Analyze Diet

Topic:Genotyping

Genotyping in horses involves analyzing the genetic makeup of individual horses to identify specific genetic markers. This process aids in understanding genetic variations that may influence traits such as coat color, disease susceptibility, and performance capabilities. Genotyping can be used in breeding programs to select for desirable traits and manage genetic diversity within populations. Common methods for genotyping include single nucleotide polymorphism (SNP) analysis and microsatellite markers. This page compiles peer-reviewed research studies and scholarly articles that explore the methodologies, applications, and implications of genotyping in equine genetics and breeding.
Frameshift Variant in MFSD12 Explains the Mushroom Coat Color Dilution in Shetland Ponies.
Genes    October 19, 2019   Volume 10, Issue 10 826 doi: 10.3390/genes10100826
Tanaka J, Leeb T, Rushton J, Famula TR, Mack M, Jagannathan V, Flury C, Bachmann I, Eberth J, McDonnell SM, Penedo MCT, Bellone RR.Mushroom is a unique coat color phenotype in Shetland Ponies characterized by the dilution of the chestnut coat color to a sepia tone and is hypothesized to be a recessive trait. A genome wide association study (GWAS), utilizing the Affymetrix 670K array (MNEc670k) and a single locus mixed linear model analysis (EMMAX), identified a locus on ECA7 for further investigation ( = 2.08 × 10). This locus contained a 3 Mb run of homozygosity in the 12 mushroom ponies tested. Analysis of high throughput Illumina sequencing data from one mushroom Shetland pony compared to 87 genomes from horses of var...
Characterization of abortion, stillbirth and non-viable foals homozygous for the Warmblood Fragile Foal Syndrome.
Animal reproduction science    October 17, 2019   Volume 211 106202 doi: 10.1016/j.anireprosci.2019.106202
Aurich C, Müller-Herbst S, Reineking W, Müller E, Wohlsein P, Gunreben B, Aurich J.Warmblood fragile foal syndrome (WFFS) is a monogenetic defect with autosomal recessive inheritance. The WFFS homozygosity is non-compatible with extra-uterine life. Although as many as 15% of Warmblood horses are WFFS carriers, there has been little veterinary focus on this condition. The aim of this study was to determine outcomes and symptoms of clinical signs and pathological abnormalities during pregnancies when there were WFFS homozygous foetuses. Diagnostic material of 15 abortion or stillbirth cases with suspected diagnosis of WFFS was available for this study. Additionally, there were...
TRIM39-RPP21 Variants (∆19InsCCC) Are Not Associated with Juvenile Idiopathic Epilepsy in Egyptian Arabian Horses.
Genes    October 16, 2019   Volume 10, Issue 10 816 doi: 10.3390/genes10100816
Rivas VN, Aleman M, Peterson JA, Dahlgren AR, Hales EN, Finno CJ.Juvenile idiopathic epilepsy (JIE) is an inherited disease characterized by recurrent seizures during the first year of life in Egyptian Arabian horses. Definitive diagnosis requires an electroencephalogram (EEG) performed by a veterinary specialist. A recent study has suggested that a 19 base-pair deletion, along with a triple-C insertion, in intron five of twelve (∆19InsCCC; chr20:29542397-29542425: GTTCAGGGGACCACATGGCTCTCTATAGA>TATCTTAAGACCC) of the () gene is associated with JIE. To confirm this association, a new sample set consisting of nine EEG-phenotyped affected and nine unaffec...
A candidate-SNP retrospective cohort study for fracture risk in Japanese Thoroughbred racehorses.
Animal genetics    October 14, 2019   Volume 51, Issue 1 43-50 doi: 10.1111/age.12866
Tozaki T, Kusano K, Ishikawa Y, Kushiro A, Nomura M, Kikuchi M, Kakoi H, Hirota K, Miyake T, Hill EW, Nagata S.Fractures are medical conditions that compromise the athletic potential of horses and/or the safety of jockeys. Therefore, the reduction of fracture risk is an important horse and human welfare issue. The present study used molecular genetic approaches to determine the effect of genetic risk for fracture at four candidate SNPs spanning the myostatin (MSTN) gene on horse chromosome 18. Among the 3706 Japanese Thoroughbred racehorses, 1089 (29.4%) had experienced fractures in their athletic life, indicating the common occurrence of this injury in Thoroughbreds. In the case/control association st...
Molecular Surveillance of EHV-1 Strains Circulating in France during and after the Major 2009 Outbreak in Normandy Involving Respiratory Infection, Neurological Disorder, and Abortion.
Viruses    October 4, 2019   Volume 11, Issue 10 916 doi: 10.3390/v11100916
Sutton G, Garvey M, Cullinane A, Jourdan M, Fortier C, Moreau P, Foursin M, Gryspeerdt A, Maisonnier V, Marcillaud-Pitel C, Legrand L, Paillot R....Equine herpesvirus 1 (EHV-1) is an Alphaherpesvirus infecting not only horses but also other equid and non-equid mammals. It can cause respiratory distress, stillbirth and neonatal death, abortion, and neurological disease. The different forms of disease induced by EHV-1 infection can have dramatic consequences on the equine industry, and thus the virus represents a great challenge for the equine and scientific community. This report describes the progress of a major EHV-1 outbreak that took place in Normandy in 2009, during which the three forms of disease were observed. A collection of EHV-1...
Warmblood fragile foal syndrome type 1 mutation (PLOD1 c.2032G>A) is not associated with catastrophic breakdown and has a low allele frequency in the Thoroughbred breed.
Equine veterinary journal    October 4, 2019   Volume 52, Issue 3 411-414 doi: 10.1111/evj.13182
Bellone RR, Ocampo NR, Hughes SS, Le V, Arthur R, Finno CJ, Penedo MCT.Catastrophic fractures are among the most common cause of fatalities in racehorses. Several factors, including genetics, likely contribute to increased risk for fatal injuries. A variant in the procollagen-lysine, 2-oxoglutarate 5-dioxygenase1 gene (PLOD1 c.2032G>A) was shown to cause Warmblood fragile foal syndrome type 1 (WFFS), a fatal recessive defect of the connective tissue. Screening of multiple horse breeds identified the presence of the WFFS allele in the Thoroughbred. PLOD1 is involved in cross-linking of collagen fibrils and thus could potentially increase the risk of catastrophic b...
Ten years of the horse reference genome: insights into equine biology, domestication and population dynamics in the post-genome era.
Animal genetics    September 30, 2019   Volume 50, Issue 6 569-597 doi: 10.1111/age.12857
Raudsepp T, Finno CJ, Bellone RR, Petersen JL.The horse reference genome from the Thoroughbred mare Twilight has been available for a decade and, together with advances in genomics technologies, has led to unparalleled developments in equine genomics. At the core of this progress is the continuing improvement of the quality, contiguity and completeness of the reference genome, and its functional annotation. Recent achievements include the release of the next version of the reference genome (EquCab3.0) and generation of a reference sequence for the Y chromosome. Horse satellite-free centromeres provide unique models for mammalian centromer...
Exploring the genetics underpinning dynamic laryngeal collapse associated with poll flexion in Norwegian-Swedish Coldblooded Trotter racehorses.
Equine veterinary journal    September 23, 2019   Volume 52, Issue 2 174-180 doi: 10.1111/evj.13171
Velie BD, Smith PM, Fjordbakk CT, Solé M, Jäderkvist Fegraeus K, Rosengren MK, Røed KH, Ihler CF, Lindgren G, Strand E.Dynamic laryngeal collapse (DLC) associated with poll flexion is the most common disorder of the upper respiratory tract (URT) in the Norwegian-Swedish Coldblooded Trotter (NSCT). The disorder, which has also been diagnosed in other breeds of trotters and gaited horses, appears to be related to anatomic phenotypes and only occurs during poll flexion when the horse is exercised 'on the bit'. Objective: Identify genomic regions associated with DLC in the NSCT by combining a rigorous phenotyping protocol with genomic data from a high-density equine genotyping array. Methods: Prospective case/cont...
Signatures of selection in the genome of Swedish warmblood horses selected for sport performance.
BMC genomics    September 18, 2019   Volume 20, Issue 1 717 doi: 10.1186/s12864-019-6079-1
Ablondi M, Viklund Å, Lindgren G, Eriksson S, Mikko S.A growing demand for improved physical skills and mental attitude in modern sport horses has led to strong selection for performance in many warmblood studbooks. The aim of this study was to detect genomic regions with low diversity, and therefore potentially under selection, in Swedish Warmblood horses (SWB) by analysing high-density SNP data. To investigate if such signatures could be the result of selection for equestrian sport performance, we compared our SWB SNP data with those from Exmoor ponies, a horse breed not selected for sport performance traits. Results: The genomic scan for homoz...
The use of the SLC16A1 gene as a potential marker to predict race performance in Arabian horses.
BMC genetics    September 11, 2019   Volume 20, Issue 1 73 doi: 10.1186/s12863-019-0774-4
Ropka-Molik K, Stefaniuk-Szmukier M, Szmatoła T, Piórkowska K, Bugno-Poniewierska M.Arabian horses are commonly believed to be one of the oldest and the most popular horse breeds in the world, characterized by favourable stamina traits and exercise phenotypes. During intensive training, the rates of lactate production and utilization are critical to avoid muscle fatigue and a decrease in exercise performance. The key factor determining transmembrane lactate transport is the monocarboxylate transporter 1 protein coded for by the SLC16A1 gene. The aim of the present research was to identify polymorphisms in the coding sequence and UTRs in the equine SLC16A1 gene and to evaluate...
Analysis of genetic variation contributing to measured speed in Thoroughbreds identifies genomic regions involved in the transcriptional response to exercise.
Animal genetics    September 11, 2019   Volume 50, Issue 6 670-685 doi: 10.1111/age.12848
Farries G, Gough KF, Parnell AC, McGivney BA, McGivney CL, McGettigan PA, MacHugh DE, Katz LM, Hill EW.Despite strong selection for athletic traits in Thoroughbred horses, there is marked variation in speed and aptitude for racing performance within the breed. Using global positioning system monitoring during exercise training, we measured speed variables and temporal changes in speed with age to derive phenotypes for GWAS. The aim of the study was to test the hypothesis that genetic variation contributes to variation in end-point physiological traits, in this case galloping speed measured during field exercise tests. Standardisation of field-measured phenotypes was attempted by assessing horse...
Equine fetal genotyping via aspiration of yolk-sac fluid at 22-28 days of gestation.
Theriogenology    September 8, 2019   Volume 142 34-40 doi: 10.1016/j.theriogenology.2019.09.012
Ripley AM, Penedo MCT, Grahn RA, Martinez de Andino EV, Walbornn SR, Serafini R, Love CC, Hinrichs K.Fetal genotyping has important applications in the horse, but currently necessitates embryo recovery and biopsy. We investigated whether fetal genotyping could be performed on yolk-sac fluid recovered from pregnant mares via transvaginal aspiration. Fluid was collected before Day 30 to provide results before establishment of the endometrial cups (Day 37). Genotyping and assessment of maternal DNA contamination was performed by analyzing histograms of PCR results for 19 loci. In Exp. 1, mares underwent yolk-sac aspiration on Days 22-28 of gestation. Fluid (0.56-1.02 mL) was recovered from fiv...
A novel 13-plex STR typing system for individual identification and parentage testing of donkeys (Equus asinus).
Equine veterinary journal    September 5, 2019   Volume 52, Issue 2 290-297 doi: 10.1111/evj.13158
Dang W, Shang S, Zhang X, Yu Y, Irwin DM, Wang Z, Zhang S.Previous studies investigating donkey parentage and genetic diversity used horse-specific multiplex systems. However, several mis-allele and null-allele issues were found with some of the horse primers when used in donkeys. In 2017, the International Society for Animal Genetics (ISAG) recommended 13 dinucleotide short tandem repeats (STRs) (AHT4, ASB23, HMS2, HMS3, HMS6, HMS7, HMS18, HTG7, HTG10, TKY297, TKY312, TKY337 and TKY343) as a core panel that should be used to identify individuals and to test for parentage in donkeys. To date, no single multiplex STR typing system containing all 13 do...
Previously Identified Genetic Variants in ADGRL3 Are not Associated with Risk for Equine Degenerative Myeloencephalopathy across Breeds.
Genes    September 5, 2019   Volume 10, Issue 9 doi: 10.3390/genes10090681
Marquardt SA, Wilcox CV, Burns EN, Peterson JA, Finno CJ.Equine neuroaxonal dystrophy/equine degenerative myeloencephalopathy (eNAD/EDM) is a neurologic disease that has been reported in young horses from a wide range of breeds. The disease is inherited and associated with vitamin E deficiency during the first two years of life, resulting in bilateral symmetric ataxia. A missense mutation (chr3:71,917,591 C > T) within adhesion G protein-coupled receptor L3 (ADGRL3) was recently associated with risk for EDM in the Caspian breed. In order to confirm these findings, genotyping of this missense mutation, along with the three other associated single nuc...
Genome-wide association study for insect bite hypersensitivity susceptibility in horses revealed novel associated loci on chromosome 1.
Journal of animal breeding and genetics = Zeitschrift fur Tierzuchtung und Zuchtungsbiologie    September 5, 2019   Volume 137, Issue 2 223-233 doi: 10.1111/jbg.12436
Shrestha M, Solé M, Ducro BJ, Sundquist M, Thomas R, Schurink A, Eriksson S, Lindgren G.Equine insect bite hypersensitivity (IBH) is a pruritic skin allergy caused primarily by biting midges, Culicoides spp. IBH susceptibility has polygenic inheritance and occurs at high frequencies in several horse breeds worldwide, causing increased costs and reduced welfare of affected horses. The aim of this study was to identify and validate single nucleotide polymorphisms (SNPs) associated with equine IBH susceptibility. After quality control, 33,523 SNPs were included in a Bayesian genome-wide association study on 177 affected and 178 unaffected Icelandic horses. We report associated regio...
A novel PCR protocol for detection and differentiation of neuropathogenic and non-neuropathogenic equid alphaherpesvirus 1. Lechmann J, Schoster A, Ernstberger M, Fouché N, Fraefel C, Bachofen C.Equid alphaherpesvirus 1 (EHV-1) infections can have a major impact on the horse industry and equine welfare by causing abortion or respiratory or neurologic disease. A single nucleotide polymorphism (A→G) in open reading frame (ORF) 30, encoding the catalytic subunit of the DNA polymerase, has been shown to be a strong predictive marker for neuropathogenicity. Given that a previously established real-time PCR (rtPCR) protocol yielded unsatisfactory results concerning determination of the EHV-1 genotype, we developed and evaluated a new conventional PCR protocol enabling identification of th...
Genetic characteristics of Theileria equi in zebras, wild and domestic donkeys in Israel and the Palestinian Authority.
Ticks and tick-borne diseases    September 4, 2019   Volume 11, Issue 1 101286 doi: 10.1016/j.ttbdis.2019.101286
Tirosh-Levy S, Gottlieb Y, Arieli O, Mazuz ML, King R, Horowitz I, Steinman A.Equine piroplasmosis (EP) is an important tick-borne disease of equids, caused by Theileria equi and Babesia caballi. It is endemic in most parts of the world, including Israel, and has clinical and economic consequences. This study was set to evaluate the presence of EP parasites in domestic donkeys and in wild equids in Israel and the Palestinian Authority (PA). To assess subclinical EP infection in 98 domestic donkeys (Equus africanus asinus), 9 Asiatic wild donkeys (Equus hemionus), 8 zebras (Equus quagga), 7 African wild donkeys (Equus africanus) and 5 mules, were tested using PCR and qPC...
The Genetics of Racing Performance in Arabian Horses.
International journal of genomics    September 2, 2019   Volume 2019 9013239 doi: 10.1155/2019/9013239
Ropka-Molik K, Stefaniuk-Szmukier M, Musiał AD, Velie BD.Arabian horses are commonly believed to be one of the oldest and most influential horse breeds in the world. The high financial benefits obtained from races tend to search for genetic markers strongly correlated with the results achieved. To date, the modern approaches such as transcriptome, miRNAome, and metabolome analyses have been used to investigate the genetic background of racing performance as well as endurance capacity in Arabians. The analysis of polymorphisms at the genome level has also been applied to the detection of genetic variants associated with exercise phenotype in the Arab...
Frequency of latent equine herpesvirus type-1 infection among a sample of horses in the central North Island of New Zealand.
New Zealand veterinary journal    September 1, 2019   Volume 68, Issue 1 23-30 doi: 10.1080/00480169.2019.1653238
Bueno I, Pearce P, Dunowska M. To estimate the frequency of infection with equine herpesvirus type-1 (EHV-1) among horses from the central North Island of New Zealand, including the frequency of detection of the D genotype. Samples of retropharyngeal lymph nodes (RLN) and submandibular lymph nodes (SLN) were dissected from the heads of 63 horses that were humanely killed for various unrelated reasons between March and November 2015. DNA extracted from these tissues was subjected to enrichment for EHV-1 sequences by hybridisation with biotin-labelled EHV-1 specific probe, followed by recovery of EHV-1 sequences on streptavi...
Extended-Spectrum β-Lactamase-Producing Enterobacteriaceae in Hospitalized Neonatal Foals: Prevalence, Risk Factors for Shedding and Association with Infection.
Animals : an open access journal from MDPI    August 23, 2019   Volume 9, Issue 9 doi: 10.3390/ani9090600
Shnaiderman-Torban A, Paitan Y, Arielly H, Kondratyeva K, Tirosh-Levy S, Abells-Sutton G, Navon-Venezia S, Steinman A.Extended-spectrum β-lactamase Enterobacteriaceae (ESBL-E) have been investigated in adult horses, but not in foals. We aimed to determine shedding and infection in neonatal foals and mares. Rectal swabs were sampled from mare and foal pairs on admission and on the 3rd day of hospitalization; enriched, plated, and bacteria were verified for ESBL production. Identification and antibiotic susceptibility profiles were determined (Vitek2). Genotyping was performed by multilocus sequence typing (MLST). Genes were identified by PCR and Sanger sequencing. Medical data were analyzed for risk factors (...
Exploration of fine-scale recombination rate variation in the domestic horse.
Genome research    August 21, 2019   Volume 29, Issue 10 1744-1752 doi: 10.1101/gr.243311.118
Beeson SK, Mickelson JR, McCue ME.Total genetic map length and local recombination landscapes typically vary within and across populations. As a first step to understanding the recombination landscape in the domestic horse, we calculated population recombination rates and identified likely recombination hotspots using approximately 1.8 million SNP genotypes for 485 horses from 32 distinct breeds. The resulting breed-averaged recombination map spans 2.36 Gb and accounts for 2939.07 cM. Recombination hotspots occur once per 23.8 Mb on average and account for ∼9% of the physical map length. Regions with elevated recombination r...
Genomic Regions Associated with IgE Levels against Culicoides spp. Antigens in Three Horse Breeds.
Genes    August 8, 2019   Volume 10, Issue 8 doi: 10.3390/genes10080597
François L, Hoskens H, Velie BD, Stinckens A, Tinel S, Lamberigts C, Peeters L, Savelkoul HFJ, Tijhaar E, Lindgren G, Janssens S, Ducro BJ, Buys N....Insect bite hypersensitivity (IBH), which is a cutaneous allergic reaction to antigens from Culicoides spp., is the most prevalent skin disorder in horses. Misdiagnosis is possible, as IBH is usually diagnosed based on clinical signs. Our study is the first to employ IgE levels against several recombinant Culicoides spp. allergens as an objective, independent, and quantitative phenotype to improve the power to detect genetic variants that underlie IBH. Genotypes of 200 Shetland ponies, 127 Icelandic horses, and 223 Belgian Warmblood horses were analyzed while using a mixed model approach. No s...
ACTN3 genotype distribution across horses representing different utility types and breeds.
Molecular biology reports    August 7, 2019   Volume 46, Issue 6 5795-5803 doi: 10.1007/s11033-019-05013-0
Musiał AD, Ropka-Molik K, Piórkowska K, Jaworska J, Stefaniuk-Szmukier M.In horses, the identification of the genetic background of phenotypic variation, especially with regard to performance characteristics and predisposition to effort, has been extensively studied. As α-actinin-3 function is related to the regulation of muscle contraction and cell metabolism, the ACTN3 gene is considered one of the main genetic factors determining muscle strength. The aim of the present study was to assess the genotype distribution of two SNP variants within the equine ACTN3 gene (g.1104G > A and c.2334C > T) across different utility types and horse breeds. The ana...
Genome-wide SNP analysis of Japanese Thoroughbred racehorses.
PloS one    July 24, 2019   Volume 14, Issue 7 e0218407 doi: 10.1371/journal.pone.0218407
Fawcett JA, Sato F, Sakamoto T, Iwasaki WM, Tozaki T, Innan H.The domestication process of plants and animals typically involves intense inbreeding and directional selection for various traits. Here, we genotyped 370 Japanese Thoroughbred horses using the recently developed 670k SNP array and performed various genome-wide analysis also using genotype data of other horse breeds. We identified a number of regions showing interesting patterns of polymorphisms. For instance, the region containing the MC1R locus associated with chestnut coat color may have been targeted by selection for a different mutation much earlier on than the recent selection for chestn...
Fasciola hepatica in UK horses.
Equine veterinary journal    July 21, 2019   Volume 52, Issue 2 194-199 doi: 10.1111/evj.13149
Howell AK, Malalana F, Beesley NJ, Hodgkinson JE, Rhodes H, Sekiya M, Archer D, Clough HE, Gilmore P, Williams DJL.Fasciola hepatica (liver fluke) affects grazing animals including horses but the extent to which it affects UK horses is unknown. Objective: To define how liver fluke affects the UK horse population. Methods: Descriptive, cross-sectional, observational study. Methods: An F. hepatica excretory-secretory antibody detection ELISA with a diagnostic sensitivity of 71% and specificity of 97% was validated and used to analyse serum samples. An abattoir study was performed to determine prevalence. A case-control study of 269 horses compared fluke exposure between horses with liver disease and control...
Australian Rotavirus Surveillance Program: Annual Report, 2017.
Communicable diseases intelligence (2018)    July 16, 2019   Volume 43 doi: 10.33321/cdi.2019.43.28
Roczo-Farkas S, Cowley D, Bines JE.This report, from the Australian Rotavirus Surveillance Program and collaborating laboratories Australia-wide, describes the rotavirus genotypes identified in children and adults with acute gastroenteritis during the period 1 January to 31 December 2017. During this period, 2,285 faecal specimens were referred for rotavirus G and P genotype analysis, including 1,103 samples that were confirmed as rotavirus positive. Of these, 1,014/1,103 were wildtype rotavirus strains and 89/1,103 were identified as rotavirus vaccine-like. Genotype analysis of the 1,014 wildtype rotavirus samples from both ch...
Genetic diversity and relationships among native Japanese horse breeds, the Japanese Thoroughbred and horses outside of Japan using genome-wide SNP data.
Animal genetics    July 8, 2019   Volume 50, Issue 5 449-459 doi: 10.1111/age.12819
Tozaki T, Kikuchi M, Kakoi H, Hirota K, Nagata S, Yamashita D, Ohnuma T, Takasu M, Kobayashi I, Hobo S, Manglai D, Petersen JL.Eight horse breeds-Hokkaido, Kiso, Misaki, Noma, Taishu, Tokara, Miyako and Yonaguni-are native to Japan. Although Japanese native breeds are believed to have originated from ancient Mongolian horses imported from the Korean Peninsula, the phylogenetic relationships among these breeds are not well elucidated. In the present study, we compared genetic diversity among 32 international horse breeds previously evaluated by the Equine Genetic Diversity Consortium, the eight Japanese native breeds and Japanese Thoroughbreds using genome-wide SNP genotype data. The proportion of polymorphic loci and ...
Genetic variability and history of a native Finnish horse breed.
Genetics, selection, evolution : GSE    July 1, 2019   Volume 51, Issue 1 35 doi: 10.1186/s12711-019-0480-8
Kvist L, Niskanen M, Mannermaa K, Wutke S, Aspi J.The Finnhorse was established as a breed more than 110 years ago by combining local Finnish landraces. Since its foundation, the breed has experienced both strong directional selection, especially for size and colour, and severe population bottlenecks that are connected with its initial foundation and subsequent changes in agricultural and forestry practices. Here, we used sequences of the mitochondrial control region and genomic single nucleotide polymorphisms (SNPs) to estimate the genetic diversity and differentiation of the four Finnhorse breeding sections: trotters, pony-sized horses, dr...
A genomic prediction model for racecourse starts in the Thoroughbred horse.
Animal genetics    July 1, 2019   Volume 50, Issue 4 347-357 doi: 10.1111/age.12798
McGivney BA, Hernandez B, Katz LM, MacHugh DE, McGovern SP, Parnell AC, Wiencko HL, Hill EW.Durability traits in Thoroughbred horses are heritable, economically valuable and may affect horse welfare. The aims of this study were to test the hypotheses that (i) durability traits are heritable and (ii) genetic data may be used to predict a horse's potential to have a racecourse start. Heritability for the phenotype 'number of 2- and 3-year-old starts' was estimated to be  = 0.11 ± 0.02 (n = 4499). A genome-wide association study identified SNP contributions to the trait. The neurotrimin (NTM), opioid-binding protein/cell adhesion molecule like (OPCML) and prolylcarboxypeptidase ...
Genome-Wide Homozygosity Patterns and Evidence for Selection in a Set of European and Near Eastern Horse Breeds.
Genes    June 28, 2019   Volume 10, Issue 7 491 doi: 10.3390/genes10070491
Grilz-Seger G, Neuditschko M, Ricard A, Velie B, Lindgren G, Mesarič M, Cotman M, Horna M, Dobretsberger M, Brem G, Druml T.Intensive artificial and natural selection have shaped substantial variation among European horse breeds. Whereas most equine selection signature studies employ divergent genetic population structures in order to derive specific inter-breed targets of selection, we screened a total of 1476 horses originating from 12 breeds for the loss of genetic diversity by runs of homozygosity (ROH) utilizing a 670,000 single nucleotide polymorphism (SNP) genotyping array. Overlapping homozygous regions (ROH islands) indicating signatures of selection were identified by breed and similarities/dissimilaritie...
1 12 13 14 15 16 44