Analyze Diet

Topic:Arabian Horses

Arabian horses are a distinct breed known for their endurance, intelligence, and distinctive physical characteristics, including a refined head shape and high tail carriage. Originating from the Arabian Peninsula, these horses have played a significant role in the development of various modern horse breeds. Their genetic makeup contributes to their unique attributes, which include a strong cardiovascular system and efficient energy metabolism, making them well-suited for long-distance riding and endurance competitions. This page aggregates peer-reviewed research studies and scholarly articles that explore the genetics, physiology, and performance attributes of Arabian horses, as well as their influence on other horse breeds and their role in equine sports and breeding programs.
Equine pythiosis in Egypt: clinicopathological findings, detection, identification and genotyping of Pythium insidiosum.
Veterinary dermatology    April 28, 2020   Volume 31, Issue 4 298-e73 doi: 10.1111/vde.12845
Tartor YH, Hamad MH, Abouzeid NZ, El-Belkemy FA.Equine pythiosis is an emerging, devastating disease that is hard to treat. The tumour-like nodular skin masses grow rapidly and the outcome is generally fatal, and thus early diagnosis and intervention are important. Objective: (i) To highlight the clinical, histological and haematological findings in pythiosis, and (ii) to evaluate the efficacy of direct sample multiplex-PCR targeting the single nucleotide polymorphisms within the ribosomal DNA region for detection and genotyping of Pythium insidiosum. Methods: Two hundred and twenty horses including 204 Arabian and 16 draft horses were surv...
Genes encoding equine β-lactoglobulin (LGB1 and LGB2): Polymorphism, expression, and impact on milk composition.
PloS one    April 22, 2020   Volume 15, Issue 4 e0232066 doi: 10.1371/journal.pone.0232066
Wodas L, Mackowski M, Borowska A, Puppel K, Kuczynska B, Cieslak J.β-lactoglobulin is one of the most abundant milk whey proteins in many mammal species, including the domestic horse. The aim of this study was to screen for polymorphism in the equine LGB1 and LGB2 gene sequences (all exons, introns, and 5'-flanking region) and to assess potential relationship of particular genotypes with gene expression levels (measured in milk somatic cells) and milk composition traits (protein, fat, lactose, and total β-lactoglobulin content). Direct DNA sequencing analysis was performed for twelve horse breeds: Polish Primitive Horse (PPH), Polish Coldblood Horse (PCH), ...
Whole genome detection of sequence and structural polymorphism in six diverse horses.
PloS one    April 9, 2020   Volume 15, Issue 4 e0230899 doi: 10.1371/journal.pone.0230899
Al Abri MA, Holl HM, Kalla SE, Sutter NB, Brooks SA.The domesticated horse has played a unique role in human history, serving not just as a source of animal protein, but also as a catalyst for long-distance migration and military conquest. As a result, the horse developed unique physiological adaptations to meet the demands of both their climatic environment and their relationship with man. Completed in 2009, the first domesticated horse reference genome assembly (EquCab 2.0) produced most of the publicly available genetic variations annotations in this species. Yet, there are around 400 geographically and physiologically diverse breeds of hors...
The Oxidative Stress Markers of Horses-the Comparison with Other Animals and the Influence of Exercise and Disease.
Animals : an open access journal from MDPI    April 3, 2020   Volume 10, Issue 4 617 doi: 10.3390/ani10040617
Shono S, Gin A, Minowa F, Okubo K, Mochizuki M.Diacron-reactive oxygen metabolite (d-ROM) and biological antioxidant potential (BAP) levels in the serum of horses were measured (ponies, = 15; thoroughbred, = 31; other full-sized horses, = 7). The mean d-ROM levels in horses were significantly higher ( < 0.001) than those in dairy cattle ( = 25) and dogs ( = 31). However, d-ROM levels in horses were lower than the standard levels reported in humans. When d-ROM and BAP levels were plotted graphically, the points for horses with a disease (ringbone in 1 Japanese sports horse, cellulitis in 1 thoroughbred, melanoma in 1 Lipizzaner) fell ...
Effects of acepromazine and xylazine on subjective and objective assessments of forelimb lameness.
Equine veterinary journal    February 17, 2020   Volume 52, Issue 4 593-600 doi: 10.1111/evj.13225
Morgan JM, Ross MW, Levine DG, Stefanovski D, You Y, Robinson MA, Davidson EJ.To facilitate lameness evaluation, sedatives such as xylazine and acepromazine are regularly used in the clinical setting, despite concerns that they may confound lameness assessment. Objective: The objective of this study was to determine the effect of low doses of acepromazine and xylazine on subjective and objective lameness assessment. Methods: Randomised, blinded, crossover study. Methods: Six horses with experimentally induced solar pain were evaluated over a 1-hour period after treatment with intravenous xylazine (0.1 or 0.2 mg/kg), intravenous acepromazine (0.02 or 0.04 mg/kg), intra...
Enterolithiasis in horses: analysis of 15 cases treated surgically in Saudi Arabia.
Iranian journal of veterinary research    February 12, 2020   Volume 20, Issue 4 270-276 
Turek B, Witkowski M, Drewnowska O.The equine colic, which is caused by the presence of enteroliths that are most often found in the small or large colon, is typical for certain geographical regions (dry and hot climate). A diet rich in alfalfa is one of the highest risk factors. The earliest symptoms include weight loss and repeated episodes of colic pain. To present the results of operative treatment of 15 horses with enteroliths in Saudi Arabia. Methods: Fifteen purebred Arabian horses in Saudi Arabia, aged between 2 and 18 years, were treated. Decision about the surgery was based on clinical exam, ultrasound and rectal exa...
Plasma disposition of gabapentin after the intragastric administration of escalating doses to adult horses.
Journal of veterinary internal medicine    February 8, 2020   Volume 34, Issue 2 933-940 doi: 10.1111/jvim.15724
Gold JR, Grubb TL, Green S, Cox S, Villarino NF.In humans, gabapentin an analgesic, undergoes non-proportional pharmacokinetics which can alter efficacy. No information exists on the pharmacokinetics of dosages >20 mg/kg, escalating dosages or dose proportionality of gabapentin in horses. Objective: Gabapentin exposure in plasma would not increase proportionally relative to the dose in horses receiving dosages ≥20 mg/kg. To assess the plasma pharmacokinetics of gabapentin after nasogastric administration of gabapentin at dosages of 10 to 160 mg/kg in adult horses. Methods: Nine clinically healthy adult Arabian and Quarter Horses....
Evaluation of Return Rates to Races in Racehorses After Tendon Injuries: Lesion-Related Parameters.
Journal of equine veterinary science    January 23, 2020   Volume 87 102931 doi: 10.1016/j.jevs.2020.102931
Ülke ÇG, Deniz SI, Nureddin Ç.Metacarpal tendon diseases are important problems that may cause a decrease in performance and even may finish sport life in equine athletes. In this study, it was aimed to evaluate the ratio of return to races and the time of staying away from races and also to detect the prognostic value of ultrasonographic findings in Thoroughbred and Arabian racehorses with metacarpal flexor tendon injury or peritendonitis. Of 120 cases, 84 (70.0%) returned to races. Among these, 82.1% had tendonitis (69/84) and 17.9% peritendonitis (15/84). Among the cases being unable to return to races, 91.7% had tendon...
Serum acylcarnitine profile in endurance horses with and without metabolic dysfunction.
Veterinary journal (London, England : 1997)    December 10, 2019   Volume 255 105419 doi: 10.1016/j.tvjl.2019.105419
van der Kolk JH, Thomas S, Mach N, Ramseyer A, Burger D, Gerber V, Nuoffer JM.Mitochondrial β-oxidation is essential in fat metabolism and can be monitored with blood acylcarnitine profiling, as partly degraded fatty acids accumulate as their carnitine esters. To guarantee continuous energy supply during long-distance exercise, endurance horses oxidise considerable amounts of fat in the mitochondrion. In endurance races over 80 km, glycogen depletion is evident in equine slow-twitch high oxidative muscle fibres and as a consequence, horses participating in endurance races over 80 km rely almost entirely on β-oxidation of fatty acids. This study investigated mitoch...
Season’s Effects on Some Clinical, Hematological Parameters and Blood Cortisol Level in Sedated Arabian Horses With Xylazine.
Journal of equine veterinary science    November 9, 2019   Volume 84 102835 doi: 10.1016/j.jevs.2019.102835
Shawaf T, Al Mubarak A, Eidi H, El-Bahr SM.Influence of heat or cold stress in sedated animals is unclear and requires further investigations. The present study aimed to evaluate the season's effects on some clinical, hematological parameters and blood cortisol level in sedated Arabian horses with xylazine. Therefore, seven Arabian horses were used to investigate heart and respiratory rates, and capillary refill time and serum cortisol level were recorded before (0) and at 5, 15, 60, and 180 minutes postsedation. Heparinized venous samples were collected before (0) and 3 hours postsedation for analysis of hematological analysis. Arte...
TRIM39-RPP21 Variants (∆19InsCCC) Are Not Associated with Juvenile Idiopathic Epilepsy in Egyptian Arabian Horses.
Genes    October 16, 2019   Volume 10, Issue 10 816 doi: 10.3390/genes10100816
Rivas VN, Aleman M, Peterson JA, Dahlgren AR, Hales EN, Finno CJ.Juvenile idiopathic epilepsy (JIE) is an inherited disease characterized by recurrent seizures during the first year of life in Egyptian Arabian horses. Definitive diagnosis requires an electroencephalogram (EEG) performed by a veterinary specialist. A recent study has suggested that a 19 base-pair deletion, along with a triple-C insertion, in intron five of twelve (∆19InsCCC; chr20:29542397-29542425: GTTCAGGGGACCACATGGCTCTCTATAGA>TATCTTAAGACCC) of the () gene is associated with JIE. To confirm this association, a new sample set consisting of nine EEG-phenotyped affected and nine unaffec...
Acute-phase protein profile in horses subjected to different exercise protocols.
Canadian journal of veterinary research = Revue canadienne de recherche veterinaire    October 2, 2019   Volume 83, Issue 4 272-278 
Assunção P, Barbosa T, Yonezawa L, Barbosa L, Watanabe M, Kohayagawa A, Schmidt E.High-intensity exercise can be associated with the occurrence of muscle injury, as well as the induction of an acute-phase response (APR). The present study aims to investigate the synthesis and profile of serum proteins in horses before and after participating in 2 different exercise protocols and to relate this profile to the presence or absence of muscular injury caused by exercise. Ten purebred Arabian (n = 5) and Criollo (n = 5) horses were subjected to 2 different tests on a treadmill, one consisting of short-duration and rapid-acceleration training (TRA) that was mostly anerobic and the...
Effect of inbreeding on the “Club Foot” disorder in Arabian Pureblood horses reared in Italy.
Open veterinary journal    September 29, 2019   Volume 9, Issue 3 273-280 doi: 10.4314/ovj.v9i3.14
Comparini L, Podestà A, Russo C, Cecchi F."The Club Foot" (or "Mismatched Foot") is an acquired or congenital flexural deformity of the distal interphalangeal joint, caused by a shortening of the musculotendinous unit of the deep digital flexor tendon. The aim of this research was to detect the incidence of the disorder in Arabian Pureblood horses, attempting to understand its causes and to analyze a possible role of inbreeding in its expression. In this breed, in fact, the pathology is widespread because in the environment of origin, the rocky desert, a hard and almost goat's hoof is not disabling so the selection against this disord...
Breed and stallion effects on frozen-thawed semen in warmblood, light and quarter horses.
Theriogenology    September 19, 2019   Volume 142 8-14 doi: 10.1016/j.theriogenology.2019.09.033
Greiser T, Sieme H, Martinsson G, Distl O.The objectives of the present study were to analyze systematic effects on semen quality traits from fresh and frozen-thawed semen collected in and outside season. A total of 4,681 reports on semen traits of 121 stallions representing Arabian, Thoroughbred, Quarter Horse and four warmblood breeds used for artificial insemination at the Lower Saxon National stud Celle were edited for analysis of gel-free volume, sperm concentration, total number of sperm and total number of motile sperm in fresh semen and in frozen-thawed semen progressive motility, DNA fragmentation index and non-viable sperm. ...
Clinical, hematologic, hemostatic, and serum biochemical findings related to survival in Arabian horses with colic.
Veterinary clinical pathology    September 17, 2019   Volume 48, Issue 3 441-448 doi: 10.1111/vcp.12779
Nikvand AA, Jalali SM, Ghadrdan Mashhadi A, Razi Jalali M, Hassanpour Amirabadi S.The efficacy of clinical examinations, and hematologic, hemostatic, and serum biochemical assessments to determine appropriate early medical or surgical therapy in Arabian horses with colic have not been well-described. Objective: We aimed to evaluate clinical and hematologic findings, coagulation-fibrinolytic parameters, and organ dysfunction markers in association with survival in horses with colic. Methods: Seventeen Arabian horses with colic and ten healthy horses were enrolled. After clinical examinations, including heart rates (HRs), capillary refill times (CRTs), abdominal sounds, recta...
Additional Evidence for DDB2 T338M as a Genetic Risk Factor for Ocular Squamous Cell Carcinoma in Horses.
International journal of genomics    September 15, 2019   Volume 2019 3610965 doi: 10.1155/2019/3610965
Singer-Berk MH, Knickelbein KE, Lounsberry ZT, Crausaz M, Vig S, Joshi N, Britton M, Settles ML, Reilly CM, Bentley E, Nunnery C, Dwyer A....Squamous cell carcinoma (SCC) is the most common periocular cancer in horses and the second most common tumor of the horse overall. A missense mutation in damage-specific DNA-binding protein 2 (DDB2, c.1012 C>T, p.Thr338Met) was previously found to be strongly associated with ocular SCC in Haflinger and Belgian horses, explaining 76% of cases across both breeds. To determine if this same variant in DDB2 contributes to risk for ocular SCC in the Arabian, Appaloosa, and Percheron breeds and to determine if the variant contributes to risk for oral or urogenital SCC, histologically confirmed SCC c...
The use of the SLC16A1 gene as a potential marker to predict race performance in Arabian horses.
BMC genetics    September 11, 2019   Volume 20, Issue 1 73 doi: 10.1186/s12863-019-0774-4
Ropka-Molik K, Stefaniuk-Szmukier M, Szmatoła T, Piórkowska K, Bugno-Poniewierska M.Arabian horses are commonly believed to be one of the oldest and the most popular horse breeds in the world, characterized by favourable stamina traits and exercise phenotypes. During intensive training, the rates of lactate production and utilization are critical to avoid muscle fatigue and a decrease in exercise performance. The key factor determining transmembrane lactate transport is the monocarboxylate transporter 1 protein coded for by the SLC16A1 gene. The aim of the present research was to identify polymorphisms in the coding sequence and UTRs in the equine SLC16A1 gene and to evaluate...
The Genetics of Racing Performance in Arabian Horses.
International journal of genomics    September 2, 2019   Volume 2019 9013239 doi: 10.1155/2019/9013239
Ropka-Molik K, Stefaniuk-Szmukier M, Musiał AD, Velie BD.Arabian horses are commonly believed to be one of the oldest and most influential horse breeds in the world. The high financial benefits obtained from races tend to search for genetic markers strongly correlated with the results achieved. To date, the modern approaches such as transcriptome, miRNAome, and metabolome analyses have been used to investigate the genetic background of racing performance as well as endurance capacity in Arabians. The analysis of polymorphisms at the genome level has also been applied to the detection of genetic variants associated with exercise phenotype in the Arab...
Anti-Inflammatory State in Arabian Horses Introduced to the Endurance Training.
Animals : an open access journal from MDPI    August 27, 2019   Volume 9, Issue 9 616 doi: 10.3390/ani9090616
Witkowska-Piłaszewicz O, Bąska P, Czopowicz M, Żmigrodzka M, Szarska E, Szczepaniak J, Nowak Z, Winnicka A, Cywińska A.Development of an anti-inflammatory state during physical training has been postulated in both human and equine athletes, but it is not completely understood. The aim of this study was to investigate whether endurance training changes pro- and anti-inflammatory cytokine profiles within a 20-week training season in young inexperienced endurance horses. Nine Arabian horses were examined in this prospective 20-week follow-up study. Blood samples were analysed 5 times monthly, at rest and after training sessions. Routine haematological examinations were performed. Cytokine patterns including IL-1...
The Blood and Muscle Expression Pattern of the Equine TCAP Gene during the Race Track Training of Arabian Horses.
Animals : an open access journal from MDPI    August 18, 2019   Volume 9, Issue 8 574 doi: 10.3390/ani9080574
Stefaniuk-Szmukier M, Szmatoła T, Łątka J, Długosz B, Ropka-Molik K.Horse musculature has been shaped through evolution by environmental and human factors, which has resulted in several extraordinary adaptations to physical effort. Skeletal muscle plasticity results from the response to mechanical stimulation causing hypertrophy, where sarcomeres increase the muscle's cross-sectional area under the influence of contractile forces. The aim of the present study was the evaluation of transcript abundance of the telethonin () gene, which is a part of the sarcomere macromolecular mechanosensory complex in the gluteus medius muscle, and the whole blood of Arabian ho...
ACTN3 genotype distribution across horses representing different utility types and breeds.
Molecular biology reports    August 7, 2019   Volume 46, Issue 6 5795-5803 doi: 10.1007/s11033-019-05013-0
Musiał AD, Ropka-Molik K, Piórkowska K, Jaworska J, Stefaniuk-Szmukier M.In horses, the identification of the genetic background of phenotypic variation, especially with regard to performance characteristics and predisposition to effort, has been extensively studied. As α-actinin-3 function is related to the regulation of muscle contraction and cell metabolism, the ACTN3 gene is considered one of the main genetic factors determining muscle strength. The aim of the present study was to assess the genotype distribution of two SNP variants within the equine ACTN3 gene (g.1104G > A and c.2334C > T) across different utility types and horse breeds. The ana...
Retrospective study of the reproductive performance of Barb and Thoroughbred stallions in Algeria.
Veterinary world    July 26, 2019   Volume 12, Issue 7 1132-1139 doi: 10.14202/vetworld.2019.1132-1139
Aouane N, Nasri A, Bekara MAA, Metref AK, Kaidi R.The Barb horse occupies a prominent place in the history, culture, and equestrian traditions of the Maghreb (Algeria, Morocco, and Tunisia). Although many studies on the breed standard and morphometry have been published, there are no studies on its fertility and reproductive potential. Thus, this work aimed to study the fertility of Barb, Arabian Purebred, and Thoroughbred horses in Algeria. Methods: A total of 168 stallions and 1202 mares at the Chaouchaoua Stud farm in Tiaret, Algeria, were included in the study. The reproductive performance during 1592 cycles over 10 consecutive mating sea...
Plasma Apelin Concentration in Exercised Horses: Preliminary Study.
Journal of equine veterinary science    July 3, 2019   Volume 80 16-19 doi: 10.1016/j.jevs.2019.06.012
Kędzierski W, Cywińska A, Wawak T, Janczarek I, Wilk I, Kowalik S.Physical effort is one of the key aspects of keeping horses in good condition. The condition of the animal is reflected by multiple blood parameters. The newly discovered cytokine-apelin can pose one of them, however, so far, has not been studied in the horse population. Apelin is produced by adipocytes and myocytes and plays an important role in the energy metabolism of the body through the influence, for example, on the process of adipogenesis and lipolysis. The aim of this study was to investigate if physical effort of various intensity affects the plasma concentration of apelin in horses. ...
Changes in Serum Amyloid A (SAA) Concentration in Arabian Endurance Horses During First Training Season.
Animals : an open access journal from MDPI    June 8, 2019   Volume 9, Issue 6 330 doi: 10.3390/ani9060330
Witkowska-Piłaszewicz O, Bąska P, Czopowicz M, Żmigrodzka M, Szczepaniak J, Szarska E, Winnicka A, Cywińska A.Sport training leads to adaptation to physical effort that is reflected by the changes in blood parameters. In equine endurance athletes, blood testing is accepted as a support in training, however, only the changes before versus after exercise in creatine phosphokinase activity (CPK) and basic blood parameters are usually measured. This study is the first longitudinal investigation of the changes in routinely measured blood parameters and, additionally, serum amyloid A (SAA), during seven months, in Arabian horses introduced to endurance training and competing in events for young horses. It h...
Isolation and identification of cellulolytic bacteria from gastrointestinal tract of Arabian horse and investigation of their effect on the nutritional value of wheat straw.
Journal of applied microbiology    June 7, 2019   Volume 127, Issue 2 344-353 doi: 10.1111/jam.14251
Shakarami MH, Mohammadabadi T, Motamedi H, Sari M, Teimouri Yansari A.This study was conducted to isolate and identify the cellulolytic bacteria from gastrointestinal tract of Arabian horse and investigate their effect on the nutritional value of wheat straw (WS). Results: Fresh faeces were collected from four Arabian horses. The cellulose-hydrolytic bacteria were isolated by using a medium amended with carboxymethyl cellulose (CMC). The activity of CMC was determined by measuring the release of reducing sugars from CMC. Among the isolates, four isolates (L11, L12, L2 and Z2) showed maximum hydrolysis capacity. 16S rRNA sequence analysis showed that these isolat...
Detection of equid herpesviruses among different Arabian horse populations in Egypt.
Veterinary medicine and science    May 31, 2019   Volume 5, Issue 3 361-371 doi: 10.1002/vms3.176
Azab W, Bedair S, Abdelgawad A, Eschke K, Farag GK, Abdel-Raheim A, Greenwood AD, Osterrieder N, Ali AAH.Equid herpesviruses (EHVs) threaten equine health and can cause significant economic losses to the equine industry worldwide. Different equid herpesviruses, EHV-1, EHV-2, EHV-4 and EHV5 are regularly detected among horse populations. In Egypt, monitoring is sporadic but EHV-1 or EHV-4 have been reported to circulate in the horse population. However, there is a lack of reports related to infection and health status of horses, likely due to the absence of regular diagnostic procedures. In the current study, the circulation of four infectious equid herpesviruses (EHV-1, EHV-2, EHV-4 and EHV-5) am...
Surveillance of the equine infectious anemia virus in Eastern and Central Saudi Arabia during 2014-2016.
Veterinary world    May 29, 2019   Volume 12, Issue 5 719-723 doi: 10.14202/vetworld.2019.719-723
Alnaeem AA, Hemida MG.Equine infectious anemia virus (EIAV) is one of the most important threats to the equine industry globally. This is due to the poor performance of the affected horses, which requires euthanization of the infected animals upon the infection confirmation. Infected animals remain carriers throughout their life. EIAV infection has been reported in many parts of the world, including North America, Europe, Asia, and Africa. However, the EIAV status is never assessed in horses in the Gulf area, especially in the Kingdom of Saudi Arabia (KSA). Objective: This study aimed to perform molecular and serol...
Chinese Mongolian horses may retain early domestic male genetic lineages yet to be discovered.
Animal genetics    May 9, 2019   Volume 50, Issue 4 399-402 doi: 10.1111/age.12780
Han H, Wallner B, Rigler D, MacHugh DE, Manglai D, Hill EW.The Mongolian horse represents one of the most ancient extant horse populations. In this study we determined the male-specific region of the Y chromosome (MSY) haplotype distribution in 60 Chinese Mongolian horses representing five distinct populations. Cosmopolitan male lineages were predominant in horses from one improved (Sanhe), one Chinese Mongolian subtype (Baicha Iron Hoof) and one indigenous (Abaga Black) population. In contrast, autochthonous Y chromosome diversity was evident among the two landrace populations (Wushen and Wuzhumuqin), as the majority of their MSY haplotypes were situ...
Subconjunctival nodule due to Setaria equina erratic migration in a horse: First case report.
Veterinary ophthalmology    May 2, 2019   Volume 22, Issue 6 921-927 doi: 10.1111/vop.12675
Regnier A, Martin C, Semin MO, Lienard E, Geffre A, Douet JY, Raymond-Letron I.An 18-month-old Arabian-English filly resident in southwest France was referred for evaluation of a conjunctival mass in the right eye (OD). A pink, solid, and mobile nodular formation, measuring approximately 1.2 × 0.8 cm was found under the superior nasal bulbar conjunctiva during an ophthalmic examination that was otherwise normal. The mass was surgically removed using a standing procedure. Cytological examination of fine-needle aspirates from the mass revealed a mixed eosinophilic-lymphocytic inflammation. Histological examination confirmed the dense and diffuse eosinophilic-lymphocyti...
Genetic screening for cerebellar abiotrophy, severe combined immunodeficiency and lavender foal syndrome in Arabian horses in Poland.
Veterinary journal (London, England : 1997)    April 27, 2019   Volume 248 71-73 doi: 10.1016/j.tvjl.2019.04.012
Bugno-Poniewierska M, Stefaniuk-Szmukier M, -Kajtoch AP, Fornal A, Piórkowska K, Ropka-Molik K.The highly selective breeding of Arabian horses results in inbreeding depression and genetic disorders, thereby causing significant economic loss. The Polish population of Arabians has a great impact on many breeding programmes. The aim of the current study was to monitor genetic variants involved in the most common genetic disorders of this breed. A total of 808 elite Arabian horses were screened for cerebellar abiotrophy (CA), severe combined immunodeficiency (SCID) and lavender foal syndrome (LFS) genetic disorders by Sanger sequencing and allelic discrimination methods. The investigated po...
1 5 6 7 8 9 28