Analyze Diet

Topic:Clinical Study

Clinical studies in equine research involve the systematic investigation of health and disease in horses through structured scientific methods. These studies aim to evaluate the safety and efficacy of treatments, understand disease mechanisms, and improve veterinary care practices. Clinical studies can include randomized controlled trials, observational studies, and case-control studies. They may focus on various aspects such as pharmacokinetics, therapeutic interventions, and diagnostic techniques. This page compiles peer-reviewed research studies and scholarly articles that explore the design, implementation, and findings of clinical studies in equine medicine, providing insights into their impact on horse health and veterinary practices.
Factors Associated With Survival and Return to Function Following Synovial Infections in Horses.
Frontiers in veterinary science    October 22, 2019   Volume 6 367 doi: 10.3389/fvets.2019.00367
Crosby DE, Labens R, Hughes KJ, Nielsen S, Hilbert BJ.Synovial infections (SI) are common in horses of all ages and can be associated with high rates of morbidity and mortality. Identifying factors influencing survival and return to function may be useful for management of affected individuals and determination of prognosis. The objectives of this study were to identify factors associated with survival and return to function of horses and foals with SI presented to an equine hospital. This study is a retrospective case series. Data were collected from medical records of all horses with SI that were presented to a single equine hospital between Ap...
Cauda equina syndrome in an ovarian malignant-mixed müllerian tumor with leptomeningeal spread.
Clinical case reports    October 22, 2019   Volume 7, Issue 12 2341-2345 doi: 10.1002/ccr3.2472
Bernstock JD, Ostby S, Fox B, Sotoudeh H, Janssen A, Kang YJ, Chen J, Prattipati V, Elsayed G, Chagoya G, Yamashita D, Friedman GK, Nabors B, Huh WK....Leptomeningeal metastasis is extremely rare in patients with ovarian cancer, but should be considered in patients presenting with neurologic deficits such as cauda equine syndrome. Given its poor prognosis and lack of data currently on management, additional studies are needed to optimize treatment regimens and improve outcomes.
Equine non-invasive time-lapse imaging and blastocyst development.
Reproduction, fertility, and development    October 22, 2019   Volume 31, Issue 12 1874-1884 doi: 10.1071/RD19260
Meyers S, Burruel V, Kato M, de la Fuente A, Orellana D, Renaudin C, Dujovne G.In this study we examined the timeline of mitotic events of invitro-produced equine embryos that progressed to blastocyst stage using non-invasive time-lapse microscopy (TLM). Intracytoplasmic sperm injection (ICSI) embryos were cultured using a self-contained imaging incubator system (Miri®TL; Esco Technologies) that captured brightfield images at 5-min intervals that were then generated into video for retrospective analysis. For all embryos that progressed to the blastocyst stage, the initial event of extrusion of acellular debris preceded all first cleavages and occurred at mean (±s.e.m.)...
High intake of sugars and starch, low number of meals and low roughage intake are associated with Equine Gastric Ulcer Syndrome in a Belgian cohort.
Journal of animal physiology and animal nutrition    October 22, 2019   Volume 105 Suppl 2 18-23 doi: 10.1111/jpn.13215
Galinelli N, Wambacq W, Broeckx BJG, Hesta M.Equine gastric ulcer syndrome (EGUS) is a pathological condition affecting the glandular and squamous regions of the stomach. It is characterized by non-specific clinical signs, behavioural changes or can also be found without any overt clinical manifestations. Nutritional factors such as intermittent feeding, high sugars and starch intake, large amounts of straw as forage and prolonged time without access to forage have all been associated with an increased risk of equine squamous gastric disease (ESGD). The aim of this study was to investigate which nutritional practices are commonly seen in...
Morphokinetics of early equine embryo development in vitro using time-lapse imaging, and use in selecting blastocysts for transfer.
Reproduction, fertility, and development    October 22, 2019   Volume 31, Issue 12 1851-1861 doi: 10.1071/RD19225
Lewis N, Schnauffer K, Hinrichs K, Morganti M, Troup S, Argo C.The use of time-lapse imaging (TLI) in the evaluation of morphokinetics associated with invitro developmental competence is well described for human, cattle and pig embryos. It is generally accepted that embryos that complete early cleavage sooner are more likely to form blastocysts and that timing of later events, such as blastocyst formation and expansion, are predictive of implantation potential and euploid status. In the horse, morphokinetics as a predictor of developmental competence has received little attention. In this study we evaluated the morphokinetics of early equine embryo develo...
Association of equine oocyte and cleavage stage embryo morphology with maternal age and pregnancy after intracytoplasmic sperm injection.
Reproduction, fertility, and development    October 22, 2019   Volume 31, Issue 12 1812-1822 doi: 10.1071/RD19250
Frank BL, Doddman CD, Stokes JE, Carnevale EM.In this retrospective study the morphological characteristics of oocytes and cleavage stage embryos were associated with pregnancy results from clinical intracytoplasmic sperm injection (ICSI) in mares. Oocytes were collected from preovulatory follicles, and images (×200; n=401) were captured for measurements of ooplasm, the perivitelline space and zona pellucida. After ICSI and before transfer into recipients' oviducts, cleavage stage embryos were imaged (n=178). Oocyte donor ages (3-13, 14-19, 20-23, 24-27 years) were compared, as were mares aged 3-13 years without versus with recent histor...
Mare and stallion effects on blastocyst production in a commercial equine ovum pick-up-intracytoplasmic sperm injection program.
Reproduction, fertility, and development    October 22, 2019   Volume 31, Issue 12 1894-1903 doi: 10.1071/RD19201
Cuervo-Arango J, Claes AN, Stout TAE.This study retrospectively examined the degree to which success within a commercial ovum pick-up (OPU)-intracytoplasmic sperm injection (ICSI) program varied between individual mares and stallions. Over 2 years, 552 OPU sessions were performed on 323 privately owned warmblood mares. For mares that yielded at least one blastocyst during the first OPU-ICSI cycle, there was a 77% likelihood of success during subsequent attempts; conversely, when the first cycle yielded no blastocyst, the likelihood of failure (no embryo) in subsequent cycles was 62%. In mares subjected to four or more OPU session...
Investigation of stemness and multipotency of equine adipose-derived mesenchymal stem cells (ASCs) from different fat sources in comparison with lipoma.
Stem cell research & therapy    October 22, 2019   Volume 10, Issue 1 309 doi: 10.1186/s13287-019-1429-0
Arnhold S, Elashry MI, Klymiuk MC, Geburek F.Adipose tissue-derived mesenchymal stem cells (ASCs) offer a promising cell source for therapeutic applications in musculoskeletal disorders. The appropriate selection of ASCs from various fat depots for cell-based therapy is challenging. The present study aims to compare stemness and multipotency of ASCs derived from retroperitoneal (RP), subcutaneous (SC), and lipoma (LP) fat to assess their usefulness for clinical application. Equine ASCs from the three fat tissue sources were isolated and characterized. The cell viability, proliferation, and self-renewal were evaluated using MTT, sulforhod...
Ejaculated compared with epididymal stallion sperm vitrification.
Animal reproduction science    October 22, 2019   Volume 211 106205 doi: 10.1016/j.anireprosci.2019.106205
Álvarez C, González N, Luño V, Gil L.The aim of this study was to evaluate the effect of trehalose and lactose extenders on ejaculated and epididymal stallion sperm vitrification. Ejaculated semen samples were collected from seven fertile stallions, and cauda epididymis samples were collected from ten stallion carcasses after slaughter. Both the ejaculated and the epididymis samples were diluted and vitrified using INRA 96® and bovine serum albumin as well as trehalose or lactose. As a control, ejaculated and epididymal samples were collected and frozen using the conventional method. Vitrification was performed by immersing sper...
Results of racetrack examinations of Standardbred horses at race meetings in New South Wales.
Australian veterinary journal    October 21, 2019   Volume 97, Issue 12 509-514 doi: 10.1111/avj.12882
Knight PK.This study analysed the race day veterinary reports from harness racing meetings controlled by the New South Wales Greyhound and Harness Racing Regulatory Authority between 1 September 2008 and 30 June 2009. The findings of all prerace and postrace examinations were analysed, and the frequency of observations was recorded. Chi-square testing was used to determine whether the incidence of abnormalities differed between age groups and tracks. A total of 542 meetings were conducted during the period of the study, with veterinary examinations conducted at 395 of these meetings. A total of 520 vete...
Transendoscopic correction of epiglottic entrapment with a silicone-covered laser guide and diode laser in 29 horses.
Veterinary surgery : VS    October 21, 2019   Volume 49, Issue 1 131-137 doi: 10.1111/vsu.13338
Beste KJ, Ortved KF, Rossignol F, Ducharme NG.To describe the use of a silicone-covered laser guide and diode laser for surgical correction of epiglottic entrapment and report postoperative outcomes in horses with epiglottic entrapment. Methods: Retrospective case series. Methods: Thoroughbred and standardbred racehorses (n = 29) with epiglottic entrapment. Methods: A silicone-covered laser guide was placed endoscopically to direct the diode laser cutting action during transection of the entrapping subepiglottic membrane and to act as a physical barrier between the membrane and the epiglottic cartilage. Postoperative complications and tra...
Effects of Docosahexaenoic Acid-Rich Microalgae Supplementation on Metabolic and Inflammatory Parameters in Horses With Equine Metabolic Syndrome.
Journal of equine veterinary science    October 21, 2019   Volume 83 102811 doi: 10.1016/j.jevs.2019.102811
Elzinga SE, Betancourt A, Stewart JC, Altman MH, Barker VD, Muholland M, Bailey S, Brennan KM, Adams AA.Much of the equine population is obese and therefore predisposed to the development of additional health concerns such as equine metabolic syndrome (EMS). However, pharmacologic treatments for EMS are limited. Omega-3 fatty acid supplementation is a therapeutic strategy in humans with metabolic dysfunction that improves insulin sensitivity and reduces inflammation, but the effects of omega-3 fatty acid supplementation in horses with EMS are unclear. Therefore, in this pilot study, 10 mixed-sex and mixed-breed horses with EMS were fed a docosahexaenoic acid (DHA)-rich microalgae containing 16 ...
Possible dysmetabolic hyperferritinemia in hyperinsulinemic horses.
Open veterinary journal    October 21, 2019   Volume 9, Issue 4 287-293 doi: 10.4314/ovj.v9i4.2
Kellon EM, Gustafson KM.Hyperinsulinemia associated with equine metabolic syndrome and pituitary pars intermedia dysfunction is a risk factor for laminitis. Research in other species has shown elevated body iron levels as both a predictor and consequence of insulin resistance. In humans, this is known as dysmetabolic hyperferritinemia. To explore the relationship between equine hyperinsulinemia and body iron levels. We reviewed case histories and laboratory results from an open access database maintained by the Equine Cushing's and Insulin Resistance Group Inc. (ECIR). We identified 33 horses with confirmed hyperinsu...
Longitudinal study of electrical, functional and structural remodelling in an equine model of atrial fibrillation.
BMC cardiovascular disorders    October 21, 2019   Volume 19, Issue 1 228 doi: 10.1186/s12872-019-1210-4
Hesselkilde EZ, Carstensen H, Flethøj M, Fenner M, Kruse DD, Sattler SM, Tfelt-Hansen J, Pehrson S, Braunstein TH, Carlson J, Platonov PG....Large animal models are important in atrial fibrillation (AF) research, as they can be used to study the pathophysiology of AF and new therapeutic approaches. Unlike other animal models, horses spontaneously develop AF and could therefore serve as a bona fide model in AF research. We therefore aimed to study the electrical, functional and structural remodelling caused by chronic AF in a horse model. Nine female horses were included in the study, with six horses tachypaced into self-sustained AF and three that served as a time-matched sham-operated control group. Acceleration in atrial fibrilla...
[Cervical Stent for Long-term Treatment of Pyometra in Mares].
Tierarztliche Praxis. Ausgabe G, Grosstiere/Nutztiere    October 21, 2019   Volume 47, Issue 5 327-328 doi: 10.1055/a-1004-9876
Krohn J, Ennen S, Hospes R et al. Use of a cervical stent for long-term treatment of pyometra in the mare: A report of three cases. Reprod Dom Anim 2019; 55: 1155–1159 DIE PYOMETRA DER STUTE IST EIN CHRONISCHER ENTZüNDUNGSZUSTAND DES ENDOMETRIUMS, DER HäUFIG MIT DER AKKUMULATION GROßER MENGEN AN SEKRET EINHERGEHT. PRäDISPONIERT SIND STUTEN MIT VERäNDERUNGEN DER ZERVIX, DURCH DIE DIE UTERINE CLEARANCE BEEINTRäCHTIGT WIRD. DIE HäUFIG UNSPEZIFISCHEN SYMPTOME UMFASSEN LEISTUNGSMANGEL, KONDITIONSVERLUST, SUBFEBRILE TEMPERATUR ODER KOLIKARTIGE SCHMERZEN. MANCHE TIERE PRäSENTIEREN SICH SYMP...
The Effect of Tree Width on Thoracolumbar and Limb Kinematics, Saddle Pressure Distribution, and Thoracolumbar Dimensions in Sports Horses in Trot and Canter.
Animals : an open access journal from MDPI    October 21, 2019   Volume 9, Issue 10 doi: 10.3390/ani9100842
MacKechnie-Guire R, MacKechnie-Guire E, Fairfax V, Fisher D, Fisher M, Pfau T.This study evaluated the effect of saddle tree width on thoracolumbar and limb kinematics, saddle pressure distribution, and thoracolumbar epaxial musculature dimensions. Correctly fitted saddles were fitted by a Society of Master Saddler Qualified Saddle Fitter in fourteen sports horses (mean ± SD age 12 ± 8.77 years, height 1.65 ± 0.94 m), and were altered to one width fitting wider and narrower. Horses were equipped with skin markers, inertial measurement units, and a pressure mat beneath the saddle. Differences in saddle pressure distribution, as well as limb and thoracolumbosacral kine...
Low-density lipoproteins and milk serum proteins improve the quality of stallion sperm after vitrification in straws.
Reproduction in domestic animals = Zuchthygiene    October 19, 2019   Volume 54 Suppl 4 86-89 doi: 10.1111/rda.13495
Consuegra C, Crespo F, Dorado J, Diaz-Jimenez M, Pereira B, Hidalgo M.Lipids and proteins can be used for sperm vitrification to preserve the integrity of sperm membranes or to increase the viscosity of the medium. This study evaluated the effect of low-density lipoproteins (LDL) and milk serum proteins (Pronexcell) for stallion sperm vitrification. Hippex extender (Barex Biochemical Products, The Netherlands), plus 1% of bovine serum albumin and 100 mM of trehalose, was used as control for sperm vitrification. In experiment 1, different concentrations of LDL (L1 = 0.25, L2 = 0.5, L3 = 1%) and in experiment 2 of Pronexcell (P1 = 1, P2 = 5, P3 = 10%)...
Systemic Administration of Rejuvenated Adipose-Derived Mesenchymal Stem Cells Improves Liver Metabolism in Equine Metabolic Syndrome (EMS)- New Approach in Veterinary Regenerative Medicine.
Stem cell reviews and reports    October 18, 2019   Volume 15, Issue 6 842-850 doi: 10.1007/s12015-019-09913-3
Marycz K, Szłapka-Kosarzewska J, Geburek F, Kornicka-Garbowska K.Equine metabolic syndrome (EMS) is characterized by adiposity, insulin dysregulation and increased risk for laminitis. Increased levels of specific liver enzymes in the peripheral blood are typical findings in horses diagnosed with EMS. Current management of EMS is based on caloric restriction and increased physical activity. However, new potential treatment options are arising such as the transplantation of autologous adipose stem cells (ASC). However, cytophysiological properties of ASC derived from EMS horses are impaired which strongly limits their therapeutic potential. We hypothesized, t...
Effects of Different Freezing Protocols on Motility, Viability, Mitochondrial Membrane Potential, Intracellular Calcium Level, and DNA Integrity of Cryopreserved Equine Epididymal Sperm.
Journal of equine veterinary science    October 17, 2019   Volume 82 102801 doi: 10.1016/j.jevs.2019.102801
Neuhauser S, Bollwein H, Siuda M, Handler J.The aim of the present study was to evaluate the effect of different freezing procedures on sperm motion, viability, the acrosome status, mitochondrial membrane potential (MMP), intracellular calcium content, and DNA integrity on epididymal stallion sperm. Therefore, the sperm of 10 healthy stallions was harvested by retrograde flushing after testectomy, diluted with a semen extender containing defined milk proteins and a freezing extender containing egg yolk and glycerol and frozen according to 4 different protocols, using a programmable freezer and a floating rack performing a slow (processe...
TRIM39-RPP21 Variants (∆19InsCCC) Are Not Associated with Juvenile Idiopathic Epilepsy in Egyptian Arabian Horses.
Genes    October 16, 2019   Volume 10, Issue 10 816 doi: 10.3390/genes10100816
Rivas VN, Aleman M, Peterson JA, Dahlgren AR, Hales EN, Finno CJ.Juvenile idiopathic epilepsy (JIE) is an inherited disease characterized by recurrent seizures during the first year of life in Egyptian Arabian horses. Definitive diagnosis requires an electroencephalogram (EEG) performed by a veterinary specialist. A recent study has suggested that a 19 base-pair deletion, along with a triple-C insertion, in intron five of twelve (∆19InsCCC; chr20:29542397-29542425: GTTCAGGGGACCACATGGCTCTCTATAGA>TATCTTAAGACCC) of the () gene is associated with JIE. To confirm this association, a new sample set consisting of nine EEG-phenotyped affected and nine unaffec...
Ultrasonographic assessment of normal jugular veins in Standardbred horses.
BMC veterinary research    October 16, 2019   Volume 15, Issue 1 343 doi: 10.1186/s12917-019-2104-5
Pasolini MP, Spinella G, Del Prete C, Valentini S, Coluccia P, Auletta L, Greco M, Meomartino L.Ultrasonography (US) is the recommended imaging technique to evaluate jugular veins. This prospective randomized clinical study was designed to collect a series of B-mode US measurements of manually distended jugular veins in healthy Italian Standardbreds and to find possible correlations between ultrasound measurements and animal morphometric characteristics. Forty-two horses, eight males and 34 females (range 3-22 years; bodyweight 494.4 ± 41.7 kg), were included in the study. The diameters and wall thicknesses of both jugular veins were measured at three different sites of the neck...
Immunoreactive insulin stability in horses at risk of insulin dysregulation.
Journal of veterinary internal medicine    October 16, 2019   Volume 33, Issue 6 2746-2751 doi: 10.1111/jvim.15629
Leschke DH, Muir GS, Hodgson JK, Coyle M, Horn R, Bertin FR.Diseases associated with insulin dysregulation (ID), such as equine metabolic syndrome and pituitary pars intermedia dysfunction, are of interest to practitioners because of their association with laminitis. Accurate insulin concentration assessment is critical in diagnosing and managing these diseases. Objective: To determine the effect of time, temperature, and collection tube type on insulin concentrations in horses at risk of ID. Methods: Eight adult horses with body condition score >6/9. Methods: In this prospective study, subjects underwent an infeed oral glucose test 2 hours before...
Vaccination of foals with a modified live, equid herpesvirus-1 gM deletion mutant (RacHΔgM) confers partial protection against infection.
Vaccine    October 16, 2019   Volume 38, Issue 2 388-398 doi: 10.1016/j.vaccine.2019.09.106
Kydd JH, Hannant D, Robinson RS, Bryant N, Osterrieder N.Equid herpesvirus-1 (EHV-1) causes respiratory and neurological disease and late gestation abortion in pregnant mares. Current vaccines contain either inactivated or live EHV-1, but fail to provide complete clinical or virological protection, namely prevention of nasopharyngeal shedding and cell-associated viraemia. Thus, the development of novel products, such as modified live virus (MLV) vaccines which stimulate virus-specific, humoral and cell mediated immune responses more effectively remains a priority. Two groups of weaned foals (n = 6 each group) were used in a longitudinal, prospec...
The effect of different grazing conditions on the insulin and incretin response to the oral glucose test in ponies.
BMC veterinary research    October 16, 2019   Volume 15, Issue 1 345 doi: 10.1186/s12917-019-2088-1
Fitzgerald DM, Pollitt CC, Walsh DM, Sillence MN, de Laat MA.The oral glucose test (OGT) is a useful tool for diagnosing insulin dysregulation (ID) and is somewhat repeatable in ponies under consistent management. This study aimed to determine whether the insulin and incretin responses to an OGT in ponies differed after short-term access to fertilised pasture, compared to unfertilised pasture, by using a randomised, repeated measures study design. Sixteen mixed-breed ponies were classified as severely insulin-dysregulated (SD; post-prandial insulin ≥80 μIU/mL) or not severely insulin-dysregulated (NSD; post-prandial insulin < 80 μIU/mL) using an O...
Inflammatory mediators are potential biomarkers for extracorporeal shockwave therapy in horses.
Equine veterinary journal    October 16, 2019   Volume 52, Issue 3 449-454 doi: 10.1111/evj.13183
Chen JW, Stefanovski D, Haughan J, Jiang Z, Boston R, Soma LR, Robinson MA.Extracorporeal shockwave therapy (ESWT) can potentially mask painful injuries in equine athletes. Tests to detect whether a horse has received ESWT prior to competition are needed. Extracorporeal shockwave therapy is known to affect inflammatory mediators in other species, and if these mediators are altered in the horse, these could serve as biomarkers of ESWT. Objective: To test the hypothesis that a single application of ESWT will alter the circulating protein concentrations of 10 inflammatory mediators in horse plasma. Methods: Prospective repeated measures experimental study. Methods: Elev...
Horses for courses: an approach to the qualification of clinical trial sites and investigators in ATMPs.
Drug discovery today    October 16, 2019   Volume 25, Issue 2 265-268 doi: 10.1016/j.drudis.2019.10.003
Hildebrandt M.The advanced therapy medicinal products (ATMPs) landscape is entirely different from classical drug development. Academia has been the major source of ATMP development, and academic hospitals act as trial sites for the clinical testing of ATMPs, including early academic-led trials as well as industry-sponsored trials that pursue the full developmental pathway to market authorization. The recent breakthrough developments in some ATMPs, such as genetically engineered immune cells, have confronted academic hospitals with a substantial amount of public demand, competitive pressure, and costs. At t...
Dimethyl sulfoxide maintains structure and function of cryopreserved equine endometrial explants.
Cryobiology    October 15, 2019   Volume 91 90-96 doi: 10.1016/j.cryobiol.2019.10.006
Thompson RE, Johnson AK, Prado TM, Premanandan C, Brown ME, Whitlock BK, Pukazhenthi BS.Availability of viable frozen-thawed endometrial tissues could facilitate detailed studies into physiologic and disease processes influencing the endometrium. This study was designed to investigate the cryosurvival of equine endometrial tissue. Previous studies in the human and horse have focused on cryopreservation of dissociated endometrial cells. To our knowledge, there are no studies on cryopreservation of endometrial explants. Our objectives were to 1) determine the influence of differing concentrations of the permeating cryoprotectant dimethyl sulfoxide (MeSO) on viability, structural in...
The First Detection of Equine Coronavirus in Adult Horses and Foals in Ireland.
Viruses    October 14, 2019   Volume 11, Issue 10 946 doi: 10.3390/v11100946
Nemoto M, Schofield W, Cullinane A.The objective of this study was to investigate the presence of equine coronavirus (ECoV) in clinical samples submitted to a diagnostic laboratory in Ireland. A total of 424 clinical samples were examined from equids with enteric disease in 24 Irish counties between 2011 and 2015. A real-time reverse transcription polymerase chain reaction was used to detect ECoV RNA. Nucleocapsid, spike and the region from the p4.7 to p12.7 genes of positive samples were sequenced, and sequence and phylogenetic analyses were conducted. Five samples (1.2%) collected in 2011 and 2013 tested positive for ECoV. Po...
Thermal, mechanical and electrical stimuli in antinociceptive studies in standing horses: an update.
Veterinary anaesthesia and analgesia    October 13, 2019   Volume 47, Issue 1 15-27 doi: 10.1016/j.vaa.2019.09.003
Gozalo-Marcilla M, Luna SPL, Gasthuys F, Schauvliege S.To perform a literature review of the thermal and mechanical antinociceptive devices used in pharmacological studies in standing horses published after 2011 (2012-2019). To complete a full literature review about electrical stimulation used for evaluation in similar studies. Methods: PubMed, Google Scholar and Web of Science. Conclusions: A high level of standardization has been reached in antinociceptive studies in standing horses using thermal and mechanical stimuli in most recent years. Commercially available testing devices to deliver thermal, mechanical and electrical stimuli, with observ...
Multiple excisions of an equine sarcoid and the repercussions.
The Canadian veterinary journal = La revue veterinaire canadienne    October 11, 2019   Volume 60, Issue 10 1115-1117 
Melinyshyn H.A 13-year-old Morgan crossbred mare was presented in May 2018 with a 10-cm mass on the medial aspect of the left hind fetlock. In September and November 2018 and June 2019 the mass was incompletely excised and continued to grow. A diagnosis of spindle cell tumor, consistent with equine sarcoid, was made based on histopathology from the last excision. . Une jument Morgan croisée âgée de 13 ans a été présentée en mai 2018 avec une masse de 10 cm sur l’aspect médial du boulet arrière gauche. En septembre et novembre 2018 ainsi qu’en juin 2019, la masse avait été excisée de manièr...