mucocutanous or visceral form depending upon the parasite species in humans. The disease is widespread geographically, leading to 20 000 annual deaths. Here, leishmaniases in both humans and animals, reservoirs and sand fly vectors on the Caribbean islands are reviewed. Autochthonous human infections by Leishmania spp. were found in the Dominican Republic, Guadeloupe and Martinique as well as Trinidad and Tobago; canine infections were found in St. Kitts and Grenada; and equine infe...
Nemoto M, Schofield W, Cullinane A.The objective of this study was to investigate the presence of equine coronavirus (ECoV) in clinical samples submitted to a diagnostic laboratory in Ireland. A total of 424 clinical samples were examined from equids with enteric disease in 24 Irish counties between 2011 and 2015. A real-time reverse transcription polymerase chain reaction was used to detect ECoV RNA. Nucleocapsid, spike and the region from the p4.7 to p12.7 genes of positive samples were sequenced, and sequence and phylogenetic analyses were conducted. Five samples (1.2%) collected in 2011 and 2013 tested positive for ECoV. Po...
Tozaki T, Kusano K, Ishikawa Y, Kushiro A, Nomura M, Kikuchi M, Kakoi H, Hirota K, Miyake T, Hill EW, Nagata S.Fractures are medical conditions that compromise the athletic potential of horses and/or the safety of jockeys. Therefore, the reduction of fracture risk is an important horse and human welfare issue. The present study used molecular genetic approaches to determine the effect of genetic risk for fracture at four candidate SNPs spanning the myostatin (MSTN) gene on horse chromosome 18. Among the 3706 Japanese Thoroughbred racehorses, 1089 (29.4%) had experienced fractures in their athletic life, indicating the common occurrence of this injury in Thoroughbreds. In the case/control association st...
Altan E, Li Y, Sabino-Santos G, Sawaswong V, Barnum S, Pusterla N, Deng X, Delwart E.Metagenomics was used to identify viral sequences in the plasma and CSF (cerobrospinal fluid) of 13 horses with unexplained neurological signs and in the plasma and respiratory swabs of 14 horses with unexplained respiratory signs. Equine hepacivirus and two copiparvoviruses (horse parvovirus-CSF and a novel parvovirus) were detected in plasma from neurological cases. Plasma from horses with respiratory signs contained the same two copiparvoviruses plus equine pegivirus D and respiratory swabs contained equine herpes virus 2 and 5. Based on genetic distances the novel copiparvovirus qualified ...
Spence KL, Cardwell JM, Slater J, Rosanowski SM.The potential for an exotic disease incursion is a significant concern for the United Kingdom (UK) equine industry. Horse owners' perceptions of, and attitudes towards, exotic diseases can influence decisions to adopt disease preparedness strategies. The objectives of this study were to describe horse owners' 1) perceptions of the term 'exotic disease', and 2) attitudes towards their risk of being affected by an exotic disease. In order to address these objectives, qualitative content analysis was undertaken on data collected using two open-ended survey questions. Results: Horse owners (n =â€...
Blanco-Lobo P, Rodriguez L, Reedy S, Oladunni FS, Nogales A, Murcia PR, Chambers TM, Martinez-Sobrido L.Vaccination remains the most effective approach for preventing and controlling equine influenza virus (EIV) in horses. However, the ongoing evolution of EIV has increased the genetic and antigenic differences between currently available vaccines and circulating strains, resulting in suboptimal vaccine efficacy. As recommended by the World Organization for Animal Health (OIE), the inclusion of representative strains from clade 1 and clade 2 Florida sublineages of EIV in vaccines may maximize the protection against presently circulating viral strains. In this study, we used reverse genetics tech...
Sheats MK, Davis KU, Poole JA.Farmers are routinely exposed to organic dusts and aeroallergens that can have adverse respiratory health effects including asthma. Horses are farm-reared large animals with similar exposures and can develop equine asthma syndrome (EAS). This review aims to compare the etiology, pathophysiology, and immunology of asthma in horses compared to farmers and highlights the horse as a potential translational animal model for organic dust-induced asthma in humans. Severe EAS shares many clinical and pathological features with various phenotypes of human asthma including allergic, non-allergic, late o...
Olitsky PK, Harford CG.Young (12 to 15 day old) mice are approximately as susceptible to the virus of equine encephalomyelitis, Eastern or Western strain, when it is given intraperitoneally as are adult mice when the virus is injected intracerebrally. With this susceptibility by the intraperitoneal route as a basis, the injection of immune serum-virus mixtures intraperitoneally was found to result in protection in dilutions which give rise to infection after intracerebral inoculation. The difference of protective power by the two indicated routes was shown not to depend on the amount of inoculum nor on the age of th...
Ivester KM, Smith K, Moore GE, Zimmerman NJ, Couëtilt LL.Exposure of horses to airborne particulates during stable confinement has been linked with airway inflammation in these animals. Understanding that link requires accurate measures of exposures and greater understanding of the sources of variability in these exposures. Objective: Area and breathing zone particulate concentrations were measured over time in order to determine the relative variability introduced by daily, monthly or between horse variations. Additionally, the relationship between area and breathing zone respirable particulate concentrations was examined. Methods: The study was co...
Tutluoglu B, AtiÅŸ S, Anakkaya AN, Altug E, Tosun GA, Yaman M.This study aimed to investigate the rate of occupational sensitization to horse hair in grooms and whether occupational exposure to horse hair increases respiratory and allergic symptoms and affects lung function in grooms or not. Methods: This is a cross-sectional study. Two hundred grooms were randomly selected among 1000 grooms working in Veliefendi Hippodrome of Istanbul. One hundred and twenty-five subjects agreed to enter the study. Ninety-two workers who worked in the different parts of this hippodrome enrolled as the control group. A detailed questionnaire including respiratory and all...
Gharekhani J, Yakhchali M, Berahmat R.Knowledge on neosporosis and associated risk factors in different species of animals are so important for designing the control programs and reduce the economic losses globally. This literature review targeted for evaluating the infection rate of in animals in Iran. Until April 2020, all of published documents in the main English and Persian-language databases were searched. A total number of 110 documents (English = 85 and Persian = 25) were extracted. Most of reports were sero-epidemiological studies using ELISA in Iranian cattle population. The range of infection was 3.8-76.2% in ...
Boxell AC, Gibson KT, Hobbs RP, Thompson RC.To assess the occurrence of gastrointestinal parasites in horses in Perth. To apply polymerase chain reaction (PCR) for the identification of some species of encysted larval cyathostomes. Methods: Between February and September of 2000, the gastrointestinal tracts of 29 horses submitted to a local knackery and Murdoch University Veterinary hospital in Perth were examined post mortem for the presence of gastrointestinal parasites. Methods: The gastrointestinal tract was divided into six sections, which were screened for the presence of parasites such as Gasterophilus sp, Anoplocephala sp and Pa...
Nilsson O, Ljungström BL, Höglund J, Lundquist H, Uggla A.Distal ileum, caecum and proximal colon of 470 horses were examined for helminths during 1 year at an abattoir in central Sweden. The infection levels of the horse tapeworm Anoplocephala perfoliata, their stage of development, site of attachment and gross pathological lesions caused by the worm were recorded. Faecal samples from 395 of the horses were examined specifically for tapeworm segments and eggs in order to correlate these findings with the numbers in the alimentary canal. In total 65% of the horses were infected with A. perfoliata and the mean intensity of infection was 79 worms per i...
Olivo G, Lucas TM, Borges AS, Silva RO, Lobato FC, Siqueira AK, da Silva Leite D, Brandão PE, Gregori F, de Oliveira-Filho JP, Takai S, Ribeiro MG.Diarrhea is a major clinical problem affecting foals up to 3 months of age. The aim of this study was to identify enteric microorganisms involved in monoinfections and coinfections and the associated virulence factors in healthy and diarrheic foals. Diarrheic (D) ( = 56) and nondiarrheic (ND) foals ( = 60) up to three months of age were studied. Fecal samples were analyzed for identification of infectious agents (microbiological culturing, molecular techniques, and microscopic analyses). (30% versus 25%), spp. (25% versus 7%), (25% versus 25%), type A (21% versus 10%), (20% versus 35%), ...
Bosh KA, Powell D, Shelton B, Zent W.To improve efficiency at the farm level, a better understanding of how farm management factors impact reproductive performance is important. Objective: To assess reproductive efficiency and effectiveness among Thoroughbred mares in central Kentucky. Methods: A cohort of 1011 mares on 13 farms in central Kentucky was followed during the 2004 mating and 2005 foaling season. Information on farm level practices was collected via interviews with farm managers. Reproductive records were collected for each mare mated to obtain information on mare characteristics. The influence of mare age and status ...
Rusnak JM, Glass PJ, Weaver SC, Sabourin CL, Glenn AM, Klimstra W, Badorrek CS, Nasar F, Ward LA.Licensure of a vaccine to protect against aerosolized Venezuelan equine encephalitis virus (VEEV) requires use of the U.S. Food and Drug Administration (FDA) Animal Rule to assess vaccine efficacy as human studies are not feasible or ethical. An approach to selecting VEEV challenge strains for use under the Animal Rule was developed, taking into account Department of Defense (DOD) vaccine requirements, FDA Animal Rule guidelines, strain availability, and lessons learned from the generation of filovirus challenge agents within the Filovirus Animal Nonclinical Group (FANG). Initial down-selectio...
Ataseven VS, Dağalp SB, Güzel M, Başaran Z, Tan MT, Geraghty B.In this report we examined the presence of specific antibodies against equine herpesvirus type 1 (EHV-1), and equine herpesvirus type 4 (EHV-4) in several equidae, including mules, donkeys, horses. The presence of EHV-1 and EHV-4 in respiratory diseases of equids, and ability of multiplex nested polymerase chain reaction (PCR) screening in simultaneous diagnosis of horses acutely infected by EHV-1 and EHV-4 were also investigated. Sera from 504 horses, mules and donkeys sampled were tested for the presence of EHV-1 and EHV-4 specific antibodies. Blood samples taken from 21 symptomatic horses a...
Narankhajid M, Yeruult C, Gurbadam A, Battsetseg J, Aberle SW, Bayartogtokh B, Joachim A, Duscher GG.Ticks are cosmopolitan vectors of numerous diseases, and detection of various pathogens in ticks can help to assess their distribution. In the current study, 528 adult ticks were collected from grazing animals or the ground in ten different Mongolian provinces. Dermacentor nuttalli constituted 76.1% of them and was found in all ecozones except the eastern desert. Dermacentor marginatus (8.3%), Dermacentor silvarum (1.1%) and Ixodes persulcatus (3.0%) were found in the northern forest areas and Hyalomma asiaticum (11.4%) only in the southern (semi-)desert. Of these, 359 ticks were subjected to ...
Matsuda M, Moore JE.In the present review article, recent molecular advances relating to studies with Taylorella equigenitalis, as well as the recently described second species of the genus Taylorella, namely Taylorella asinigenitalis, have been described. Molecular genotyping of T. equigenitalis strains by pulsed-field gel electrophoresis (PFGE) after digestion with the suitable restriction enzyme(s) enabled the effective discrimination of strains, thus allowing the examination of the scientific mechanism(s) for its occurrence and transmission of contagious equine metritis (CEM). Alternatively, polymerase chain ...
Bolfa P, Jeon I, Loftis A, Leslie T, Marchi S, Sithole F, Beck C, Lecollinet S, Zientara S, Hans A, Issel CJ.Equines in the West Indies are used for recreational purposes, tourism industry, racing and agriculture or can be found in feral populations. Little is known in the Caribbean basin about the prevalence of some major equine infectious diseases, some with zoonotic potential, listed as reportable by the OIE. Our objective was to study the prevalence of antibodies for West Nile Virus (WNV), Equine Herpes Virus-1 and 4 (EHV-1 and EHV-4), Equine Influenza (EI), Equine Viral Arteritis (EVA) and Equine Infectious Anemia Virus (EIAV) using a retrospective serological convenience study. We used 180 equi...
De Souza PN, Bomfim TC, Huber F, Abboud LC, Gomes RS.To detect Cryptosporidium sp., Giardia sp. and Eimeria leuckarti in horses, fecal samples were collected from three different handling horse groups from the state of Rio de Janeiro, Brazil. Group A was composed of "Mangalarga Marchador" pure breed horses, Group B was formed by horses of a Military Corporation and Group C by stray horses captured by the Center of Zoonosis Control Paulo Dacorso Filho. A total of 396 fecal samples were collected, 212 samples from Group A, 154 samples from Group B and 30 from Group C. The material was submitted to the centrifugation - flotation technique and stain...
Livesay GJ, O'Neill T, Hannant D, Yadav MP, Mumford JA.In July 1989 influenza A/equine-2 (H3N8) was isolated from a nasopharyngeal swab taken from a non-thoroughbred horse exhibiting acute clinical respiratory disease. This was the first isolation of equine influenza virus in the United Kingdom since 1981. Subsequent investigations of acute respiratory disease in horses indicated that the infection was dispersed throughout the UK. However, unlike the previous epidemic of 1979, the first horses from which the virus was isolated had been vaccinated. This outbreak of influenza provided an opportunity to evaluate an antigen capture ELISA, directed aga...
West Nile fever (WNF) is a viral disease of wild birds transmitted by mosquitoes. Humans and equids can also be affected and suffer from meningoencephalitis. In Algeria, since the 1994 epidemic, no data on WNV circulation was available until 2012. In September 2012, a fatal human case of WNV neuro-invasive infection occurred in Jijel province. This study describes the first seroprevalence study of West Nile virus (WNV) antibodies conducted in the equine population in Algeria. During 2014, serum samples were collected from 293 equids (222 donkeys and 71 horses) asymptomatic and unvaccinated for...
Velie BD, Knight PK, Thomson PC, Wade CM, Hamilton NA.Studies of Thoroughbred racing populations have provided evidence of a positive effect on racing careers for horses that commence racing as 2-year-olds. Currently, research investigating the presence of this effect in the Australian Thoroughbred racing population is limited. Objective: To investigate the association between age at first start and career length in the Australian Thoroughbred population and estimate the risk of racing retirement for horses racing in Australia based on age at first start, career earnings, number of starts as a 2-year-old and distance raced. Methods: Data were col...
Varcasia A, Garippa G, Pipia AP, Scala A, Brianti E, Giannetto S, Battelli G, Poglayen G, Micagni G.Between March 2003 and February 2007, the livers and the lungs of 2,231 horses from various Italian regions were examined for cystic echinococcosis presence at the time of slaughter. Hydatid cysts were found in six horses, namely four from Sardinia, one from Sicily, and one from Tuscany. The location, number, morphology, and fertility of the cysts found were determined. DNA was extracted from the germinal layers and protoscoleces of the fertile cysts and polymerase chain reactions (PCR) were performed in order to strain type DNA isolates for reduced nicotinamide adenine dinucleotide dehydrogen...
Hockenhull J, Creighton E.UK leisure horses are owned primarily for riding. Ridden behaviour problems may compromise the use of the horse in this role and lead to harsh redress or relinquishment of the horse. Despite the consequences of these problems little is known about their prevalence or the working lives of UK leisure horses. Objective: To generate data on the work undertaken by leisure horses, the equipment and training practices used with them and prevalence of ridden behaviour problems. Methods: An internet survey was used to generate horse-level data from a convenience sample of leisure horse carers. Responde...
Sumbria D, Das Singla L, Sharma A.A cross-sectional study was conducted in Submountain undulating, Undulating plain, Western and Western plain agro-climatic zones of Punjab province, India, to determine the prevalence, agreement between diagnostic tests and associated related risk factors of Theileria equi and Babesia caballi infection in equids (horses, donkey, mules). An overall prevalence of 14.14 and 0.0% of T. equi and B. caballi was recorded by multiplex polymerase chain reaction targeting 18S ribosomal RNA (rRNA) for both the parasites and 75 and 1.11% by competitive enzyme-linked immunosorbent assay in a representative...
Laabassi F, Lecouturier F, Amelot G, Gaudaire D, Mamache B, Laugier C, Legrand L, Zientara S, Hans A.An outbreak of equine influenza (EI) was reported in Algeria between May and July, 2011. The outbreak started in Tiaret, in west province of Algeria, and spread to the other parts of the country affecting almost 900 horses in many provinces. The population studied was composed of 325 horses from different groups of age. Clinical sign expression was age dependent. Indeed, a morbidity rate of 14.9% was observed in horses under 15Â months old and a rate of 4.95% in horses over 8Â years old. Interestingly, the morbidity rate raised sharply to reach 100% in horses aged between 18Â months and 7Â yea...
The Journal of parasitologyJanuary 23, 2003
Volume 88, Issue 6 1130-1134 doi: 10.1645/0022-3395(2002)088[1130:GHOPIL]2.0.CO;2
Chapman MR, French DD, Klei TR.A survey in Louisiana of gastrointestinal helminths recovered at necropsy from 117 ponies with minimal exposure to anthelmintics between 1989 and 2000 is compared with a survey conducted 20 yr earlier in the same region. An objective of this study was to determine whether species diversity has been affected by the advent and use of the macrocyclic lactone (ML) parasiticides and by the increased anthelmintic pressure on the helminth species infecting the general equine population. Twenty-six cyathostome species and 8 strongyle species were recovered. Two cyathostome species that were not found ...
Nemoto M, Tsunemitsu H, Imagawa H, Hata H, Higuchi T, Sato S, Orita Y, Sugita S, Bannai H, Tsujimura K, Yamanaka T, Kondo T, Matsumura T.Using a total of 2018 fecal samples collected between 2003 and 2008 from foals with diarrhea, the molecular epidemiology of group A equine rotaviruses circulating in Japan was investigated by the reverse transcription-polymerase chain reaction (RT-PCR) typing and sequence analysis of the VP4 (P type) and VP7 (G type) genes. A total of 1149 samples showed positive reactions with RT-PCR, of which 462 samples (40.2%) were positive for G3 type, 502 samples (43.7%) were positive for G14 type, and 185 samples (16.1%) were positive for both G3 and G14 types. To examine P types, 59 G3 and 56 G14 posit...
Brault SA, Bird BH, Balasuriya UB, MacLachlan NJ.Equine herpesvirus-2 (EHV-2) infection has been implicated as a cause of a variety of clinical disorders in young horses, including upper respiratory tract disease, generalized malaise, fever, pharyngeal lymphoid hyperplasia, and lymphadenopathy. Considerable sequence heterogeneity has been demonstrated previously among EHV-2 strains, and individual horses can be concurrently infected with more than one virus strain. In this study, the temporal variation of the viral load and genomic diversity of the glycoprotein B (gB) gene of EHV-2 in the nasal secretions of a cohort of foals was characteriz...
Shnaiderman-Torban A, Navon-Venezia S, Dor Z, Paitan Y, Arielly H, Ahmad WA, Kelmer G, Fulde M, Steinman A. We aimed to investigate the prevalence, molecular characteristics and risk factors of extended-spectrum β-lactamase (ESBL)-producing (ESBL-E) shedding in horses. A prospective study included three cohorts: (i) farm horses (13 farms, n = 192); (ii) on hospital admission (n = 168) and; (iii) horses hospitalized for ≥72 h re-sampled from cohort (ii) (n = 86). Enriched rectal swabs were plated, ESBL-production was confirmed (Clinical and Laboratory Standards Institute (CLSI)) and genes were identified (polymerase chain reaction (PCR)). Identification and antibiotic susceptibility were determi...
Glaser AL, de Vries AA, Rottier PJ, Horzinek MC, Colenbrander B.Sero-epidemiological surveys have revealed that equine arteritis virus (EAV) is prevalent in most European countries. The virus causes sporadic cases of respiratory disease and abortion in horses, the incidence of which has increased in recent years. Mares and geldings eliminate virus after acute infection, but 30% to 60% of stallions become persistently infected. In these animals, EAV is maintained within the reproductive tract and is shed continuously in the semen. Persistent infection with EAV in stallions has no negative consequences for fertility but mares inseminated with virus-contamina...
Henley WE, Rogers K, Harkins L, Wood JL.Survival analysis was used to assess risk factors for fatal injuries on UK race courses. This allowed assessment of variation due to temporal horse-level effects, including previous racing intensity and historical distribution of race types, as well as race-level factors. Comparisons were made between measuring survival time as number of days and as number of races to injury from the first race. Two related models were presented for time as number of races to injury: a Cox regression model fitted using partial likelihood, with the Efron approximation to handling ties, and a discrete-time logit...
Payne RC, Sukanto IP, Djauhari D, Partoutomo S, Wilson AJ, Jones TW, Boid R, Luckins AG.Cattle, buffaloes and horses in several areas of Indonesia were examined for evidence of infection with Trypanosoma evansi by the microhaematocrit centrifugation technique (MHCT) and an enzyme-linked immunosorbent assay (ELISA) for detection of antibodies to T. evansi. Evidence of infection was found in animals at each sampling site although differences were seen in prevalence rates between sites. Prevalence rates in buffalo were usually higher than in cattle in the same area while in horses they were much lower than in cattle or buffalo. An age-dependent prevalence rate was seen in buffalo an...
Bártová E, Sedlák K, Syrová M, Literák I.During January 2007, blood samples were collected from 552 healthy horses from nine different regions of the Czech Republic. Sera were tested for serum antibodies to Neospora caninum by a competitive-inhibition enzyme-linked immunosorbent assay and confirmed by an indirect fluorescent antibody test. The same samples were tested for serum antibodies against Toxoplasma gondii by a latex agglutination test. In total, 131 of 552 (24%) horses reacted positively for Neospora antibodies in competitive-inhibition enzyme-linked immunosorbent assay; seven of them had > or =50% of inhibition. Samples wer...