Analyze Diet

Topic:Arabian Horses

Arabian horses are a distinct breed known for their endurance, intelligence, and distinctive physical characteristics, including a refined head shape and high tail carriage. Originating from the Arabian Peninsula, these horses have played a significant role in the development of various modern horse breeds. Their genetic makeup contributes to their unique attributes, which include a strong cardiovascular system and efficient energy metabolism, making them well-suited for long-distance riding and endurance competitions. This page aggregates peer-reviewed research studies and scholarly articles that explore the genetics, physiology, and performance attributes of Arabian horses, as well as their influence on other horse breeds and their role in equine sports and breeding programs.
Affecting Lipid Metabolism Salivary MicroRNAs Expressions in Arabian Racehorses Before and After the Race.
Journal of equine veterinary science    August 8, 2020   Volume 93 103218 doi: 10.1016/j.jevs.2020.103218
Ekici S, Ozmen O.The active roles of microribonucleic acids (miRNAs) in gene regulation have made miRNAs a key point for the scientific world in the study of physiological processes. Although saliva includes the largest number of miRNAs, there is no miRNA study in saliva on horses has been found. Our study is the first study on miRNAs isolation from saliva in horses. In the present study, saliva was studied in Arabian racehorses to better understand the molecular mechanisms of expression levels that are effective in lipid metabolism of miRNAs and their target genes during the race. Identification of lipid meta...
Changes in blood biomarkers in Arabian horses with Clostridium difficile-induced enterocolitis.
Comparative immunology, microbiology and infectious diseases    August 7, 2020   Volume 73 101525 doi: 10.1016/j.cimid.2020.101525
El-Deeb W, Fayez M, Elsohaby I, Mkrtchyan HV, Alhaider A.Clostridium difficile (CD) is considered a major health care problem both in developing and developed countries; frequently reported to be associated with enterocolitis and diarrhea in horses and other animals. In this study, we examined acute phase response (APR), cytokines response, neopterin (NP) procalcitonin (PCT) production and oxidative stress condition in horses and foals with C. difficile-induced enterocolitis (CDIE) and evaluated the effectiveness of these parameters as biomarkers for the disease. A total of 407 Arabian horses in 35 stables were examined between January 2017 to Decem...
Congenital Osteoma of the Frontal Bone in an Arabian Filly.
Journal of equine veterinary science    August 7, 2020   Volume 93 103217 doi: 10.1016/j.jevs.2020.103217
Abu-Seida AM, Shamaa AA.Congenital frontal osteoma has not been previously described in horses. This report records-for the first time-a congenital osteoma of the frontal bone in a 4-month-old Arabian filly. The filly had a frontal hard mass that was present at birth and then showed a slow and continuous growth. This mass appeared as a solitary, painless, oval dense tumor of compact bone, about 2 cm in diameter and 3 cm in length. The tumor was asymptomatic, and the skin over the mass was normal. Radiography revealed a well-defined oval, radio-dense mass projecting from the surface of the right frontal bone with no...
Variation in the SLC16A1 and the ACOX1 Genes Is Associated with Gallop Racing Performance in Arabian Horses.
Journal of equine veterinary science    August 5, 2020   Volume 93 103202 doi: 10.1016/j.jevs.2020.103202
Fontanel M, Todd E, Drabbe A, Ropka-Molik K, Stefaniuk-Szmukier M, Myćka G, Velie BD.Arabian horses are not only one of the most ancient breeds in the world, but they are also one of the most appreciated racehorse breeds today. The breed generates attention for their phenomenal endurance ability and their capability for gallop racing. Consequently, genetic testing to select the best individuals is attracting ever increasing interests from the Arabian industry. As such, the aim of this study was to further investigate associations between performance and variation at candidate genes suspected of having a key role in Arabian gallop racing performance. Generalized linear models w...
Genetic Diversity and Population Structure of Arabian Horse Populations Using Microsatellite Markers.
Journal of equine veterinary science    July 31, 2020   Volume 93 103200 doi: 10.1016/j.jevs.2020.103200
Machmoum M, Boujenane I, Azelhak R, Badaoui B, Petit D, Piro M.Understanding the genetic diversity and the relationships among the show Arabian horse populations is a current issue for breeders and professionals. This study aimed to define the relationship among the Desert breed, the Straight Egyptian, and the Polish Arabian populations by considering the historical background of their origin and to verify their genetic diversity. All selected samples were related to Arabian show activities. One hundred forty four hair samples were collected from horses at stud farms having notoriety in the breeding of Arabians from different geographic regions. A set of ...
Clinical dental finding in Iranian horses.
Veterinary medicine and science    July 31, 2020   Volume 6, Issue 4 679-685 doi: 10.1002/vms3.329
Samad L, Tavanaeimanesh H, Mehr Azin H, Moadab SH, Vajhi AR.A horse's well-being is directly related to the management of its dental health. A good knowledge of the epidemiology and aetiology of dental disorders could help the owners and clinicians to prevent not only dental problems but also severe gastrointestinal diseases. In this study we report the prevalence of dental disorders in horses in Iran. We examined 317 horses randomly in eight provinces in Iran and 21 diseases were characterized in the examined horses. The observed diseases were compared among different breeds, genders and ages of the examined horses. The factor of age among the other t...
Basic Studies on the Oxidative Stress Markers in Two Types of Horse Breed: Semi-isolated Population of Huculs Is Different from Commercially Used Arabian Horses.
BioMed research international    July 13, 2020   Volume 2020 7542384 doi: 10.1155/2020/7542384
Bażanów BA, Chełmecka E, Romuk E, Stygar DM.Hucul and Arabian horses differ in the physiological constitution and exposition to environmental conditions. Oxidative stress plays a pathogenic role in many diseases and enables further injuries. The objective of this study was to compare the levels of enzymatic and nonenzymatic oxidative stress markers in Hucul horses living in seminatural conditions and in commercially handled Arabian horses. We tested the serum samples for total superoxide dismutase (total SOD), Cu-Zn-superoxide dismutase (CuZnSOD), and Mn-dependent superoxide dismutase (MnSOD) activity; for lipofuscin (LPS), ceruloplasmi...
Metabogenomics reveals four candidate regions involved in the pathophysiology of Equine Metabolic Syndrome.
Molecular and cellular probes    July 10, 2020   Volume 53 101620 doi: 10.1016/j.mcp.2020.101620
Patterson Rosa L, Mallicote MF, Long MT, Brooks SA.An analogous condition to human metabolic syndrome, Equine Metabolic Syndrome (EMS) is defined by several clinical signs including obesity, hyperinsulinemia, and peripheral insulin dysregulation (ID). Affected horses may also exhibit hypertension, hyperlipemia and systemic inflammation. Measures of ID typically comprise the gold-standard for diagnosis in veterinary care. Yet, the dynamic nature of insulin homeostasis and complex procedures of typical assays make accurate quantification of ID and EMS challenging. This work aimed to investigate new strategies for identification of biochemical ma...
Effects of endurance racing on horse plasma extracellular particle miRNA.
Equine veterinary journal    July 1, 2020   Volume 53, Issue 3 618-627 doi: 10.1111/evj.13300
de Oliveira GP, Porto WF, Palu CC, Pereira LM, Reis AMM, Marçola TG, Teixeira-Neto AR, Franco OL, Pereira RW.Physical exercise is an essential factor in preventing and treating metabolic diseases by promoting systemic benefits throughout the body. The molecular factors involved in this process are poorly understood. Micro RNAs (miRNAs) are small non-coding RNAs that inhibit mRNA transcription. MiRNAs, which can participate in the benefits of exercise to health, circulate in plasma in extracellular particles (EP). Horses that undergo endurance racing are an excellent model to study the impact of long-duration/low intensity exercise in plasma EP miRNAs. Objective: To evaluate the effects of 160 km end...
Combining Threshold, Thurstonian and Classical Linear Models in Horse Genetic Evaluations for Endurance Competitions.
Animals : an open access journal from MDPI    June 22, 2020   Volume 10, Issue 6 1075 doi: 10.3390/ani10061075
Cervantes I, Gutiérrez JP, García-Ballesteros S, Varona L.The racing time and rank at finish traits are commonly used for endurance horse breeding programs as a measure of their performance. Even so, given the nature of endurance competitions, many horses do not finish the race. However, the exclusion of non placed horses from the dataset could have an influence on the prediction of individual breeding values. The objective of the present paper was to develop a multitrait model including race time (T), rank (R) and placing (P), with different methodologies, to improve the genetic evaluation in endurance competitions in Spain. The database contained 6...
Genome Diversity and the Origin of the Arabian Horse.
Scientific reports    June 16, 2020   Volume 10, Issue 1 9702 doi: 10.1038/s41598-020-66232-1
Cosgrove EJ, Sadeghi R, Schlamp F, Holl HM, Moradi-Shahrbabak M, Miraei-Ashtiani SR, Abdalla S, Shykind B, Troedsson M, Stefaniuk-Szmukier M....The Arabian horse, one of the world's oldest breeds of any domesticated animal, is characterized by natural beauty, graceful movement, athletic endurance, and, as a result of its development in the arid Middle East, the ability to thrive in a hot, dry environment. Here we studied 378 Arabian horses from 12 countries using equine single nucleotide polymorphism (SNP) arrays and whole-genome re-sequencing to examine hypotheses about genomic diversity, population structure, and the relationship of the Arabian to other horse breeds. We identified a high degree of genetic variation and complex ances...
Unraveling the Genetics Behind Equid Cardiac Disease.
The Veterinary clinics of North America. Equine practice    June 10, 2020   Volume 36, Issue 2 235-241 doi: 10.1016/j.cveq.2020.03.004
Fousse SL, Stern JA.There have been some advances in understanding the genetic contribution to ventricular septal defects in Arabians, sudden death in racehorses, and atrial fibrillation in racehorses. No genetic analyses have been published for aortic rupture in Friesians or atrioventricular block in donkeys despite strong evidence for a genetic cause. To date, no genetic mutation has been identified for any equid cardiac disease. With the advancement of genetic tools and resources, we are moving closer to discoveries that may explain the heritable basis of inherited equid cardiac disease.
Ultrasonography and Surgical Treatment of an Unusual Case of Urethral Calculus in an Arabian Horse.
Journal of equine veterinary science    June 6, 2020   Volume 92 103150 doi: 10.1016/j.jevs.2020.103150
Abu-Seida AM, Shamaa AA.This case report records an obstructive urolithiasis due to a large calcium carbonate urethral stone in an 11-year-old Arabian stallion. The stallion had colicky pain, anuria, and reduction in food and water intakes. Palpation of the penis revealed rhythmic contractions of the urethra, a hard mass in the penile urethra at the level of the ischial arch, and a dilated urethra proximal to the mass. Rectal examination revealed a distended and turgid urinary bladder. Passing a urethral catheter revealed a complete urethral obstruction at the level of the ischial arch. Ultrasonography revealed a cal...
Morphological Characteristics of the Placenta and Umbilical Cord of Arabian Mares Foaling in the United Arab Emirates.
Journal of equine veterinary science    May 28, 2020   Volume 91 103124 doi: 10.1016/j.jevs.2020.103124
Wilsher S, Bowker A, Silva J, Allen WRT.A total of 127 normal placentas from Arabian mares resident in the United Arab Emirates were examined. The mean linear dimensions of the placenta were, on average, 84% of those previously recorded for the placentas of the Thoroughbred. Significant differences in the size of the allantochorion between primigravid and multiparous mares were seen only in the linear dimensions of the body portion. The pregnant horn was more commonly on the right than left side of the uterus (P = .01; 74/127; 58%). Cord attachment was primarily at the base of the two placental horns (112/127; 88%), with the remain...
Assessment of the FAM174A 11G allele as a risk allele for equine metabolic syndrome.
Animal genetics    May 15, 2020   Volume 51, Issue 4 607-610 doi: 10.1111/age.12952
Roy MM, Norton EM, Rendahl AK, Schultz NE, McFarlane D, Geor RJ, Mickelson JR, McCue ME.An 11G nucleotide repeat in the 3' UTR of FAM174A was recently postulated as a risk allele with a dominant mode of inheritance for equine metabolic syndrome (EMS) and laminitis status in Arabian horses. The objective of this project was to evaluate this hypothesis in a large and diverse across-breed population. A total of 301 ponies, 292 Morgans, 64 Arabians, 49 Tennessee Walking Horses and 59 Quarter Horses were genotyped for six observed G repeat alleles in the FAM174A 3' UTR. Phenotype data included laminitis status, baseline insulin, glucose, non-esterified fatty acids, triglycerides, adip...
Novel Streptococcus equi strains causing strangles outbreaks in Arabian horses in Egypt.
Transboundary and emerging diseases    May 10, 2020   Volume 67, Issue 6 2455-2466 doi: 10.1111/tbed.13584
Tartor YH, El-Naenaeey EY, Gharieb NM, Ali WS, Ammar AM.Strangles displays a major challenge to veterinary medicine worldwide. However, no data on Streptococcus equi subsp. equi (S. equi) M protein alleles have been reported so far from Arabian horses. We report here for the first time the S. equi SeM alleles causing strangles in Arabian horses, and the associated risk factors for the disease. Duplicate samples from one hundred Arabian horses with acute strangles in confirmed outbreaks and sporadic cases were analysed by phenotypic methods and multiplex polymerase chain reaction (PCR) targeting streptokinase precursor, seeI and sodA genes. PCR and ...
Use of autologous fascia lata graft to repair a complex corneal ulcer in a mare.
Irish veterinary journal    May 5, 2020   Volume 73 7 doi: 10.1186/s13620-020-00160-4
Lores M, Rakestraw P, De Rijck M, Yarbrough T.Application of an autogenous fascia lata graft in the treatment of keratomalacia in the horse has not been reported. The present case describes the use of an autologous fascia lata graft to surgically treat a complicated corneal ulcer in a horse. Methods: A 12-year-old Arabian mare was admitted to Sharjah Equine Hospital with a history of right eye ulcerative keratitis of unknown duration. Following a week of aggressive medical treatment, the condition deteriorated and a keratectomy and pedicle conjunctival graft were performed. A week later, the conjunctival graft partially dehisced and the u...
Genetic Parameters and Inbreeding Effect of Morphological Traits in Sardinian Anglo Arab Horse.
Animals : an open access journal from MDPI    May 2, 2020   Volume 10, Issue 5 791 doi: 10.3390/ani10050791
Giontella A, Sarti FM, Biggio GP, Giovannini S, Cherchi R, Pieramati C, Silvestrelli M.The purpose of this study was to estimate the heritability and genetic correlations of four biometric measurements and an overall score (OS) in the Sardinian Anglo-Arab horse (SAA); moreover, the effect of inbreeding on these traits was investigated. A dataset with 43,624 horses (27,052 females and 16,572 males) was provided by the Agricultural Research Agency of Sardinia (AGRIS). Cannon bone circumference (BC), chest girth (CG), shoulder length (SL), and withers height (WH) were measured on 6033 SAA horses born in Sardinia between 1967 and 2005; beside the measurements, an overall score (OS) ...
Equine pythiosis in Egypt: clinicopathological findings, detection, identification and genotyping of Pythium insidiosum.
Veterinary dermatology    April 28, 2020   Volume 31, Issue 4 298-e73 doi: 10.1111/vde.12845
Tartor YH, Hamad MH, Abouzeid NZ, El-Belkemy FA.Equine pythiosis is an emerging, devastating disease that is hard to treat. The tumour-like nodular skin masses grow rapidly and the outcome is generally fatal, and thus early diagnosis and intervention are important. Objective: (i) To highlight the clinical, histological and haematological findings in pythiosis, and (ii) to evaluate the efficacy of direct sample multiplex-PCR targeting the single nucleotide polymorphisms within the ribosomal DNA region for detection and genotyping of Pythium insidiosum. Methods: Two hundred and twenty horses including 204 Arabian and 16 draft horses were surv...
Genes encoding equine β-lactoglobulin (LGB1 and LGB2): Polymorphism, expression, and impact on milk composition.
PloS one    April 22, 2020   Volume 15, Issue 4 e0232066 doi: 10.1371/journal.pone.0232066
Wodas L, Mackowski M, Borowska A, Puppel K, Kuczynska B, Cieslak J.β-lactoglobulin is one of the most abundant milk whey proteins in many mammal species, including the domestic horse. The aim of this study was to screen for polymorphism in the equine LGB1 and LGB2 gene sequences (all exons, introns, and 5'-flanking region) and to assess potential relationship of particular genotypes with gene expression levels (measured in milk somatic cells) and milk composition traits (protein, fat, lactose, and total β-lactoglobulin content). Direct DNA sequencing analysis was performed for twelve horse breeds: Polish Primitive Horse (PPH), Polish Coldblood Horse (PCH), ...
Whole genome detection of sequence and structural polymorphism in six diverse horses.
PloS one    April 9, 2020   Volume 15, Issue 4 e0230899 doi: 10.1371/journal.pone.0230899
Al Abri MA, Holl HM, Kalla SE, Sutter NB, Brooks SA.The domesticated horse has played a unique role in human history, serving not just as a source of animal protein, but also as a catalyst for long-distance migration and military conquest. As a result, the horse developed unique physiological adaptations to meet the demands of both their climatic environment and their relationship with man. Completed in 2009, the first domesticated horse reference genome assembly (EquCab 2.0) produced most of the publicly available genetic variations annotations in this species. Yet, there are around 400 geographically and physiologically diverse breeds of hors...
The Oxidative Stress Markers of Horses-the Comparison with Other Animals and the Influence of Exercise and Disease.
Animals : an open access journal from MDPI    April 3, 2020   Volume 10, Issue 4 617 doi: 10.3390/ani10040617
Shono S, Gin A, Minowa F, Okubo K, Mochizuki M.Diacron-reactive oxygen metabolite (d-ROM) and biological antioxidant potential (BAP) levels in the serum of horses were measured (ponies, = 15; thoroughbred, = 31; other full-sized horses, = 7). The mean d-ROM levels in horses were significantly higher ( < 0.001) than those in dairy cattle ( = 25) and dogs ( = 31). However, d-ROM levels in horses were lower than the standard levels reported in humans. When d-ROM and BAP levels were plotted graphically, the points for horses with a disease (ringbone in 1 Japanese sports horse, cellulitis in 1 thoroughbred, melanoma in 1 Lipizzaner) fell ...
Effects of acepromazine and xylazine on subjective and objective assessments of forelimb lameness.
Equine veterinary journal    February 17, 2020   Volume 52, Issue 4 593-600 doi: 10.1111/evj.13225
Morgan JM, Ross MW, Levine DG, Stefanovski D, You Y, Robinson MA, Davidson EJ.To facilitate lameness evaluation, sedatives such as xylazine and acepromazine are regularly used in the clinical setting, despite concerns that they may confound lameness assessment. Objective: The objective of this study was to determine the effect of low doses of acepromazine and xylazine on subjective and objective lameness assessment. Methods: Randomised, blinded, crossover study. Methods: Six horses with experimentally induced solar pain were evaluated over a 1-hour period after treatment with intravenous xylazine (0.1 or 0.2 mg/kg), intravenous acepromazine (0.02 or 0.04 mg/kg), intra...
Enterolithiasis in horses: analysis of 15 cases treated surgically in Saudi Arabia.
Iranian journal of veterinary research    February 12, 2020   Volume 20, Issue 4 270-276 
Turek B, Witkowski M, Drewnowska O.The equine colic, which is caused by the presence of enteroliths that are most often found in the small or large colon, is typical for certain geographical regions (dry and hot climate). A diet rich in alfalfa is one of the highest risk factors. The earliest symptoms include weight loss and repeated episodes of colic pain. To present the results of operative treatment of 15 horses with enteroliths in Saudi Arabia. Methods: Fifteen purebred Arabian horses in Saudi Arabia, aged between 2 and 18 years, were treated. Decision about the surgery was based on clinical exam, ultrasound and rectal exa...
Plasma disposition of gabapentin after the intragastric administration of escalating doses to adult horses.
Journal of veterinary internal medicine    February 8, 2020   Volume 34, Issue 2 933-940 doi: 10.1111/jvim.15724
Gold JR, Grubb TL, Green S, Cox S, Villarino NF.In humans, gabapentin an analgesic, undergoes non-proportional pharmacokinetics which can alter efficacy. No information exists on the pharmacokinetics of dosages >20 mg/kg, escalating dosages or dose proportionality of gabapentin in horses. Objective: Gabapentin exposure in plasma would not increase proportionally relative to the dose in horses receiving dosages ≥20 mg/kg. To assess the plasma pharmacokinetics of gabapentin after nasogastric administration of gabapentin at dosages of 10 to 160 mg/kg in adult horses. Methods: Nine clinically healthy adult Arabian and Quarter Horses....
Evaluation of Return Rates to Races in Racehorses After Tendon Injuries: Lesion-Related Parameters.
Journal of equine veterinary science    January 23, 2020   Volume 87 102931 doi: 10.1016/j.jevs.2020.102931
Ülke ÇG, Deniz SI, Nureddin Ç.Metacarpal tendon diseases are important problems that may cause a decrease in performance and even may finish sport life in equine athletes. In this study, it was aimed to evaluate the ratio of return to races and the time of staying away from races and also to detect the prognostic value of ultrasonographic findings in Thoroughbred and Arabian racehorses with metacarpal flexor tendon injury or peritendonitis. Of 120 cases, 84 (70.0%) returned to races. Among these, 82.1% had tendonitis (69/84) and 17.9% peritendonitis (15/84). Among the cases being unable to return to races, 91.7% had tendon...
Serum acylcarnitine profile in endurance horses with and without metabolic dysfunction.
Veterinary journal (London, England : 1997)    December 10, 2019   Volume 255 105419 doi: 10.1016/j.tvjl.2019.105419
van der Kolk JH, Thomas S, Mach N, Ramseyer A, Burger D, Gerber V, Nuoffer JM.Mitochondrial β-oxidation is essential in fat metabolism and can be monitored with blood acylcarnitine profiling, as partly degraded fatty acids accumulate as their carnitine esters. To guarantee continuous energy supply during long-distance exercise, endurance horses oxidise considerable amounts of fat in the mitochondrion. In endurance races over 80 km, glycogen depletion is evident in equine slow-twitch high oxidative muscle fibres and as a consequence, horses participating in endurance races over 80 km rely almost entirely on β-oxidation of fatty acids. This study investigated mitoch...
Season’s Effects on Some Clinical, Hematological Parameters and Blood Cortisol Level in Sedated Arabian Horses With Xylazine.
Journal of equine veterinary science    November 9, 2019   Volume 84 102835 doi: 10.1016/j.jevs.2019.102835
Shawaf T, Al Mubarak A, Eidi H, El-Bahr SM.Influence of heat or cold stress in sedated animals is unclear and requires further investigations. The present study aimed to evaluate the season's effects on some clinical, hematological parameters and blood cortisol level in sedated Arabian horses with xylazine. Therefore, seven Arabian horses were used to investigate heart and respiratory rates, and capillary refill time and serum cortisol level were recorded before (0) and at 5, 15, 60, and 180 minutes postsedation. Heparinized venous samples were collected before (0) and 3 hours postsedation for analysis of hematological analysis. Arte...
TRIM39-RPP21 Variants (∆19InsCCC) Are Not Associated with Juvenile Idiopathic Epilepsy in Egyptian Arabian Horses.
Genes    October 16, 2019   Volume 10, Issue 10 816 doi: 10.3390/genes10100816
Rivas VN, Aleman M, Peterson JA, Dahlgren AR, Hales EN, Finno CJ.Juvenile idiopathic epilepsy (JIE) is an inherited disease characterized by recurrent seizures during the first year of life in Egyptian Arabian horses. Definitive diagnosis requires an electroencephalogram (EEG) performed by a veterinary specialist. A recent study has suggested that a 19 base-pair deletion, along with a triple-C insertion, in intron five of twelve (∆19InsCCC; chr20:29542397-29542425: GTTCAGGGGACCACATGGCTCTCTATAGA>TATCTTAAGACCC) of the () gene is associated with JIE. To confirm this association, a new sample set consisting of nine EEG-phenotyped affected and nine unaffec...
Acute-phase protein profile in horses subjected to different exercise protocols.
Canadian journal of veterinary research = Revue canadienne de recherche veterinaire    October 2, 2019   Volume 83, Issue 4 272-278 
Assunção P, Barbosa T, Yonezawa L, Barbosa L, Watanabe M, Kohayagawa A, Schmidt E.High-intensity exercise can be associated with the occurrence of muscle injury, as well as the induction of an acute-phase response (APR). The present study aims to investigate the synthesis and profile of serum proteins in horses before and after participating in 2 different exercise protocols and to relate this profile to the presence or absence of muscular injury caused by exercise. Ten purebred Arabian (n = 5) and Criollo (n = 5) horses were subjected to 2 different tests on a treadmill, one consisting of short-duration and rapid-acceleration training (TRA) that was mostly anerobic and the...
1 6 7 8 9 10 29