Epidemiology in horses involves the study of the distribution and determinants of health-related states and events in equine populations. It encompasses the investigation of patterns, causes, and effects of diseases and health conditions within horse populations. This field of study aims to identify risk factors for disease and targets for preventive healthcare. Key components of equine epidemiology include disease surveillance, outbreak investigation, and the study of disease dynamics within herds or regions. Research in this area often focuses on infectious diseases, zoonotic diseases, and the impact of environmental factors on equine health. This page compiles peer-reviewed research studies and scholarly articles that explore various aspects of epidemiology in horses, including disease prevalence, transmission pathways, and strategies for disease prevention and control.
Knight PK.This study analysed the race day veterinary reports from harness racing meetings controlled by the New South Wales Greyhound and Harness Racing Regulatory Authority between 1 September 2008 and 30 June 2009. The findings of all prerace and postrace examinations were analysed, and the frequency of observations was recorded. Chi-square testing was used to determine whether the incidence of abnormalities differed between age groups and tracks. A total of 542 meetings were conducted during the period of the study, with veterinary examinations conducted at 395 of these meetings. A total of 520 vete...
Li X, Ni HB, Ren WX, Jiang J, Gong QL, Zhang XX.Toxoplasmosis, one of the most common zoonoses worldwide, is caused by Toxoplasma gondii. T. gondii can infect almost all warm-blooded animals, including humans. Horses are an intermediate host of T. gondii, representing a potential risk for humans. To determine the T. gondii seroprevalence in horses worldwide, a global meta-analysis was conducted. A total of 35 publications were obtained by searching the PubMed, ScienceDirect, Chinese Web of knowledge (CNKI) and Wanfang databases. A total of 12,354 horses were assessed, of which 1580 were positive for T. gondii. The pooled overall seroprevale...
Meister TL, Tegtmeyer B, Brüggemann Y, Sieme H, Feige K, Todt D, Stang A, Cavalleri JV, Steinmann E.An equine parvovirus-hepatitis (EqPV-H) has been recently identified in association with equine serum hepatitis, also known as Theiler's disease. The disease was first described by Arnold Theiler in 1918 and is often observed with parenteral use of blood products in equines. However, natural ways of viral circulation and potential risk factors for transmission still remain unknown. In this study, we investigated the occurrence of EqPV-H infections in Thoroughbred horses in northern and western Germany and aimed to identify potential risk factors associated with viral infections. A total of 392...
Padalino B, Rosanowski SM, Di Bella C, Lacinio R, Rubino GTR.This study aimed to document the prevalence of chronic equine piroplasmosis (EP) in poorly performing Standardbred racehorses and to explore associations between the disease and sex, age, and hematological parameters. Blood was collected between 2004 and 2018; blood cell counts were performed using a cell counter analyzer, biochemical parameters using a photometer, and serum proteins using agarose gel electrophoresis. Blood smears were prepared, colored with a modified Giemsa, and an experienced technician identified the presence of protozoa. The horses were categorized into piroplasmosis posi...
Rivas VN, Aleman M, Peterson JA, Dahlgren AR, Hales EN, Finno CJ.Juvenile idiopathic epilepsy (JIE) is an inherited disease characterized by recurrent seizures during the first year of life in Egyptian Arabian horses. Definitive diagnosis requires an electroencephalogram (EEG) performed by a veterinary specialist. A recent study has suggested that a 19 base-pair deletion, along with a triple-C insertion, in intron five of twelve (∆19InsCCC; chr20:29542397-29542425: GTTCAGGGGACCACATGGCTCTCTATAGA>TATCTTAAGACCC) of the () gene is associated with JIE. To confirm this association, a new sample set consisting of nine EEG-phenotyped affected and nine unaffec...
Clark JM, Adanty K, Post A, Hoshizaki TB, Clissold J, McGoldrick A, Hill J, Annaidh AN, Gilchrist MD.Equestrian helmets are designed to pass certification standards based on linear drop tests onto rigid steel surfaces. However, concussions in equestrian sports occur most commonly when a rider is thrown off a horse and obliquely impacts a compliant surface such as turf or sand. This paper seeks to elucidate the mechanics of such impacts and thereby propose corresponding thresholds for the occurrence of concussion that can improve equestrian helmet standards and designs. Methods: The present study examined the biomechanics of real-world equestrian accidents and developed thresholds for the occu...
Yao C.The kinetoplastid protozoan Leishmania spp. cause leishmaniasis, which clinically exhibit mainly as a cutaneous, mucocutanous or visceral form depending upon the parasite species in humans. The disease is widespread geographically, leading to 20 000 annual deaths. Here, leishmaniases in both humans and animals, reservoirs and sand fly vectors on the Caribbean islands are reviewed. Autochthonous human infections by Leishmania spp. were found in the Dominican Republic, Guadeloupe and Martinique as well as Trinidad and Tobago; canine infections were found in St. Kitts and Grenada; and equine infe...
Nemoto M, Schofield W, Cullinane A.The objective of this study was to investigate the presence of equine coronavirus (ECoV) in clinical samples submitted to a diagnostic laboratory in Ireland. A total of 424 clinical samples were examined from equids with enteric disease in 24 Irish counties between 2011 and 2015. A real-time reverse transcription polymerase chain reaction was used to detect ECoV RNA. Nucleocapsid, spike and the region from the p4.7 to p12.7 genes of positive samples were sequenced, and sequence and phylogenetic analyses were conducted. Five samples (1.2%) collected in 2011 and 2013 tested positive for ECoV. Po...
Tozaki T, Kusano K, Ishikawa Y, Kushiro A, Nomura M, Kikuchi M, Kakoi H, Hirota K, Miyake T, Hill EW, Nagata S.Fractures are medical conditions that compromise the athletic potential of horses and/or the safety of jockeys. Therefore, the reduction of fracture risk is an important horse and human welfare issue. The present study used molecular genetic approaches to determine the effect of genetic risk for fracture at four candidate SNPs spanning the myostatin (MSTN) gene on horse chromosome 18. Among the 3706 Japanese Thoroughbred racehorses, 1089 (29.4%) had experienced fractures in their athletic life, indicating the common occurrence of this injury in Thoroughbreds. In the case/control association st...
Altan E, Li Y, Sabino-Santos G, Sawaswong V, Barnum S, Pusterla N, Deng X, Delwart E.Metagenomics was used to identify viral sequences in the plasma and CSF (cerobrospinal fluid) of 13 horses with unexplained neurological signs and in the plasma and respiratory swabs of 14 horses with unexplained respiratory signs. Equine hepacivirus and two copiparvoviruses (horse parvovirus-CSF and a novel parvovirus) were detected in plasma from neurological cases. Plasma from horses with respiratory signs contained the same two copiparvoviruses plus equine pegivirus D and respiratory swabs contained equine herpes virus 2 and 5. Based on genetic distances the novel copiparvovirus qualified ...
Spence KL, Cardwell JM, Slater J, Rosanowski SM.The potential for an exotic disease incursion is a significant concern for the United Kingdom (UK) equine industry. Horse owners' perceptions of, and attitudes towards, exotic diseases can influence decisions to adopt disease preparedness strategies. The objectives of this study were to describe horse owners' 1) perceptions of the term 'exotic disease', and 2) attitudes towards their risk of being affected by an exotic disease. In order to address these objectives, qualitative content analysis was undertaken on data collected using two open-ended survey questions. Results: Horse owners (n =â€...
Blanco-Lobo P, Rodriguez L, Reedy S, Oladunni FS, Nogales A, Murcia PR, Chambers TM, Martinez-Sobrido L.Vaccination remains the most effective approach for preventing and controlling equine influenza virus (EIV) in horses. However, the ongoing evolution of EIV has increased the genetic and antigenic differences between currently available vaccines and circulating strains, resulting in suboptimal vaccine efficacy. As recommended by the World Organization for Animal Health (OIE), the inclusion of representative strains from clade 1 and clade 2 Florida sublineages of EIV in vaccines may maximize the protection against presently circulating viral strains. In this study, we used reverse genetics tech...
Sheats MK, Davis KU, Poole JA.Farmers are routinely exposed to organic dusts and aeroallergens that can have adverse respiratory health effects including asthma. Horses are farm-reared large animals with similar exposures and can develop equine asthma syndrome (EAS). This review aims to compare the etiology, pathophysiology, and immunology of asthma in horses compared to farmers and highlights the horse as a potential translational animal model for organic dust-induced asthma in humans. Severe EAS shares many clinical and pathological features with various phenotypes of human asthma including allergic, non-allergic, late o...
Malalana F, Ireland JL, Pinchbeck G, McGowan CM.Uveitis appears to be less prevalent in the UK compared with other parts of the world and studies characterising the disease in the UK are lacking. The objectives of this retrospective study were to describe acute and recurrent cases presenting for management of uveitis in a referral hospital on the North West of England and compare the signalment of horses presenting with uveitis with the equine hospital population during the same period. Methods: Medical records of horses presented to the referral Equine Hospital, University of Liverpool with signs of uveitis between 2008 and 2018 were revie...
Takahashi Y, Takahashi T.Exertional heat illness (EHI) is recognised in horses, but few reports have investigated its risk factors. Objective: To identify risk factors for EHI in racehorses participating in flat races in Japan. Methods: Descriptive epidemiology and retrospective unmatched case-control study. Methods: Between 2005 and 2016, veterinary records of horses diagnosed with EHI after flat races were reviewed retrospectively and data of the months from April to September were used for a case-control study. For each case, three control horses were randomly selected from starts between April and September. Race ...
Mhadhbi M, Sassi A.Infection of equids by Leishmania (L.) parasites was previously described in both the Old and New World, particularly in Central and South America. Equine cutaneous leishmaniasis (CL) is caused by the Leishmania species, L. Viannia (V.) braziliensis and L. infantum, previously identified in humans and other parasite hosts living in the same geographic endemic areas. Sporadic autochthonous clinical cases, with no travel history, were documented in several countries including Germany, Portugal, Spain, Texas and Brazil; L. infantum and L. (Mundinia) martiniquensis were the infectious species....
Olguin-Perglione C, Vissani MA, Alamos F, Tordoya MS, Barrandeguy M.Equine influenza is an important cause of respiratory disease of horses worldwide. The equine influenza virus (EIV) undergoes antigenic drift through the accumulation of amino acid substitutions in the viral proteins, which may lead to vaccine breakdown. Objective: To describe the epidemiological findings and the molecular characteristics of the EIV detected during the multifocal outbreak that occurred in Argentina between March and July 2018 and evidence a vaccine breakdown. Methods: Observational, descriptive study. Methods: Virus was detected in nasopharyngeal swabs using real-time reverse ...
Sutton G, Garvey M, Cullinane A, Jourdan M, Fortier C, Moreau P, Foursin M, Gryspeerdt A, Maisonnier V, Marcillaud-Pitel C, Legrand L, Paillot R....Equine herpesvirus 1 (EHV-1) is an Alphaherpesvirus infecting not only horses but also other equid and non-equid mammals. It can cause respiratory distress, stillbirth and neonatal death, abortion, and neurological disease. The different forms of disease induced by EHV-1 infection can have dramatic consequences on the equine industry, and thus the virus represents a great challenge for the equine and scientific community. This report describes the progress of a major EHV-1 outbreak that took place in Normandy in 2009, during which the three forms of disease were observed. A collection of EHV-1...
Bellone RR, Ocampo NR, Hughes SS, Le V, Arthur R, Finno CJ, Penedo MCT.Catastrophic fractures are among the most common cause of fatalities in racehorses. Several factors, including genetics, likely contribute to increased risk for fatal injuries. A variant in the procollagen-lysine, 2-oxoglutarate 5-dioxygenase1 gene (PLOD1 c.2032G>A) was shown to cause Warmblood fragile foal syndrome type 1 (WFFS), a fatal recessive defect of the connective tissue. Screening of multiple horse breeds identified the presence of the WFFS allele in the Thoroughbred. PLOD1 is involved in cross-linking of collagen fibrils and thus could potentially increase the risk of catastrophic b...
Ueno Y, Uemura R, Niwa H, Higuchi T, Sekiguchi S, Sasaki Y, Sueyoshi M.Equine proliferative enteropathy (EPE) caused by Lawsonia intracellularis is characterized by hypoproteinemia. There are currently no reliable reports that provide a reference value for the total serum protein (TP) concentration to clinically diagnose EPE. The objective of this study was to statistically determine the reference value. Feces and sera of 99 foals with EPE-like clinical signs and of 35 healthy foals were obtained. The samples were used for specific-gene detection of L. intracellularis, TP measurement, and specific-antibody detection against L. intracellularis. Based on these resu...
Seghrouchni M, Elkasraoui H, Piro M, Alyakine H, Bouayad H, Chakir J, Tligui N, Elallali K, Azrib R.Tbourida is a traditional Moroccan equestrian sport in which 15 horses gallop 200 m in a line while riders fire into the sky with muskets. The stop is the finale and representative demands of this equestrian event. Such particular sudden stop after a fast gallop requires a hyperextension of the metacarpophalangeal joint. Indeed, it is well known that Tbourida show predisposes horses to different injuries of the hard and soft tissues of the distal forelimbs. Yet, there is a paucity of research that examined such lesions. The aim of the present study was to investigate for the first time the typ...
Wernery U, Rodriguez Caveney M, Wernery R, Raghavan R, Laroucau K, Syriac G, Thomas SM, John J, Joseph M, Jose S, Joseph S, Woo P.Six horses were challenged experimentally with a strain of Burkholderia pseudomallei isolated from a fatal case of the infection in a dromedary camel years earlier in the Emirate of Dubai. Three horses were inoculated subcutaneously and in 3 the bacterium was administered by the oral route. Four of the horses became serologically positive based on reactions to one or more of the OIE described tests for glanders. B. pseudomallei was re-isolated from the 4 serological positive horses. Only one of the subcutaneously infected horses, developed fever for 3 days. The white blood cell values and the ...
Browne C, Medlock JM.Last summer saw an unusually high number of cases of West Nile fever in horses and people in south and south-east Europe, but it is too early to tell if this was a one-off increase or a sign of things to come. Here, , , and discuss the various West Nile fever surveillance and control mechanisms in place in the UK.
Comparini L, Podestà A, Russo C, Cecchi F."The Club Foot" (or "Mismatched Foot") is an acquired or congenital flexural deformity of the distal interphalangeal joint, caused by a shortening of the musculotendinous unit of the deep digital flexor tendon. The aim of this research was to detect the incidence of the disorder in Arabian Pureblood horses, attempting to understand its causes and to analyze a possible role of inbreeding in its expression. In this breed, in fact, the pathology is widespread because in the environment of origin, the rocky desert, a hard and almost goat's hoof is not disabling so the selection against this disord...
Tuorinsky EV, Machtinger ET.House flies can have negative consequences on the welfare of horses and other equids. Fly repellents in the form of on-animal sprays, wipes, or spot-ons are the most commonly used fly control method for horses. Many products are available, but repellent efficacy and duration of effectiveness may influence repellent choice by horse owners. A better understanding of the efficacy of common fly repellent products will help guide repellent selection to reduce fly pressure on horses. To evaluate commercially available repellents, house fly behavioral inhibition after application of three products ma...
Schoster A, Kunz T, Lauper M, Graubner C, Schmitt S, Weese JS.Overgrowth of enteric clostridia in dysbiosis in horses with colic is presumed but scarcely investigated. The objective was to provide prevalence data of Clostridium difficile and Clostridium perfringens in horses with and without gastrointestinal disease in Switzerland, and investigate microbiota differences between C. difficile shedders and non-shedders. Fecal samples were taken from healthy horses (n = 103), horses with colic (n = 98) and horses with diarrhea (n = 151). Colic horses were sampled on three days. Selective enrichment culture and molecular typing for C. difficile an...
Gür S, Gürçay M, Seyrek A.Bovine enteroviruses (BEV) are members of Enterovirus genus of the family Picornaviridae. BEV1 has a broad host spectrum, including humans. The virus usually causes subclinical infection, but fatal/severe cases have also been reported in different animal species. There is quite limited data regarding BEV1 in humans. The purpose of this study is to investigate human infection and to identify possible risk factors for viral exposure. For this purpose, blood serum samples (n=1,526) were collected from a city center and nearby villagers simultaneously from humans and farm animals in Elazig provinc...
Haussler KK, Pool RR, Clayton HM.The objectives of this observational, cross-sectional study were to characterize and establish the prevalence of osseous proliferation of articular surfaces, joint margins and adjacent soft tissue attachments (i.e., joint capsule and deep spinal muscles) in a mixed population of horses of variable ages, sizes, and breeds to better capture the full spectrum of disease affecting the cervical articular processes. Cranial and caudal articular processes of the cervical and first three thoracic vertebrae (C2-T3) from 55 horses without a primary complaint of neck pain were evaluated for the presence ...
Olitsky PK, Harford CG.Young (12 to 15 day old) mice are approximately as susceptible to the virus of equine encephalomyelitis, Eastern or Western strain, when it is given intraperitoneally as are adult mice when the virus is injected intracerebrally. With this susceptibility by the intraperitoneal route as a basis, the injection of immune serum-virus mixtures intraperitoneally was found to result in protection in dilutions which give rise to infection after intracerebral inoculation. The difference of protective power by the two indicated routes was shown not to depend on the amount of inoculum nor on the age of th...
Ivester KM, Smith K, Moore GE, Zimmerman NJ, Couëtilt LL.Exposure of horses to airborne particulates during stable confinement has been linked with airway inflammation in these animals. Understanding that link requires accurate measures of exposures and greater understanding of the sources of variability in these exposures. Objective: Area and breathing zone particulate concentrations were measured over time in order to determine the relative variability introduced by daily, monthly or between horse variations. Additionally, the relationship between area and breathing zone respirable particulate concentrations was examined. Methods: The study was co...
Tutluoglu B, AtiÅŸ S, Anakkaya AN, Altug E, Tosun GA, Yaman M.This study aimed to investigate the rate of occupational sensitization to horse hair in grooms and whether occupational exposure to horse hair increases respiratory and allergic symptoms and affects lung function in grooms or not. Methods: This is a cross-sectional study. Two hundred grooms were randomly selected among 1000 grooms working in Veliefendi Hippodrome of Istanbul. One hundred and twenty-five subjects agreed to enter the study. Ninety-two workers who worked in the different parts of this hippodrome enrolled as the control group. A detailed questionnaire including respiratory and all...
Gharekhani J, Yakhchali M, Berahmat R.Knowledge on neosporosis and associated risk factors in different species of animals are so important for designing the control programs and reduce the economic losses globally. This literature review targeted for evaluating the infection rate of in animals in Iran. Until April 2020, all of published documents in the main English and Persian-language databases were searched. A total number of 110 documents (English = 85 and Persian = 25) were extracted. Most of reports were sero-epidemiological studies using ELISA in Iranian cattle population. The range of infection was 3.8-76.2% in ...
Boxell AC, Gibson KT, Hobbs RP, Thompson RC.To assess the occurrence of gastrointestinal parasites in horses in Perth. To apply polymerase chain reaction (PCR) for the identification of some species of encysted larval cyathostomes. Methods: Between February and September of 2000, the gastrointestinal tracts of 29 horses submitted to a local knackery and Murdoch University Veterinary hospital in Perth were examined post mortem for the presence of gastrointestinal parasites. Methods: The gastrointestinal tract was divided into six sections, which were screened for the presence of parasites such as Gasterophilus sp, Anoplocephala sp and Pa...
Nilsson O, Ljungström BL, Höglund J, Lundquist H, Uggla A.Distal ileum, caecum and proximal colon of 470 horses were examined for helminths during 1 year at an abattoir in central Sweden. The infection levels of the horse tapeworm Anoplocephala perfoliata, their stage of development, site of attachment and gross pathological lesions caused by the worm were recorded. Faecal samples from 395 of the horses were examined specifically for tapeworm segments and eggs in order to correlate these findings with the numbers in the alimentary canal. In total 65% of the horses were infected with A. perfoliata and the mean intensity of infection was 79 worms per i...
Olivo G, Lucas TM, Borges AS, Silva RO, Lobato FC, Siqueira AK, da Silva Leite D, Brandão PE, Gregori F, de Oliveira-Filho JP, Takai S, Ribeiro MG.Diarrhea is a major clinical problem affecting foals up to 3 months of age. The aim of this study was to identify enteric microorganisms involved in monoinfections and coinfections and the associated virulence factors in healthy and diarrheic foals. Diarrheic (D) ( = 56) and nondiarrheic (ND) foals ( = 60) up to three months of age were studied. Fecal samples were analyzed for identification of infectious agents (microbiological culturing, molecular techniques, and microscopic analyses). (30% versus 25%), spp. (25% versus 7%), (25% versus 25%), type A (21% versus 10%), (20% versus 35%), ...
Bosh KA, Powell D, Shelton B, Zent W.To improve efficiency at the farm level, a better understanding of how farm management factors impact reproductive performance is important. Objective: To assess reproductive efficiency and effectiveness among Thoroughbred mares in central Kentucky. Methods: A cohort of 1011 mares on 13 farms in central Kentucky was followed during the 2004 mating and 2005 foaling season. Information on farm level practices was collected via interviews with farm managers. Reproductive records were collected for each mare mated to obtain information on mare characteristics. The influence of mare age and status ...
Rusnak JM, Glass PJ, Weaver SC, Sabourin CL, Glenn AM, Klimstra W, Badorrek CS, Nasar F, Ward LA.Licensure of a vaccine to protect against aerosolized Venezuelan equine encephalitis virus (VEEV) requires use of the U.S. Food and Drug Administration (FDA) Animal Rule to assess vaccine efficacy as human studies are not feasible or ethical. An approach to selecting VEEV challenge strains for use under the Animal Rule was developed, taking into account Department of Defense (DOD) vaccine requirements, FDA Animal Rule guidelines, strain availability, and lessons learned from the generation of filovirus challenge agents within the Filovirus Animal Nonclinical Group (FANG). Initial down-selectio...
Ataseven VS, Dağalp SB, Güzel M, Başaran Z, Tan MT, Geraghty B.In this report we examined the presence of specific antibodies against equine herpesvirus type 1 (EHV-1), and equine herpesvirus type 4 (EHV-4) in several equidae, including mules, donkeys, horses. The presence of EHV-1 and EHV-4 in respiratory diseases of equids, and ability of multiplex nested polymerase chain reaction (PCR) screening in simultaneous diagnosis of horses acutely infected by EHV-1 and EHV-4 were also investigated. Sera from 504 horses, mules and donkeys sampled were tested for the presence of EHV-1 and EHV-4 specific antibodies. Blood samples taken from 21 symptomatic horses a...
Narankhajid M, Yeruult C, Gurbadam A, Battsetseg J, Aberle SW, Bayartogtokh B, Joachim A, Duscher GG.Ticks are cosmopolitan vectors of numerous diseases, and detection of various pathogens in ticks can help to assess their distribution. In the current study, 528 adult ticks were collected from grazing animals or the ground in ten different Mongolian provinces. Dermacentor nuttalli constituted 76.1% of them and was found in all ecozones except the eastern desert. Dermacentor marginatus (8.3%), Dermacentor silvarum (1.1%) and Ixodes persulcatus (3.0%) were found in the northern forest areas and Hyalomma asiaticum (11.4%) only in the southern (semi-)desert. Of these, 359 ticks were subjected to ...
Matsuda M, Moore JE.In the present review article, recent molecular advances relating to studies with Taylorella equigenitalis, as well as the recently described second species of the genus Taylorella, namely Taylorella asinigenitalis, have been described. Molecular genotyping of T. equigenitalis strains by pulsed-field gel electrophoresis (PFGE) after digestion with the suitable restriction enzyme(s) enabled the effective discrimination of strains, thus allowing the examination of the scientific mechanism(s) for its occurrence and transmission of contagious equine metritis (CEM). Alternatively, polymerase chain ...
Bolfa P, Jeon I, Loftis A, Leslie T, Marchi S, Sithole F, Beck C, Lecollinet S, Zientara S, Hans A, Issel CJ.Equines in the West Indies are used for recreational purposes, tourism industry, racing and agriculture or can be found in feral populations. Little is known in the Caribbean basin about the prevalence of some major equine infectious diseases, some with zoonotic potential, listed as reportable by the OIE. Our objective was to study the prevalence of antibodies for West Nile Virus (WNV), Equine Herpes Virus-1 and 4 (EHV-1 and EHV-4), Equine Influenza (EI), Equine Viral Arteritis (EVA) and Equine Infectious Anemia Virus (EIAV) using a retrospective serological convenience study. We used 180 equi...
De Souza PN, Bomfim TC, Huber F, Abboud LC, Gomes RS.To detect Cryptosporidium sp., Giardia sp. and Eimeria leuckarti in horses, fecal samples were collected from three different handling horse groups from the state of Rio de Janeiro, Brazil. Group A was composed of "Mangalarga Marchador" pure breed horses, Group B was formed by horses of a Military Corporation and Group C by stray horses captured by the Center of Zoonosis Control Paulo Dacorso Filho. A total of 396 fecal samples were collected, 212 samples from Group A, 154 samples from Group B and 30 from Group C. The material was submitted to the centrifugation - flotation technique and stain...
Livesay GJ, O'Neill T, Hannant D, Yadav MP, Mumford JA.In July 1989 influenza A/equine-2 (H3N8) was isolated from a nasopharyngeal swab taken from a non-thoroughbred horse exhibiting acute clinical respiratory disease. This was the first isolation of equine influenza virus in the United Kingdom since 1981. Subsequent investigations of acute respiratory disease in horses indicated that the infection was dispersed throughout the UK. However, unlike the previous epidemic of 1979, the first horses from which the virus was isolated had been vaccinated. This outbreak of influenza provided an opportunity to evaluate an antigen capture ELISA, directed aga...
West Nile fever (WNF) is a viral disease of wild birds transmitted by mosquitoes. Humans and equids can also be affected and suffer from meningoencephalitis. In Algeria, since the 1994 epidemic, no data on WNV circulation was available until 2012. In September 2012, a fatal human case of WNV neuro-invasive infection occurred in Jijel province. This study describes the first seroprevalence study of West Nile virus (WNV) antibodies conducted in the equine population in Algeria. During 2014, serum samples were collected from 293 equids (222 donkeys and 71 horses) asymptomatic and unvaccinated for...
Velie BD, Knight PK, Thomson PC, Wade CM, Hamilton NA.Studies of Thoroughbred racing populations have provided evidence of a positive effect on racing careers for horses that commence racing as 2-year-olds. Currently, research investigating the presence of this effect in the Australian Thoroughbred racing population is limited. Objective: To investigate the association between age at first start and career length in the Australian Thoroughbred population and estimate the risk of racing retirement for horses racing in Australia based on age at first start, career earnings, number of starts as a 2-year-old and distance raced. Methods: Data were col...
Varcasia A, Garippa G, Pipia AP, Scala A, Brianti E, Giannetto S, Battelli G, Poglayen G, Micagni G.Between March 2003 and February 2007, the livers and the lungs of 2,231 horses from various Italian regions were examined for cystic echinococcosis presence at the time of slaughter. Hydatid cysts were found in six horses, namely four from Sardinia, one from Sicily, and one from Tuscany. The location, number, morphology, and fertility of the cysts found were determined. DNA was extracted from the germinal layers and protoscoleces of the fertile cysts and polymerase chain reactions (PCR) were performed in order to strain type DNA isolates for reduced nicotinamide adenine dinucleotide dehydrogen...
Hockenhull J, Creighton E.UK leisure horses are owned primarily for riding. Ridden behaviour problems may compromise the use of the horse in this role and lead to harsh redress or relinquishment of the horse. Despite the consequences of these problems little is known about their prevalence or the working lives of UK leisure horses. Objective: To generate data on the work undertaken by leisure horses, the equipment and training practices used with them and prevalence of ridden behaviour problems. Methods: An internet survey was used to generate horse-level data from a convenience sample of leisure horse carers. Responde...
Sumbria D, Das Singla L, Sharma A.A cross-sectional study was conducted in Submountain undulating, Undulating plain, Western and Western plain agro-climatic zones of Punjab province, India, to determine the prevalence, agreement between diagnostic tests and associated related risk factors of Theileria equi and Babesia caballi infection in equids (horses, donkey, mules). An overall prevalence of 14.14 and 0.0% of T. equi and B. caballi was recorded by multiplex polymerase chain reaction targeting 18S ribosomal RNA (rRNA) for both the parasites and 75 and 1.11% by competitive enzyme-linked immunosorbent assay in a representative...
Laabassi F, Lecouturier F, Amelot G, Gaudaire D, Mamache B, Laugier C, Legrand L, Zientara S, Hans A.An outbreak of equine influenza (EI) was reported in Algeria between May and July, 2011. The outbreak started in Tiaret, in west province of Algeria, and spread to the other parts of the country affecting almost 900 horses in many provinces. The population studied was composed of 325 horses from different groups of age. Clinical sign expression was age dependent. Indeed, a morbidity rate of 14.9% was observed in horses under 15Â months old and a rate of 4.95% in horses over 8Â years old. Interestingly, the morbidity rate raised sharply to reach 100% in horses aged between 18Â months and 7Â yea...
The Journal of parasitologyJanuary 23, 2003
Volume 88, Issue 6 1130-1134 doi: 10.1645/0022-3395(2002)088[1130:GHOPIL]2.0.CO;2
Chapman MR, French DD, Klei TR.A survey in Louisiana of gastrointestinal helminths recovered at necropsy from 117 ponies with minimal exposure to anthelmintics between 1989 and 2000 is compared with a survey conducted 20 yr earlier in the same region. An objective of this study was to determine whether species diversity has been affected by the advent and use of the macrocyclic lactone (ML) parasiticides and by the increased anthelmintic pressure on the helminth species infecting the general equine population. Twenty-six cyathostome species and 8 strongyle species were recovered. Two cyathostome species that were not found ...
Nemoto M, Tsunemitsu H, Imagawa H, Hata H, Higuchi T, Sato S, Orita Y, Sugita S, Bannai H, Tsujimura K, Yamanaka T, Kondo T, Matsumura T.Using a total of 2018 fecal samples collected between 2003 and 2008 from foals with diarrhea, the molecular epidemiology of group A equine rotaviruses circulating in Japan was investigated by the reverse transcription-polymerase chain reaction (RT-PCR) typing and sequence analysis of the VP4 (P type) and VP7 (G type) genes. A total of 1149 samples showed positive reactions with RT-PCR, of which 462 samples (40.2%) were positive for G3 type, 502 samples (43.7%) were positive for G14 type, and 185 samples (16.1%) were positive for both G3 and G14 types. To examine P types, 59 G3 and 56 G14 posit...
Brault SA, Bird BH, Balasuriya UB, MacLachlan NJ.Equine herpesvirus-2 (EHV-2) infection has been implicated as a cause of a variety of clinical disorders in young horses, including upper respiratory tract disease, generalized malaise, fever, pharyngeal lymphoid hyperplasia, and lymphadenopathy. Considerable sequence heterogeneity has been demonstrated previously among EHV-2 strains, and individual horses can be concurrently infected with more than one virus strain. In this study, the temporal variation of the viral load and genomic diversity of the glycoprotein B (gB) gene of EHV-2 in the nasal secretions of a cohort of foals was characteriz...
Shnaiderman-Torban A, Navon-Venezia S, Dor Z, Paitan Y, Arielly H, Ahmad WA, Kelmer G, Fulde M, Steinman A. We aimed to investigate the prevalence, molecular characteristics and risk factors of extended-spectrum β-lactamase (ESBL)-producing (ESBL-E) shedding in horses. A prospective study included three cohorts: (i) farm horses (13 farms, n = 192); (ii) on hospital admission (n = 168) and; (iii) horses hospitalized for ≥72 h re-sampled from cohort (ii) (n = 86). Enriched rectal swabs were plated, ESBL-production was confirmed (Clinical and Laboratory Standards Institute (CLSI)) and genes were identified (polymerase chain reaction (PCR)). Identification and antibiotic susceptibility were determi...
Glaser AL, de Vries AA, Rottier PJ, Horzinek MC, Colenbrander B.Sero-epidemiological surveys have revealed that equine arteritis virus (EAV) is prevalent in most European countries. The virus causes sporadic cases of respiratory disease and abortion in horses, the incidence of which has increased in recent years. Mares and geldings eliminate virus after acute infection, but 30% to 60% of stallions become persistently infected. In these animals, EAV is maintained within the reproductive tract and is shed continuously in the semen. Persistent infection with EAV in stallions has no negative consequences for fertility but mares inseminated with virus-contamina...
Henley WE, Rogers K, Harkins L, Wood JL.Survival analysis was used to assess risk factors for fatal injuries on UK race courses. This allowed assessment of variation due to temporal horse-level effects, including previous racing intensity and historical distribution of race types, as well as race-level factors. Comparisons were made between measuring survival time as number of days and as number of races to injury from the first race. Two related models were presented for time as number of races to injury: a Cox regression model fitted using partial likelihood, with the Efron approximation to handling ties, and a discrete-time logit...
Payne RC, Sukanto IP, Djauhari D, Partoutomo S, Wilson AJ, Jones TW, Boid R, Luckins AG.Cattle, buffaloes and horses in several areas of Indonesia were examined for evidence of infection with Trypanosoma evansi by the microhaematocrit centrifugation technique (MHCT) and an enzyme-linked immunosorbent assay (ELISA) for detection of antibodies to T. evansi. Evidence of infection was found in animals at each sampling site although differences were seen in prevalence rates between sites. Prevalence rates in buffalo were usually higher than in cattle in the same area while in horses they were much lower than in cattle or buffalo. An age-dependent prevalence rate was seen in buffalo an...
Bártová E, Sedlák K, Syrová M, Literák I.During January 2007, blood samples were collected from 552 healthy horses from nine different regions of the Czech Republic. Sera were tested for serum antibodies to Neospora caninum by a competitive-inhibition enzyme-linked immunosorbent assay and confirmed by an indirect fluorescent antibody test. The same samples were tested for serum antibodies against Toxoplasma gondii by a latex agglutination test. In total, 131 of 552 (24%) horses reacted positively for Neospora antibodies in competitive-inhibition enzyme-linked immunosorbent assay; seven of them had > or =50% of inhibition. Samples wer...