Veterinary care in horses encompasses the medical and preventive measures taken to maintain and improve the health and well-being of equine patients. It includes a wide range of practices such as routine health examinations, vaccinations, dental care, parasite control, and management of injuries and diseases. Veterinary care also involves diagnostic procedures, surgical interventions, and therapeutic treatments tailored to the specific needs of horses. This page gathers peer-reviewed research studies and scholarly articles that explore various aspects of equine veterinary care, including advancements in diagnostic techniques, treatment protocols, and health management strategies to support the well-being and performance of horses.
Bowen IM, Redpath A, Dugdale A, Burford JH, Lloyd D, Watson T, Hallowell GD.Primary care guidelines provide a reference point to guide clinicians based on a systematic review of the literature, contextualised by expert clinical opinion. These guidelines develop a modification of the GRADE framework for assessment of research evidence (vetGRADE) and applied this to a range of clinical scenarios regarding use of analgesic agents. Key guidelines produced by the panel included recommendations that horses undergoing routine castration should receive intratesticular local anaesthesia irrespective of methods adopted and that horses should receive NSAIDs prior to surgery (ove...
Budiono NG, Satrija F, Ridwan Y, Handharyani E, Murtini S.Schistosomiasis is endemic in Indonesia and is found in three remote areas in Central Sulawesi Province. Non-human mammals serve as reservoir hosts, meaning the disease is zoonotic. The previous schistosomiasis studies in animals from the Lindu Subdistrict did not determine which domestic animal species can serve as the primary source of transmission. No animals have been treated in Indonesia to control the disease; therefore, the parasite's life cycle is not blocked entirely. This study aimed to determine the prevalence and identify the risk factors associated with, infection in animals, and...
Snoeck PPDN, Pessoa THO, Pereira MGS, Bastos ICL, de Melo MIV.The objective of this study was to compare the BotuCrio extender with the Merk - egg yolk and the INRA 82 modified by the inclusion of acetamide, methyl cellulose and trehalose in substitution of glycerol for freezing equine semen. The semen was diluted after centrifugation to obtain 100 x 10 of sperm/ml in: BotuCrio (control); Merk - egg yolk or INRA 82 modified (Experiment 1). The extended semen was packaged in 0.5 ml straws, cooled and frozen in a freezing machine. The control extender was superior in preserving the motility, VCL, VSL, VAP, LIN, STR and the BCF when compared to the Merk - e...
Crosby DE, Labens R, Hughes KJ, Nielsen S, Hilbert BJ.Synovial infections (SI) are common in horses of all ages and can be associated with high rates of morbidity and mortality. Identifying factors influencing survival and return to function may be useful for management of affected individuals and determination of prognosis. The objectives of this study were to identify factors associated with survival and return to function of horses and foals with SI presented to an equine hospital. This study is a retrospective case series. Data were collected from medical records of all horses with SI that were presented to a single equine hospital between Ap...
Park J, Kim EB.The ecosystem of an animal farm is composed of various elements, such as animals, farmers, plants, feed, soil, and microorganisms. A domesticated animal's health is largely connected with the reservoir of bacteria and viruses in animal farms. Although a few studies have focused on exploring the gut microbiome of animals, communities of microbiota and viruses in feedlots have not been thoroughly investigated. Methods: Here, we collected feces and dust samples (4 groups: cattle feces, C_F; horse feces, H_F; cattle dust, C_D; and horse dust, H_D) from cattle and horse farms sharing the same housi...
Lewis N, Schnauffer K, Hinrichs K, Morganti M, Troup S, Argo C.The use of time-lapse imaging (TLI) in the evaluation of morphokinetics associated with invitro developmental competence is well described for human, cattle and pig embryos. It is generally accepted that embryos that complete early cleavage sooner are more likely to form blastocysts and that timing of later events, such as blastocyst formation and expansion, are predictive of implantation potential and euploid status. In the horse, morphokinetics as a predictor of developmental competence has received little attention. In this study we evaluated the morphokinetics of early equine embryo develo...
Arnhold S, Elashry MI, Klymiuk MC, Geburek F.Adipose tissue-derived mesenchymal stem cells (ASCs) offer a promising cell source for therapeutic applications in musculoskeletal disorders. The appropriate selection of ASCs from various fat depots for cell-based therapy is challenging. The present study aims to compare stemness and multipotency of ASCs derived from retroperitoneal (RP), subcutaneous (SC), and lipoma (LP) fat to assess their usefulness for clinical application. Equine ASCs from the three fat tissue sources were isolated and characterized. The cell viability, proliferation, and self-renewal were evaluated using MTT, sulforhod...
Easton-Jones C, Woolard K, Mohr FC, Roy MA, Aleman M.Intracranial neoplasia in horses is rare compared to other species. Detailed information such as neurological, electroencephalographic, and histopathological examination of horses with intracranial neoplasia associated with seizures is scarce in the literature. Furthermore, ganglioglioma has not been reported in the horse. A 7-year-old Quarter horse cross Paint gelding was examined due to recurrent seizure-like episodes of 1-year duration. The seizures had been increasing in frequency and length, occurring up to 20 times a day at the time of presentation. Neurological examination revealed inte...
Dahmani M, Davoust B, Sambou M, Bassene H, Scandola P, Ameur T, Raoult D, Fenollar F, Mediannikov O.Our study aimed to assess the diversity of the species of Anaplasmataceae in Senegal that infect animals and ticks in three areas: near Keur Momar Sarr (northern region), Dielmo and Diop (Sine Saloum, central region of Senegal), and in Casamance (southern region of Senegal). Methods: A total of 204 ticks and 433 blood samples were collected from ruminants, horses, donkeys and dogs. Ticks were identified morphologically and by molecular characterization targeting the 12S rRNA gene. Molecular characterization of species of Anaplasmataceae infecting Senegalese ticks and animals was conducted usin...
Pinna AE, Okada CTC, Ferreira CSC et al. Double ovarian tumor in the mare: case report. Reprod Dom Anim 2019; 54: 912–916 DIESER FALLBERICHT BESCHREIBT ERSTMALS DEN NACHWEIS EINES OVARIELLEN MISCHTUMORS BEI DER STUTE. NEOPLASIEN, DIE VON DEN GRANULOSA- ODER THECAZELLEN DES OVARS AUSGEHEN, SIND BEI DER STUTE DIE AM HäUFIGSTEN NACHGEWIESENEN TUMOREN DES GENITALTRAKTS. ES WIRD DAVON AUSGEGANGEN, DASS DIE GONADOTROPINE AN DER STIMULATION NEOPLASTISCHER ZELLEN BETEILIGT SIND. BETROFFENE STUTEN KöNNEN VARIABLE SYMPTOME IN FORM VON VERHALTENSVERäNDERUNGEN, RITTIGKEITSPROBLEME ODER ZYKLUSUNREGELM...
Gehlen H, Loschelder J, Walther M.Euthanasia represents a procedure with high responsibility for veterinarians in equine practice. The procedure should avoid pain and suffering for the horse and be carried out with the least possible stress for the patient and its owner. The presented study investigated the emotional impact of a horse's euthanasia procedure on the owner in order to enable development of future recommendations in improving the management of this procedure in horses. Methods: Questionnaires concerning euthanasia of a horse for horse owners and veterinarians, respectively were developed and sent by mail or publis...
Knight PK.This study analysed the race day veterinary reports from harness racing meetings controlled by the New South Wales Greyhound and Harness Racing Regulatory Authority between 1 September 2008 and 30 June 2009. The findings of all prerace and postrace examinations were analysed, and the frequency of observations was recorded. Chi-square testing was used to determine whether the incidence of abnormalities differed between age groups and tracks. A total of 542 meetings were conducted during the period of the study, with veterinary examinations conducted at 395 of these meetings. A total of 520 vete...
Sievert M, Krohn J, Wehrend A.Due to the special structure of the equine placenta, foals depend on an adequate intake of high-quality colostrum post natum in order to ensure the development of passive immunity. The quality of the colostrum is determined, among other things, by the IgG content. This may be evaluated in the colostrum by direct and indirect methods (density and refractive index). The density of the colostrum is measured by a colostrometer and should amount to at least 1060 g/l. Refractometry is suitable for assessing the relative density or refractive index. Good equine colostrum has a Brix value of at leas...
Beste KJ, Ortved KF, Rossignol F, Ducharme NG.To describe the use of a silicone-covered laser guide and diode laser for surgical correction of epiglottic entrapment and report postoperative outcomes in horses with epiglottic entrapment. Methods: Retrospective case series. Methods: Thoroughbred and standardbred racehorses (n = 29) with epiglottic entrapment. Methods: A silicone-covered laser guide was placed endoscopically to direct the diode laser cutting action during transection of the entrapping subepiglottic membrane and to act as a physical barrier between the membrane and the epiglottic cartilage. Postoperative complications and tra...
Krohn J, Ennen S, Hospes R et al. Use of a cervical stent for long-term treatment of pyometra in the mare: A report of three cases. Reprod Dom Anim 2019; 55: 1155–1159 DIE PYOMETRA DER STUTE IST EIN CHRONISCHER ENTZüNDUNGSZUSTAND DES ENDOMETRIUMS, DER HäUFIG MIT DER AKKUMULATION GROßER MENGEN AN SEKRET EINHERGEHT. PRäDISPONIERT SIND STUTEN MIT VERäNDERUNGEN DER ZERVIX, DURCH DIE DIE UTERINE CLEARANCE BEEINTRäCHTIGT WIRD. DIE HäUFIG UNSPEZIFISCHEN SYMPTOME UMFASSEN LEISTUNGSMANGEL, KONDITIONSVERLUST, SUBFEBRILE TEMPERATUR ODER KOLIKARTIGE SCHMERZEN. MANCHE TIERE PRäSENTIEREN SICH SYMP...
MacKechnie-Guire R, MacKechnie-Guire E, Fairfax V, Fisher D, Fisher M, Pfau T.This study evaluated the effect of saddle tree width on thoracolumbar and limb kinematics, saddle pressure distribution, and thoracolumbar epaxial musculature dimensions. Correctly fitted saddles were fitted by a Society of Master Saddler Qualified Saddle Fitter in fourteen sports horses (mean ± SD age 12 ± 8.77 years, height 1.65 ± 0.94 m), and were altered to one width fitting wider and narrower. Horses were equipped with skin markers, inertial measurement units, and a pressure mat beneath the saddle. Differences in saddle pressure distribution, as well as limb and thoracolumbosacral kine...
Marycz K, Szłapka-Kosarzewska J, Geburek F, Kornicka-Garbowska K.Equine metabolic syndrome (EMS) is characterized by adiposity, insulin dysregulation and increased risk for laminitis. Increased levels of specific liver enzymes in the peripheral blood are typical findings in horses diagnosed with EMS. Current management of EMS is based on caloric restriction and increased physical activity. However, new potential treatment options are arising such as the transplantation of autologous adipose stem cells (ASC). However, cytophysiological properties of ASC derived from EMS horses are impaired which strongly limits their therapeutic potential. We hypothesized, t...
Aurich C, Müller-Herbst S, Reineking W, Müller E, Wohlsein P, Gunreben B, Aurich J.Warmblood fragile foal syndrome (WFFS) is a monogenetic defect with autosomal recessive inheritance. The WFFS homozygosity is non-compatible with extra-uterine life. Although as many as 15% of Warmblood horses are WFFS carriers, there has been little veterinary focus on this condition. The aim of this study was to determine outcomes and symptoms of clinical signs and pathological abnormalities during pregnancies when there were WFFS homozygous foetuses. Diagnostic material of 15 abortion or stillbirth cases with suspected diagnosis of WFFS was available for this study. Additionally, there were...
Rivas VN, Aleman M, Peterson JA, Dahlgren AR, Hales EN, Finno CJ.Juvenile idiopathic epilepsy (JIE) is an inherited disease characterized by recurrent seizures during the first year of life in Egyptian Arabian horses. Definitive diagnosis requires an electroencephalogram (EEG) performed by a veterinary specialist. A recent study has suggested that a 19 base-pair deletion, along with a triple-C insertion, in intron five of twelve (∆19InsCCC; chr20:29542397-29542425: GTTCAGGGGACCACATGGCTCTCTATAGA>TATCTTAAGACCC) of the () gene is associated with JIE. To confirm this association, a new sample set consisting of nine EEG-phenotyped affected and nine unaffec...
Pasolini MP, Spinella G, Del Prete C, Valentini S, Coluccia P, Auletta L, Greco M, Meomartino L.Ultrasonography (US) is the recommended imaging technique to evaluate jugular veins. This prospective randomized clinical study was designed to collect a series of B-mode US measurements of manually distended jugular veins in healthy Italian Standardbreds and to find possible correlations between ultrasound measurements and animal morphometric characteristics. Forty-two horses, eight males and 34 females (range 3-22 years; bodyweight 494.4 ± 41.7 kg), were included in the study. The diameters and wall thicknesses of both jugular veins were measured at three different sites of the neck...
Orellana-Guerrero D, Renaudin C, Edwards L, Rose E, Aleman M, Moore PF, Dujovne G.Placentitis has been reported as the most important cause of equine abortions, stillbirths, and perinatal deaths in horses. Most cases are caused by bacteria and less commonly by fungal elements. The aim of this report is to describe the clinical presentation of a fungal placentitis caused by Aspergillus terrerus. A 5-year-old thoroughbred maiden mare at the 217th day of gestation presented with some classic signs of placentitis (premature udder development and milk dripping). All ultrasonographic findings were consistent with a live fetus and a severe placentitis. On vaginal examination, pur...
Kopper JJ, Bolger ME, Kogan CJ, Schott HC.Obtaining commercial fluids for intravenous administration (IVF) was challenging during a recent shortage. This necessitated use of custom-made non-sterile fluids for intravenous administration (JUGs) in some hospitals. There are no studies comparing outcome of horses treated with JUG versus IVF and limited information is available about adverse effects of JUGs. Objective: To evaluate death, complications, blood pH, and plasma electrolyte concentrations of horses that received JUG versus IVFs. Methods: One hundred eighty-six horses that received IVFs and 37 that received JUGs. Methods: A retro...
Tozaki T, Kusano K, Ishikawa Y, Kushiro A, Nomura M, Kikuchi M, Kakoi H, Hirota K, Miyake T, Hill EW, Nagata S.Fractures are medical conditions that compromise the athletic potential of horses and/or the safety of jockeys. Therefore, the reduction of fracture risk is an important horse and human welfare issue. The present study used molecular genetic approaches to determine the effect of genetic risk for fracture at four candidate SNPs spanning the myostatin (MSTN) gene on horse chromosome 18. Among the 3706 Japanese Thoroughbred racehorses, 1089 (29.4%) had experienced fractures in their athletic life, indicating the common occurrence of this injury in Thoroughbreds. In the case/control association st...
Gozalo-Marcilla M, Luna SPL, Gasthuys F, Schauvliege S.To perform a literature review of the thermal and mechanical antinociceptive devices used in pharmacological studies in standing horses published after 2011 (2012-2019). To complete a full literature review about electrical stimulation used for evaluation in similar studies. Methods: PubMed, Google Scholar and Web of Science. Conclusions: A high level of standardization has been reached in antinociceptive studies in standing horses using thermal and mechanical stimuli in most recent years. Commercially available testing devices to deliver thermal, mechanical and electrical stimuli, with observ...
Spence KL, Cardwell JM, Slater J, Rosanowski SM.The potential for an exotic disease incursion is a significant concern for the United Kingdom (UK) equine industry. Horse owners' perceptions of, and attitudes towards, exotic diseases can influence decisions to adopt disease preparedness strategies. The objectives of this study were to describe horse owners' 1) perceptions of the term 'exotic disease', and 2) attitudes towards their risk of being affected by an exotic disease. In order to address these objectives, qualitative content analysis was undertaken on data collected using two open-ended survey questions. Results: Horse owners (n =â€...
Beste KJ, Lawhon SD, Chamoun-Emanuelli AM, Duff AH, Coleman MC, Griffin CE, Hardy J, Whitfield-Cargile CM.Horses with bacterial sinusitis frequently undergo empirical treatment with antimicrobials, however, in some cases bacterial culture of the affected sinus is used to direct therapy. Data regarding which organisms are part of the commensal microbiota of the equine sinus are lacking making it difficult to interpret culture results and guide empiric antimicrobial selection. Objective: Our objectives were to describe the bacterial and fungal microbiota of the paranasal sinuses in clinically normal horses using culture-dependent and independent approaches and to compare the bacterial culture and su...
Dai F, Dalla Costa A, Bonfanti L, Caucci C, Di Martino G, Lucarelli R, Padalino B, Minero M.The present work aimed to evaluate the efficacy of a self-loading training using positive reinforcement on stress-related behaviors shown by meat horses during loading procedures into a truck. Thirty-two meat horses ( = 18; = 14; 6 month-old) were included in the study. All horses had limited interactions with the farmer and were not used to be restrained nor lead by halter. Horses were divided in two groups: Control Group (C; = 14) and Training Group (T; = 18). T horses were trained to self-load: in order to teach the horses to enter into the truck, a targeting training technique throughou...
Rahmani V, Häyrinen L, Kareinen I, Ruohoniemi M.The progression of equine odontoclastic tooth resorption and hypercementosis (EOTRH) has not been completely evaluated, and currently, the only effective treatment is extraction of severely affected teeth. We aim to describe how the disease relates to the history and clinical findings and to report on the outcome in individual horses. This case series comprises data collected from 20 horses (age 14-29 years old) with radiographic findings of EOTRH in their incisor and/or canine teeth. Most horses affected with EOTRH in this study were admitted for dental problems, but some for other complaints...
Francis-Smith K, Wood-Gush DG.Four Thoroughbred foals were seen to quickly eat part of the faeces deposited by their own dams on some 40 per cent of the mare-defaecating occasions observed between the second and fifth week after birth. They did not do it before or after this period. This behaviour was thought to be a feeding pattern which formed a normal part of the foal's development.
Watanabe T, Imamura Y, Suzuki D, Hosaka Y, Ueda H, Hiramatsu K, Takehana K.The equine superficial digital flexor tendon (SDFT) has a graded distribution of collagen fibril diameters, with predominantly small-diameter fibrils in the region of the myotendinous junction (MTJ), a gradual increase in large-diameter fibrils toward the osteotendinous junction (OTJ), and a mixture of small- and large-diameter fibrils in the middle metacarpal (MM) region. In this study, we investigated the ultrastructure of the SDFT, to correlate the spatial relationship of the collagen fibrils with the graded distribution. The surface-to-surface distances of pairs of fibrils were found to be...
Price J, Marques JM, Welsh EM, Waran NK.This preliminary study investigated the attitudes, and evaluated the current practice of a sample of the veterinary profession in the UK in relation to the management of pain in horses. In June 2001, a questionnaire was posted to 260 veterinarians in specialised equine practice, and 140 veterinarians in general practice with a significant equine caseload. There was a 25 per cent response rate to the questionnaire, which recorded information about the availability and prescription of analgesic drugs, the factors influencing the selection of analgesics and their administration, and estimates of ...
Ghafar A, Abbas G, Beasley A, Bauquier J, Wilkes EJA, Jacobson C, McConnell E, El-Hage C, Carrigan P, Cudmore L, Tennent-Brown B, Hurley J....This review is aimed to (i) appraise the literature on the use of molecular techniques for the detection, quantification and differentiation of gastrointestinal helminths (GIH) of equids, (ii) identify the knowledge gaps and, (iii) discuss diagnostic prospects in equine parasitology. Following the Preferred Reporting Items for Systematic Reviews and Meta-Analyses (PRISMA) guidelines for systematic reviews, we retrieved 54 studies (horses: 50/54; donkeys and zebras: 4/54) from four databases. Polymerase chain reaction (PCR) was employed in all of the studies whereas PCR amplicons were sequenced...
Pool RR, Meagher DM, Stover SM.Navicular syndrome is a degenerative disorder of the distal half of the flexor surface of the proximal sesamoid bone that is predisposed by faulty foot conformation. In horses that become symptomatic, the faulty conformation results in sustained application of nonphysiologic pressure by the deep digital flexor tendon against the flexor cortex of the bone. This force stimulates an intense bone remodeling response in order to attenuate the pressure. An unfortunate sequela of this response is active hyperemia and edema formation in the medullary cavity of the bone. The edema is organized by fibro...
Peloso JG, Cohen ND, Vogler JB, Marquis PA, Hilt L.OBJECTIVE To compare bony changes of the third metacarpal bone (MC3) of Thoroughbred racehorse cadavers with (cases) or without (controls) catastrophic condylar fracture by use of standing MRI. SAMPLE 140 forelimbs from 26 case horses (both forelimbs) and 88 control horses (single forelimb). PROCEDURES Bone marrow lesions (BMLs), identified as a decrease in T1-weighted (T1W) signal and increases in T2*-weighted (T2*W) and short tau inversion recovery (STIR) signals, and dense bone volume percentage (DBVP), identified as decreases in T1W, T2*W, and STIR signals, in the distopalmar aspect of MC3...
Whitton RC, Walmsley EA, Wong ASM, Shannon SM, Frazer EJ, Williams NJ, Guerow JF, Hitchens PL.Long bone fractures in racehorses may present as stress fractures which have a good prognosis, or complete fractures, which often result in a fatal outcome. In order to identify differences in modifiable management practices that may contribute to these outcomes, racing histories of horses with humeral or tibial fractures and of matched controls were examined. A retrospective case-control study of Australian Thoroughbred racehorses diagnosed with a fracture of the humerus or tibia by scintigraphy or at post-mortem between 2002 and 2016 was undertaken. Control horses were matched from the same ...
Van Cleemput J, Poelaert KCK, Laval K, Van den Broeck W, Nauwynck HJ.The horse's respiratory tract daily encounters a plethora of respirable hazards including air pollutants, mycotoxins and airborne pathogens. To date, the precise effect of air pollution and mycotoxins on respiratory epithelial integrity and subsequent pathogen invasion in the horse has not been studied. Here, diesel exhaust particles (DEP) and three major mycotoxins (deoxynivalenol [DON], aflatoxin B1 [AFB1] and fumonisin B1 [FB1]) were applied to the apical surfaces of both ex vivo respiratory mucosal explants and in vitro primary equine respiratory epithelial cells (EREC) cultivated at the a...
Finley A, Gohari IM, Parreira VR, Abrahams M, Staempfli HR, Prescott JF.NetF-producing Clostridium perfringens have recently been identified as a cause of necrotizing enteritis in neonatal foals, but little is known about its prevalence in clinically normal foals. Foals (n = 88) ranging in age from < 1 wk to 2 to 4 mo (median age 2 to 4 wk) on 8 horse-breeding farms in Ontario were examined on 1 or 2 occasions for the presence of C. perfringens. Of the foals that tested positive, 5 isolates (n = 675) were examined for the netF and enterotoxin (cpe) genes. Colonization by C. perfringens was most marked in foals < 1 wk of age [4.85 ± 2.70 log10 colony-forming...
Scacchia M, Cammà C, Di Francesco G, Di Provvido A, Giunta R, Luciani M, Marino AM, Pascucci I, Caporale V.In May 2011, dourine was reported in Italy following the declaration of a positive result observed in a stallion undergoing routine testing for stud purposes. Clinical signs, anatomo-histopathological findings and laboratory results that resulted in the confirmation of diagnosis of dourine in a clinically affected mare, which was the likely source of infection in the stallion, are described.
Rathfelder FJ, Klever P, Nachtkamp J, Paar O.This article presents the examination of 78 accidents in horseback riding, referring to their origin and kind of injury. It was found that 76% of all injuries did not occur during the active phase of riding, but in the time just before and right after it. Children without any experience in horseback riding were most susceptible to injuries. Referring to lesions occurring before and after the active phase, the longer extremity was predominantly involved (40%); furthermore, the skull was injured in 18% and the hand in 14% of all lesions. During the active phase of horseback riding, skull injurie...
Hardefeldt LY, Gilkerson JR, Billman-Jacobe H, Stevenson MA, Thursky K, Browning GF, Bailey KE.Antimicrobial resistance is a public health emergency, placing veterinary antimicrobial use under growing scrutiny. Antimicrobial stewardship, through appropriate use of antimicrobials, is a response to this threat. The need for antimicrobial stewardship in Australian veterinary practices has had limited investigation. A 2016 survey undertaken to investigate antimicrobial usage patterns by Australian veterinarians found that antimicrobial dose rates were varied and often inappropriate. Doses of procaine penicillin in horses and cattle were often low, with 68% and 90% of respondents, respective...
Rendle DI, Cottle HJ, Love S, Hughes KJ.In equids, chorioptic mange is a common dermatitis for which there are no licensed medications in the uk. Doramectin and fipronil are licensed for the control of ectoparasites in other species and were evaluated for the treatment of 17 cases of chorioptic mange in 13 equids. Equids were included if clinical findings were indicative of chorioptic mange, chorioptes mites were positively identified and concurrent disease that could affect response to disease was not evident. A random number table was used to allocate subjects to receive doramectin (group D, eight animals) or fipronil (group F, ni...
Nielsen MK, Fritzen B, Duncan JL, Guillot J, Eysker M, Dorchies P, Laugier C, Beugnet F, Meana A, Lussot-Kervern I, von Samson-Himmelstjerna G.Development of resistance of several important equine parasites to most of the available anthelmintic drug classes has led to a reconsideration of parasite control strategies in many equine establishments. Routine prophylactic treatments based on simple calendar-based schemes are no longer reliable and veterinary equine clinicians are increasingly seeking advice and guidance on more sustainable approaches to equine parasite control. Most techniques for the detection of equine helminth parasites are based on faecal analysis and very few tests have been developed as diagnostic tests for resistan...
Bruce V, Turek RJ.The gluteus medius of two killed Thoroughbred horses were sampled along the muscle and across the muscle at four different depths. The distribution of fibre types in these two horses was assessed by staining cross sections of the muscle sample for ATPase. A non-uniform distribution of fibre types was found within the gluteus medius in both horses and there was a significant increase in percentage of slow twitch (ST) fibres from the surface to the deeper regions of the muscle. The rate of increase, however, depended on the individual site along the muscle. Averages ranges from a low of 2.4 per ...
Goodrich EL, Behling-Kelly E.Given the stoic nature of donkeys and their hybrids, it is important to consider the significance of diagnostic testing modalities that can provide objective health status information beyond the basic physical examination findings. However, clinical pathology assays are also fraught with significant limitations because the results for donkeys, mules, and hinnies can be difficult to interpret, and transference of data from the horse is not always applicable. This article presents considerations for sample collection, storage, analysis, and interpretation strategies for clinical pathology testin...
Chiers K, Deschaght P, De Baere T, Dabrowski S, Kotlowski R, De Clercq D, Ducatelle R, Vaneechoutte M.Routine cultivation methods are able to distinguish between isolates of the Mycobacterium avium and the Mycobacterium tuberculosis complex. However, molecular tools are needed to further identify the several subspecies in the M. avium complex, especially for the subspecies avium and silvaticum. A rapid technique using HhaI restriction digestion of a 349 bp amplification product of the 85B antigen (α-antigen) gene was used for the identification of M. avium subsp. silvaticum in a three-year-old gelding presenting with caseous, necrotizing, granulomatous lesions. The result was confirmed by seq...
Blanchard TL, Kenney RM, Timoney PJ.Equine venereal infections of concern in the United States include EHV-3, T. equigenitalis, P. aeruginosa, and K. pneumoniae. Stallions may also harbor EAV in the genital tract and transmit the virus to mares during coitus. With the exception of EHV-3, the stallion generally remains asymptomatic while transmitting infections to mares during breeding. Methods for diagnosis, treatment, and control of these infections are discussed.
Tsuzuki N, Otsuka K, Seo J, Yamada K, Haneda S, Furuoka H, Tabata Y, Sasaki N.This study evaluated the therapeutic effects of a gelatin-β-TCP sponge (sponge) incorporating BMP-2 (BMP-2/sponge) on bone regeneration in equines. Six bone defects were created in third metacarpals of five thoroughbred horses, and a total of six treatments were applied in a randomized manner. The treatments were BMP-2/sponge, BMP-2/gelatin hydrogel sheet (sheet), free BMP-2, bFGF/sheet, plain sponge, and plain sheet. The defects were monitored for 16 weeks by radiography and then examined by histological analysis. Radiographic evaluation scores of bone regeneration revealed significantly gre...
Haussler KK, Martin CE, Hill AE.Spinal mobilisation and spinal manipulative therapy (SMT) are being applied to horses; however, there are limited objective measures of their effects on spinal mobility or stiffness in actively ridden horses. Objective: To quantify passive spinal movements induced during dorsoventral mobilisation of the trunk and to identify any potential effects of SMT on measures of spinal mobility within the thoracolumbar region in standing horses. We hypothesise that displacement amplitudes will be significantly increased across vertebral levels after SMT, compared to spinal mobilisation only within the co...
Akter R, Stent AW, Sansom FM, Gilkerson JR, Burden C, Devlin JM, Legione AR, El-Hage CM.Chlamydia psittaci was detected by PCR in the lung and equine foetal membranes of two aborted equine foetuses and one weak foal from two different studs in Victoria, Australia. The abortions occurred in September 2019 in two mares sharing a paddock northeast of Melbourne. The weak foal was born in October 2019 in a similar geographical region and died soon after birth despite receiving veterinary care. The detection of C. psittaci DNA in the lung and equine foetal membranes of the aborted or weak foals and the absence of any other factors that are commonly associated with abortion or neonatal ...
Laseca N, Molina A, Valera M, Antonini A, Demyda-Peyrás S.Copy number variations (CNVs) are a new-fangled source of genetic variation that can explain changes in the phenotypes in complex traits and diseases. In recent years, their study has increased in many livestock populations. However, the study and characterization of CNVs in equines is still very limited. Our study aimed to investigate the distribution pattern of CNVs, characterize CNV regions (CNVRs), and identify the biological pathways affected by CNVRs in the Pura Raza Española (PRE) breed. To achieve this, we analyzed high-density SNP genotyping data (670,804 markers) from a large cohort...
Nielsen SS, Bicout DJ, Calistri P, Canali E, Drewe JA, Garin-Bastuji B, Gonzales Rojas JL, Gortazar Schmidt C, Herskin M, Michel V, Miranda Chueca MA....In this opinion, the antimicrobial-resistant bacteria responsible for transmissible diseases that constitute a threat to the health of horses have been assessed. The assessment has been performed following a methodology composed of information collected via an extensive literature review and expert judgement. Details on the methodology used for this assessment are explained in a separate opinion. A global state of play of antimicrobial-resistant spp. spp. and subsp and subsp. and subsp. has been provided. Among those bacteria, EFSA identified , and with more than 66% certainty as the mo...
Bollig ER, Granick JL, Webb TL, Ward C, Beaudoin AL.Antimicrobials are critical for medicine, but the problem of antimicrobial resistance (AMR) threatens the effectiveness of these valuable drugs. In USA, there are no national- or state-level programs or policies in place to track antibiotic use (AU) in dogs, cats, and horses, despite acknowledgement of this sector's importance to both the AMR problem and its solution. AU measurement is a key part of antibiotic stewardship and AMR prevention. This study aimed to fill existing gaps in the veterinary professions' knowledge of antibiotic prescribing in small animals and horses. To address this aim...
Gunther-Harrington CT, Arthur R, Estell K, Martinez Lopez B, Sinnott A, Ontiveros E, Varga A, Stern JA.Exercise induced cardiac fatigue (EICF) and cardiac dysrhythmias are well described conditions identified in high-level human athletes that increase in frequency with intensity and duration of exercise. Identification of these conditions requires an understanding of normal pre- and post-race cardiac assessment values. The objectives of this study were to (1) characterize selected indices of cardiac function, electrophysiologic parameters, and biochemical markers of heart dysfunction prior to and immediately after high level racing in Thoroughbred horses receiving furosemide; and (2) create pre...
Popescu S, Lazar EA, Borda C, Niculae M, Sandru CD, Spinu M.This paper investigates the effect of different housing conditions on the welfare quality of breeding horses. Using a welfare protocol that included health and behavioral parameters, 330 stallions (kept in tie-stall housing) and 365 broodmares (kept in extensive, mostly free housing) were assessed. The horses were categorized into four welfare categories ("not classified", "acceptable", "enhanced" and "excellent"), according to an individual welfare score calculated for each horse. The prevalence of stallions with dyspnea, tendon and joint swellings, abnormal gait and abnormal hoof horn qualit...
Divers TJ.Organ thrombosis and laminitis are life-threatening complications in horses with acute gastrointestinal disease, especially those diseases that cause disruption of the protective mucosal barrier. Prevention of these complications should be a high priority when treating horses with gastrointestinal diseases because even with proper and intensive treatments, laminitis or organ thrombosis may not be curative. Preventative therapy should include expedient and appropriate treatment of the primary disease, normalization of tissue perfusion and oxygenation, and inhibition of gut-derived toxins or the...
Monahan CM, Chapman MR, Taylor HW, French DD, Klei TR.Three groups of foals were raised under different management programs in this study: Group 1 (n = 6) and Group 2 (n = 6) were raised with their dams on pasture; Group 3 foals (n = 5) were raised under parasite-free conditions. Mares and foals of Group 1 received daily pyrantel tartrate (PT) treatment with their pelleted feed ration, whereas mares and foals of Groups 2 and 3 received only the pelleted ration. Pasture-reared foals were weaned and moved to a heavily contaminated pasture for 5 weeks. Group 1 foals continued to receive daily PT treatment whereas Group 2 foals received only the pell...
